Method for preparing carbon microspheres and application of heteropolyacid in carbon microsphere preparation and graphitization

The invention discloses a method for preparing carbon microspheres and application of heteropolyacid (phosphomolybdic acid, silicomolybdic acid, silicotungstic acid and the like) in carbon microsphere preparation and graphitization. The application is characterized in that: the heteropolyacid serving as a catalyst oxidizes resin into carbon microsphere precursors in solution, and the carbon microsphere precursors are further carbonized to obtain the carbon microspheres; and the carbon microspheres using the resin as a carbon source are subjected to catalytic graphitization. The method is characterized in that: the resin is used as the carbon source, the heteropolyacid is used as the catalyst, the heteropolyacid is converted into a molybdenum oxide catalyst during the carbonization of the resin, the preparation of the carbon microspheres is performed in the solution, the graphitization treatment is performed under argon atmosphere in a graphitization furnace, and the thermal treatment temperature ...

System and method for implementing QoS control of end-to-end service of heterogeneous network

The invention relates to a system and a method for implementing QoS control of an end-to-end service of a heterogeneous network, wherein, the system comprises a service layer entity unit which is positioned in a service layer and used for verifying a service which requests access and sending a service access request containing QoS parameters to a control layer entity unit; the control layer entity unit which is positioned in a control layer and used for determining the strategic decision under the current resources of the heterogeneous network according to the using status of the resources ofthe current heterogeneous network and then issuing to a transmission layer entity unit; and the transmission layer entity unit which is positioned in a transmission layer and used for converting the strategic decision issued by the control layer entity unit to a strategy of the end-to-end service of the heterogeneous network and carrying out operation on the end-to-end surface of the heterogeneous network ...

Medicinal composition contg. glucoside of pueravia flower and its application

Expanded vitrified micro-bead fireproof thermal-insulation board and preparation method thereof

The invention relates to an expanded vitrified micro-bead fireproof thermal-insulation board and a preparation method thereof, belonging to the field of construction materials. In the invention, inorganic expanded vitrified micro-beads, which are used as main raw materials, are combined with an organic binder, molded in a die and sintered, so that the expanded vitrified micro-beads are bound to form a compact single-layer board; and meanwhile, in the sintering process, the content of organic matters in the thermal-insulation board is greatly reduced to further enhance the fire resistance of the fireproof thermal-insulation board, thereby obtaining the fireproof thermal-insulation board with favorable comprehensive properties. The preparation technique of the expanded vitrified micro-bead fireproof thermal-insulation board is simple; and the expanded vitrified micro-bead fireproof thermal-insulation board has the advantages of low coefficient of thermal conductivity, high strength, excellent ...

M-LVDS high-speed serial communication control method in mechanica arm system

There is a sort of M-LVDS high-speed serial communicator of the machine-arm system and the communication control method, it relates to the technique field of high-speed serial communicator. It resolves the problem that the communication speed of the communication trunk which is between the superior machine and the hypostatic machine of the existing manipulator is too low, thereby it leads to the hypostatic machine does not renovate the angle expected number, the speed number, the accelerated speed number of the articulation and the gravity data that the articulation endures. The main M-LVDS driving transceiver and the serial communication port of the M-LVDS driving transceiver connect with the serial trunk. Its step is in that: each division node reads their address data, waits time, and receives the deferent data of the serial trunk. The main node waits time, the main node that its cycle is T breaks the sending data, and the division node receives the data and the check of the cycle redundancy ...

NOVEL BACILLUS THURINGIENSIS GENE WITH LEPIDOPTERAN ACTIVITY

INSECTICIDAL PROTEINS AND METHODS FOR THEIR USE

Compositions and methods for controlling pests are provided. The methods involve transforming organisms with a nucleic acid sequence encoding an insecticidal protein. In particular, the nucleic acid sequences are useful for preparing plants and microorganisms that possess insecticidal activity. Thus, transformed bacteria, plants, plant cells, plant tissues and seeds are provided. Compositions are insecticidal nucleic acids and proteins of bacterial species. The sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest including plants, as probes for the isolation of other homologous (or partially homologous) genes. The pesticidal proteins find use in controlling, inhibiting growth or killing Lepidopteran, Coleopteran, Dipteran, fungal, Hemipteran and nematode pest populations and for producing compositions with insecticidal activity.

Rapamycin analogs

Locating connector for installing concrete filled steel tube column in manual excavating pile

The invention discloses a locating connector for installing a concrete filled steel tube column in a manual excavating pile, which comprises a main component which is formed by welding two cuboid steel bars in a vertical crossing way; the centre point of the main component is a locating centre point; the four end parts of the main component are respectively welded with a locating component and a plurality of connecting components, wherein the locating component is the cuboid steel bar, and the bottom end of the locating component is lower than that the of main component; the connecting components are long-strip steel bars, arranged in a vertical way and have the tops higher than those of the main component and the locating component and the bottom ends lower those thereof. The locating connector can accurately locate the concrete filled steel tube column within pile foundation, and leads the concrete filled steel tube column to be steadily connected with the pile foundation, thus beingespecially ...

Compound having anti-itching activity

The invention discloses a novel compound having an anti-itching activity, which is as shown in general formula (I) and has obvious anti-itching activity. The invention also relates to a method for preparing the compound and intermediate products thereof.

Biodegradable butane diacid ester, preparation method and application thereof

The invention relates to biodegradable butane diacid ester, which belongs to polyethylene glycol copolyesters with the sequential number average molecular weights of 35 KDa to 45 KDa and 400 KDa to 500 KDa obtained through fused esterification polymerization at 85 to 95 DEG C via microwave heating respectively by polyethylene glycol with the number average molecular weight between 400 and 20000 and butane diacid or butanedioic anhydride, wherein the mol ratio of the polyethylene glycol to the butanedioic anhydride is 1/9 to 11, and the mol ratio of the polyethylene glycol to the butane diacid is 1/1.5 to 2.0. The butane diacid ester of the invention can be used as embedding agents of antitumor drug of camptothecin slow-release agents, and the obvious slow-release characteristics and PH sensitive response performance are given to the camptothecin after the embedding.

Bottom light source component for lamp inspector

The utility model discloses a bottom light source component for a lamp inspector, which comprises a bottom light source and a hollow shaft, wherein the hollow shaft is arranged above the bottom light resource and internally provided with a concave lens. The utility model has the advantages that the bottom light source component is simple in structure, uniform in light guide and convenient to detect, and the like.

Image processing method and related equipment thereof

The invention provides an image processing method and related equipment thereof, and relates to the technical field of image.The method comprises the steps that a first interface is displayed, and the first interface comprises a first control; detecting a first operation on the first control; obtaining an original image in response to the first operation; determining an albedo image, a normal image and an environment image corresponding to the original image; performing definition enhancement processing on the albedo image to obtain a high-definition albedo image; and determining a target image according to the original image, the high-definition albedo image, the normal image and the environment image. According to the method, the albedo image decomposed from the original image is subjected to definition enhancement processing, so that a high-quality shot image can be obtained.

Shuffling of codon altered genes

Real-time distortion correction method and system of lens with high precision and wide field of view

The invention discloses a real-time distortion correction method and a system of a lens with high precision and wide field of view, belonging to the field of computer vision and computer graphics. The method comprises: a preliminary correction step of establishing a projection equation and finding a space point corresponding to an image point on an image plane according to the projection equation, an optimization step of carrying out error analysis on the preliminarily corrected image to obtain the error of the preliminarily corrected image, and an LUT (Look Up Table) establishment step of correcting the deviation of the projection equation in the preliminary correction step through the error obtained in the optimization step and establishing a mapping relationship between any point on the image and a point on the space. In the invention, in order to simplify the model, the tangential distortion is ignored in the preliminary correction, but the influences caused by the tangential distortion ...

Speed chain electricity meter detecting assembly line

The invention relates to a speed chain electricity meter detecting assembly line. Double layers of sliding plates are adopted. A work area comprises nineteen detecting stations. At the first station, electricity meters are fed, and 12-volt electricity is added to detect whether the electricity meters are powered on or not. The second station is vacant. At the third station, a bar code and a tool plate ID are read. The fourth station and the fifth station are vacant. The sixth station, the seventh station, the eighth station, the ninth station, the tenth station, the eleventh station, the twelfth station and the thirteenth station are in a group, and a stopper and a photoelectric switch are arranged at the tail end of the thirteenth station. After the electricity meters operate to the thirteenth station and a light path is blocked, a power-up system powers up the electricity meters on the tool plate and circularly displays flat valley electricity meter data, and each station is correspondingly ...

Nocardia seriolae fluorescence quantitative PCR detection kit and detection method

The invention discloses a nocardia seriolae fluorescence quantitative PCR detection kit and a nocardia seriolae fluorescence quantitative PCR detection method. The detection kit comprises 10.0 microliters of SYBRPremix ExTaqTM special agent, 10 micromol/L upstream primer solution and 0.8 microliters of downstream primer solution, and is characterized in that the nucleotide sequence of the upstream primer is 5,TGCTACAATGGCCGGTACAGAG3; and the nucleotide sequence of the downstream primer is 5,TTCACGAGGTCGAGTTGCAGAC3. The detection method comprises pathogenic bacteria extraction, pathogenic bacteria enzymolysis, DNA coarse extract preparation, DNA coarse extract purification and detection. The detection kit can detect nocardia seriolae in early stage sensitively, quickly, quantificationally and specifically. The sensitivity of the detection kit is up to 10 to 6 microgram/ microliter, the quantification can be realized basically on the level of 10 to 5 microgram/microliter.

Water retention particle preparation method

The invention relates to a water retention particle preparation method, wherein acrylic acid, acrylamide, ammonia water, ammonium persulfate, N.N-dimethyl bisacrylamide, sodium hyposulfite and water are combined and prepared into the water retention particles. According to the present invention, the whole production process does not require external auxiliary heating while the sodium hyposulfite is used as the self-initiation thermal agent, such that the temperature of the mixed liquid is automatically increased to achieve natural polymerization forming so as to form the product in a short time; the whole implementation process does not require relevant facilities and equipment while the simple facilities such as the corrosion resistance barrel, the disk and the like are utilized so as to substantially reduce the investment risk; the production process is not limited by the production environment, the full-opening type production can be achieved at the room temperature, even at the low ...

Conductive lead-free tin alloy -coated copper belt for solar photovoltaic cell

The invention discloses a conductive lead-free tin alloy-coated copper belt for a solar photovoltaic cell. The conductive lead-free tin alloy-coated copper belt for the solar photovoltaic cell consists of a copper belt (1) and a tin alloy layer (2) coated outside the copper belt (1), and is characterized in that the tin alloy layer (2) comprises the following components in percentage by weight: 0.10 to 2.00 percent of Cu, 0.01 to 0.30 percent of Ti, 0.01 to 0.50 percent of Si, 0.05 to 0.8 percent of P, and the balance of Sn. The tin alloy coating of the lead-free tin alloy-coated copper belt of the invention contains no lead, so that the material reduces the damage to human health and the pollution to the environment in the production and application processes of the material, has remarkable environmental protection advantages, and adapts to international lead-free, environmental protection and green resource trend. The lead-free tin alloy-coated copper belt of the invention is mainly used ...

Novel constructs and their use in metabolic pathway engineering

INSECTICIDAL COMBINATIONS OF PIP-72 AND METHODS OF USE

STRUCTURE BASED METHODS FOR MODIFICATION OF PIP-72 POLYPEPTIDES AND PIP-72 POLYPEPTIDES DERIVED THEREFROM

Compositions and methods for controlling pests are provided. The methods involve transforming organisms with a nucleic acid sequence encoding an insecticidal protein. In particular, the nucleic acid sequences are useful for preparing plants and microorganisms that possess insecticidal activity. Thus, transformed bacteria, plants, plant cells, plant tissues and seeds are provided. Compositions are insecticidal nucleic acids and proteins of bacterial species. The sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest including plants, as probes for the isolation of other homologous (or partially homologous) genes. The pesticidal proteins find use in controlling, inhibiting growth or killing Lepidopteran, Coleopteran, Dipteran, fungal, Hemipteran and nematode pest populations and for producing compositions with insecticidal activity. Structure based methods for engineering insecticidal proteins of the disclosure to have modified physical properties are provided. 1. A recombinant PIP-72 polypeptide comprisinga) at least 50% identity to the amino acid sequence of SEQ ID NO: 2; andb) a structure comprising a hydrophobic interface surface.2. The recombinant PIP-72 polypeptide of claim 1 , wherein the structure further comprises a flat β-sandwich formed by the packing of a β-sheet 1 and a β-sheet 2.3. The recombinant PIP-72 polypeptide of claim 2 , wherein the flat β-sandwich is approximately 35 Å×28 Å×21 Å.4. The recombinant PIP-72 polypeptide of claim 3 , wherein the β-sheet 1 comprises the N-termini claim 3 , C-termini claim 3 , a β-strand 1 (β1) claim 3 , a β-strand 4 (β4) claim 3 , a β-strand 7 (β7) and a β-strand 8 (β8).5. The recombinant PIP-72 polypeptide of claim 4 , wherein β1 and β4 as well as β7 and β8 are antiparallel claim 4 , whereas β1 and β4 are parallel to one another.6. The recombinant PIP-72 polypeptide of claim 5 , wherein β1 comprises residues about 4 to about 9 claim 5 , β4 comprises ...

Method for preparing chicken feather keratin degradable plastics

The invention relates to a method for preparing chicken feather keratin degradable plastics, which comprises that: (1) chicken feather is dissolved, centrifugated and added with a keratin complexing agent; (2) keratin powder and long chain quaternary ammonium are added into a container, added with deionized water for thermostatic waterbath, introduced with nitrogen, added with potassium peroxodisulfate and sodium sulfite solution, and added with mixed liquid of carboxymethyl starch, polybasic carboxylic acid and quaternary ammonium salt of chitosan in stirring; and after mixture liquid is obviously thickened, reaction liquid is immediately poured into calcium chloride solution for reaction in thermostatic waterbath; and (3) modified keratin powder, sodium alginate, carboxymethyl chitosan and modified soy protein are mixed and then put into a mould, TEC tri-ethyl citrate, amino polyether and ethanol water are evenly mixed and added into the mould dropwise, and then the mould is heated and ...

System and method for detecting IRC bot network based on data packet sequence characteristics

The invention discloses a method for detecting an IRC bot network based on data packet sequence characteristics. The method finishes the detection of the IRC bot network through the cooperative work of an off-line basic data acquisition module, an on-line data real-time analysis module, a data center and a detection strategy control module. The thought of the method comprises that the method uses the periodicity and size characteristic of data packet size sequences during communicating between an IRC botmaster and a C and C (Command and Control) control server, identifies and acquires the IRCflow at the network outlet, and judges the periodicity of IRC session and the size mean value of a data packet so as to detect the IRC bot network. The method has the main innovation point of distinguishing the RC chat application and the IRC bot network by measuring the periodicity and the mean value of the data packet sequences in the communication process between the IRC botmaster and the C and C ...

INSECTICIDAL PROTEINS AND METHODS FOR THEIR USE

INSECTICIDAL PROTEINS AND METHODS FOR THEIR USE

Compositions and methods for controlling pests are provided. The methods involve transforming organisms with a nucleic acid sequence encoding an insecticidal protein. In particular, the nucleic acid sequences are useful for preparing plants and microorganisms that possess insecticidal activity. Thus, transformed bacteria, plants, plant cells, plant tissues and seeds are provided. Compositions are insecticidal nucleic acids and proteins of bacterial species. The sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest including plants, as probes for the isolation of other homologous (or partially homologous) genes. The pesticidal proteins find use in controlling, inhibiting growth or killing Lepidopteran, Coleopteran, Dipteran, fungal, Hemipteran and nematode pest populations and for producing compositions with insecticidal activity.

Nitrate transport components

Medium barrier glow discharge reactor at atmospheric pressure

The invention discloses a medium barrier glow discharge reactor at atmospheric pressure, which sequentially comprises a fine line electrode, a barrier medium and an outer electrode from inside to outside, wherein a screen is arranged between the outer electrode and the barrier medium, the diameter of a mesh in the screen is between 0.01mm and 0.08mm, and the diameter of a steel wire for forming the screen is between 0.03mm and 0.08mm. A layer of screen structure is coated between the outer electrode and a medium barrier layer, and the invention can have the advantages of corona discharge and medium barrier discharge simultaneously. The screen is in direct contact with the back of the barrier medium, and mesh line crossing points are uneven so that an electric field at the mesh line crossing points is slightly higher than that of other places under the action of additional voltage; the corona discharge is generated before air gap breakdown to play a role of corona preionization; and the ...

METHODS FOR FORMING INJECTION MOLDING COMPONENT AND QUARTER WINDOW, GUIDE RAIL, QUARTER WINDOW, VEHICLE DOOR AND VEHICLE

Rubisco Activase with increased thermostability and methods of use thereof

Mobile equipment power supply system

The invention discloses a mobile equipment power supply system, which consists of a fixed part and a mobile part. A fixed bracket is arranged at the bottom of the fixed part; a rotating shaft on the fixed bracket is connected with a central rotating frame body; a guide rail is longitudinally arranged on the central rotating frame body; and a counter weight block is connected on a sliding mechanism which is matched with the guide rail. One end of a steel wire rope is connected with the sliding mechanism through a fixed pulley which is arranged on the top of the central rotating frame body, and the other end of the steel wire rope passes through a lead frame to be connected with a follow-up rotating mechanism which is arranged on the top of the mobile part. A limit block which is arranged on the fixed bracket is positioned on the upper part of the sliding mechanism; an electric wire of which one end is connected with a power supply facility is connected to mobile power equipment through the ...

Method for extracting and separating kaempferol from impatiens balsamina

The invention discloses a method for extracting and separating kaempferol from impatiens balsamina, which relates to a method for extracting and separating active ingredients of traditional Chinese medicaments, in particular to a method for extracting and separating the kaempferol. The method is provided to solve the problems of complicated kaempferol preparation process and high cost of the current kaempferol preparation process. The method comprises the following steps of: firstly, extracting the impatiens balsamina to obtain a total extract; secondly, purifying the total extract by using macroporous resin to obtain a crude kaempferol product; and finally, preparing a pure kaempferol product by using a column chromatography and re-crystallization method. The method can effectively separate the kaempferol monomer from the impatiens balsamina, provides a reference product for performing the quality detection of Chinese medicaments containing the kaempferol and is favorable for developing ...

Metal belt hot immersion plating apparatus

The metal belt hot immersion plating apparatus features that after the metal belt is upwards drawn via metal melt to coat the melt metal, the belt is made to pass through a protecting tube, which is sealed by the upper and lower metal melt and cooling liquid and filled with protective inert gas, and the cooling liquid layer to modify the coating layer via continuous quick cooling. The coating thus produced has fine and compact crystal structure and high brightness. The apparatus of the present invention has simple structure, good hot immersion plating effect and relatively lower production cost and is mainly used in hot immersion plating of metal belt.

Monoclonal antibody, Fab antibody and application for neutralizing enterohemorrhagic escherichia coli o157:H7 shiga toxin II

The invention belongs to the technological field of medicine bioengineering, more particularly relates to a monoclonal antibody neutralizing enterohemorrhagic escherichia coli O157:H7 shiga toxin II, Fab antibody sequences and the application. The monoclonal antibody is prepared by hybridoma cell strains with the preservation number of CCTCC: C200822. The antibody of the invention can be used forpreparing medicines for diagnosing and treating EHEC O157 infections and the complicating diseases thereof.

Method for preparing molecular self-assembly porous vermiculite air purification material

The present invention relates to a method for preparing a molecular self-assembly porous vermiculite air purifying material. The method comprises that: (1) vermiculite is subjected to acid cleaning, alkali cleaning and alcohol cleaning sequentially; and finally, the vermiculite is washed by deionized water and dried; (2) the vermiculite is soaked in a 0.01 to 0.1mol/l surfactant solution; after the surface of the vermiculite is assembled with a layer of organic unimolecule film, the vermiculite is taken out; a surface physical adsorption composition is washed out; and the vermiculite is dried in vacuum; (3) the vermiculite is soaked in 0.15 to 0.35 mol/L sol; an SnCl2 solution is taken out and injected to the sol; PdCl2 is taken out and dripped to the sol; the mixture is kept stand, stirred and separated; a loose layer is washed out; and the mixture is dried; and (4) the step (2) and the step (3) are repeated for three to four times; and the mixture is calcined to obtain the molecular self-assembly ...

Online monitoring numerical-control system based on network architecture

The invention discloses an online monitoring numerical-control system based on a network architecture, comprising a numerical-control machine tool, an embedded online monitoring unit, a long-distance fault diagnosis center and a standard interface, wherein the embedded online monitoring unit is provided with an independent center processing unit which is independently arranged in the system and comprises a PC (Personal Computer)/104 bus, a signal conditioning module, a data acquisition card and an online monitoring module, used for realizing data acquisition and online monitoring and buildingdata transmission in weak-coupling connection with the numerical-control machine tool and connected with the long-distance fault diagnosis center through the standard interface so as to carry out fault data transmission; and the numeral-control machine tool and the long-distance fault diagnosis center are connected through the standard interface to realize information interaction. The invention realizes ...

Preparation method of gamma-C deuterium-substituted glutamic acid

The invention relates to a preparation method of gamma-C deuterium-substituted glutamic acid. In the method, glutamic acid is reacted with a DCl solution so as to prepare the gamma-C deuterium-substituted glutamic acid. The method comprises the following specific steps: (a) adding the glutamic acid and DCl in a reactor at a certain molar ratio; (b) sealing the reactor, wherein the reaction temperature is 100-150 DEG C, and the reaction time is 8-12 hours; and (c) reacting in the reactor so as to obtain the deuterium-substituted glutamic acid. The method is simple and has the advantages of high yield, mild reaction condition and the like.

Semiconductor structure and method for forming same

A semiconductor structure and a method for forming same, the forming method including: providing a base, where a dummy gate structure is formed on the base, an interlayer dielectric layer is formed on the base the dummy gate structure exposes, and the interlayer dielectric layer exposes the top of the dummy gate structure; forming an isolation structure in the interlayer dielectric layer between adjacent dummy gate structures, where the isolation structure further extends into the base; after forming the isolation structure, removing the dummy gate structure and forming a gate opening in the interlayer dielectric layer; filling a gate electrode material into the gate opening, where the gate electrode material further covers the top of the interlayer dielectric layer; and performing at least one polishing treatment to remove the gate electrode material above the top of the interlayer dielectric layer and retaining the gate electrode material in the gate opening as a gate electrode layer, ...

Prediction model enhancement

An enhanced prediction model utilizing product life cycle segmentation and historic prediction data for generating more accurate future failure rates. Input data is segmented into groups based on failure modes of a corresponding life cycle. A prediction model such as Weibull analysis is implemented for each segmented group. Historical prediction data is also segmented into groups. Prediction parameters for each group of segmented historical prediction data are compared with one another and the comparisons are then used to adjust the prediction parameters generated from the segmented groups of input data. Updated parameters for the input data are then output thereby generating a new future failure rate.

Ultraviolet navigation sensor

The invention discloses an ultraviolet navigation sensor which employs an optical system with two spectrum bands images different objects to respective independent areas on the target surface of a photodetector, simultaneously are divided into two independent viewing field channels which respectively image earth and stars. The photodetector converts images of the earth and the stars into a stimulating signal to output. An electrical system samples, extracts and converts the stimulating signal to obtain digital images. At last, an image and attitude computing element respectively processes theultraviolet earth information and the visible light star information and computes and obtains a geocentric vector, an orbit height and an inertial attitude needed by satellite navigation. The ultraviolet navigation sensor employs the technique of sub-spectrum-bands, sub-viewing-fields and sub-imaging-areas, and resolves the problem that the photodetector simultaneously images the earth and the stars ...

M-LVDS high-speed serial communication device in mechanical arm system and communication control method thereof

There is a sort of M-LVDS high-speed serial communicator of the machine-arm system and the communication control method, it relates to the technique field of high-speed serial communicator. It resolves the problem that the communication speed of the communication trunk which is between the superior machine and the hypostatic machine of the existing manipulator is too low, thereby it leads to the hypostatic machine does not renovate the angle expected number, the speed number, the accelerated speed number of the articulation and the gravity data that the articulation endures. The main M-LVDS driving transceiver and the serial communication port of the M-LVDS driving transceiver connect with the serial trunk. Its step is in that: each division node reads their address data, waits time, and receives the deferent data of the serial trunk. The main node waits time, the main node that its cycle is T breaks the sending data, and the division node receives the data and the check of the cycle redundancy ...

New method for wireless communication of variable pitch control system of large-size wind generator set

The invention relates to a new method for wireless communication of a variable pitch control system of a large-size wind generator set. As a core component of a wind generator set, the variable pitch control system of the wind generator set plays a very important role in integrated design of a blower control system. According to the new method for wireless communication of a variable pitch control system of a large-size wind generator set, two Bluetooth communication modules FL Bluetooth Bluetooth BLUETOOTH AP (1) are used for communication; and the two Bluetooth communication modules perform end-to-end transmission on data between a master control system and the variable pitch system, wherein the end-to-end transmission is performed in a wireless communication manner. The invention is used for wireless communication of a variable pitch control system of a large-size wind generator set.

Method for preparing Meixianduoxin

This invention relates to a method for preparing metadoxine. The method comprises: adding isopropanol to mixed solid powder of vitamin B6 alkali and pyroglutamic acid, reacting at 25-45 deg.C for 30 min-24 h, filtering, and drying the solid to obtain metadoxine. The mol. ratio of vitamin B6 alkali to pyroglutamic acid is 1:1. The weight ratio of pyroglutamic acid to isopropanol is 1 :( 1.0-4). The content of deionized water in isopropanol is 0-5%. The method has such advantages as no need for refinery, low solvent consumption, low cost, simple process, easy operation and high yield, and is suitable for industrialization. The obtained drug-grade metadoxine can be used to treat acute and chronic alcoholism and alcoholic liver disease.

Transmission method and system for geographical message data

The invention discloses a transmission method for geographical information data. The transmission method comprises: a latitude and longitude range needed to be displayed is obtained according to the position of the current view point; the hierarchy n of the geographical information data to be downloaded is confirmed; the geographical information data comprises the topography data and the image data of a plurality of precision hierarchies and the model data of at least one precision hierarchy; the topography data and the image data of the n layer in the latitude and longitude range are arranged into a downloading queue; the preset attribute of the n layer is searched and whether the model data is needed to be downloaded or not under the hierarchy is judged; if yes, the model data in the latitude and longitude range in the corresponding hierarchy is arranged in the downloading queue; the data transmitted by a server is received by a user terminal and romance is carried out on the data so ...

Use of red sage root extract in preparing antithrombotic pharmaceutical composition

CODING METHOD FOR THE INPUT OF TIBETAN LANGUAGE AND ITS KEY BOARD

It relates to a kind of coding rules to input Tibetan language and its key-board, and belongs to the domain of computer science. This invention provides many kinds of codings for input including a word pattern code, latin translated word code, zone-bit code; and the corresponding keyboards for them are designed. The cole of this invention is simple, easy to remember, directly perceivable, conformed to the writing rules of the Tibetan language, less frequency for keying and its input speed is fast. It is fits for spreading in usage.

INSECTICIDAL PROTEINS AND METHODS FOR THEIR USE

Compositions and methods for controlling pests are provided. The methods involve transforming organisms with a nucleic acid sequence encoding an insecticidal protein. In particular, the nucleic acid sequences are useful for preparing plants and microorganisms that possess insecticidal activity. Thus, transformed bacteria, plants, plant cells, plant tissues and seeds are provided. Compositions are insecticidal nucleic acids and proteins of bacterial species. The sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest including plants, as probes for the isolation of other homologous (or partially homologous) genes. The pesticidal proteins find use in controlling, inhibiting growth or killing Lepidopteran, Coleopteran, Dipteran, fungal, Hemipteran and nematode pest populations and for producing compositions with insecticidal activity.

Bamboo powder filling biodegradable compound material and preparation method thereof

The invention relates to a bamboo powder filling biodegradable compound material and a preparation method thereof. The bamboo powder filling biodegradable compound material comprises the following raw materials in part by mass: 30 to 80 parts of biodegradable resin, 20 to 70 parts of bamboo powder, 1 to 19 parts of plasticizer, 0.6 to 6 parts of interface modifier and 4 to 12 parts of aids. The preparation method comprises the following steps of: uniformly mixing the biodegradable resin, bamboo powder, plasticizer, interface modifier and auxiliary agent by using a mixer according to formula proportion; performing melt blending and granulation of the obtained mixture by using a screw extruder to obtain particles; and processing the particles by using an injection molding machine, a sheet extrusion forming machine, a blow molding machine or a film blowing machine, and molding in molds of different shapes to obtain the bamboo powder filling biodegradable compound materials of different shapes ...

Visual light navigation sensor

The invention discloses a visible light navigation sensor, which employs visible light spectrum bands with different widths and a dual-channel optical system to image different objects to independent areas of a target surface of a same photodetector. The optical system is divided into two independent viewing field channels which respectively image quasars and stars. The photodetector convert images of the quasars and the stars into simulating signal to output. An electrical system processes the stimulating signal and converts to obtain digital images. At last, an image and attitude computing element respectively processes the quasar image information and the stars image information to compute and obtain a quasar center vector, an orbit height and an inertial attitude needed by satellite navigation. The visible light navigation sensor employs the technique of the visible light spectrum bands with different widths, sub-viewing-fields and sub-image-areas to resolve the problem that the photodetector ...

Electric heating element structure for vacuum thermos

The invention relates to an electric heating element structure for a vacuum thermos, and is characterized in that the electric heating element structure comprises a vacuum interlayer side wall and a bottom, the vacuum interlayer side wall is provided with an inward flanged edge, the bottom is higher than the inward flanged edge and is provided with a heating plate, a ring is arranged below the periphery of the bottom, the bottom is connected with the inward flanged edge of the vacuum interlayer side wall through the lower ring of the ring, the heating plate comprises an upper metal plate, an electric heating plate and an aluminum alloy plate, the electric heating plate is arranged below the metal plate, the aluminum alloy plate is arranged below the electric heating plate and is provided with an outward flanged edge, and the outer diameter of the outward flanged edge of the aluminum alloy plate is slightly smaller than the inner diameter of the ring arranged below the periphery of thebottom ...

Floating automatic water sampler

The invention discloses a water sampler which is simple, portable and easy to operate. Users can collect water samples in different locations and at different depths by the bank. Based on environmental science research and the actual situation of work practice, the water sampler not only solves the problem of manual sampling, but also improves the work efficiency and safety factor of outdoor water sampling activity, thus saving labor power and material resources and bringing convenience to science researchers and environment workers. The floating automatic water sampler consists of four parts, namely, a structure system, a power control system, a water sampling system and an automatic control system. The water sampler, adopting the structure, can receive instructions of operators ashore and arrive at an appointed location to collect water samples, and can collect the water samples at different depths in different locations according to a preset sampling depth. The water samples collected ...

CODING METHOD FOR INPUT OS TIBETAN LANGUAGE AND ITS KEYBOARD

NOVEL INSECTICIDAL PROTEINS AND METHODS FOR THEIR USE

Compositions and methods for controlling pests are provided. The methods involve transforming organisms with a nucleic acid sequence encoding an insecticidal protein. In particular, the nucleic acid sequences are useful for preparing plants and microorganisms that possess insecticidal activity. Thus, transformed bacteria, plants, plant cells, plant tissues and seeds are provided. Compositions are insecticidal nucleic acids and proteins of bacterial species. The sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest including plants, as probes for the isolation of other homologous (or partially homologous) genes. The pesticidal proteins find use in controlling, inhibiting growth or killing Lepidopteran, Coleopteran, Dipteran, fungal, Hemipteran and nematode pest populations and for producing compositions with insecticidal activity. 113.-. (canceled)14. (canceled)15. The recombinant AfIP-1A polypeptide of claim 16 , comprising the amino acid motifs as represented by positions 15-26 of SEQ ID NO: 257 claim 16 , positions 33-53 of SEQ ID NO: 257 claim 16 , positions 71-84 of SEQ ID NO: 257 claim 16 , and positions 100-107 of SEQ ID NO: 257.16. A recombinant AfIP-1A polypeptide having at least 85% identity to the amino acid sequence of SEQ ID NO: 2.18. The recombinant AfIP-1A polypeptide of claim 16 , wherein the AfIP-1A polypeptide comprises the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 94.19. The recombinant AfIP-1A polypeptide of claim 16 , wherein the AfIP-1A polypeptide comprises one or more property selected from:a) an amino acid motif as represented by positions 15-26 of SEQ ID NO: 257;b) an amino acid motif as represented by positions 33-53 of SEQ ID NO: 257;c) an amino acid motif as represented by positions 71-84 of SEQ ID NO: 257;d) an amino acid motif as represented by positions 100-107 of SEQ ID NO: 257;e) fungicidal activity;f) insecticidal activity;g) a calculated molecular weight of ...

金属带热浸涂装置

... 本发明装置的特征是，把连续通过熔体金属液后上引拉出的、表面已涂有熔体金属的金属带，穿过上下被熔体金属液及冷却液密封的、充有惰性保护性气体的保护管，再通过冷却液层连续速冷来修饰涂层，所得涂层结晶细密，光亮度很高。本发明装置结构简单，热浸涂效果好，生产成本较低，主要用于金属带热浸涂。 ...

Method for preparing controllable photodegraded flexible indoor air purifying material

The invention relates to a method for preparing a controllable photodegraded flexible indoor air purifying material. The method comprises the following steps of: (1) preparing a photocatalyst with a hollow heterogeneous structure; (2) treating the surface of a flexible base material and setting an intermediate protective layer; and (3) printing a print agent onto the flexible base material by a method for screen printing, and preparing the controllable photodegraded flexible indoor air purifying material after drying and washing. The preparation method is simple and easy for operation and is applicable to industrial scale production; and the prepared controllable photodegraded flexible indoor air purifying material can remove indoor typical pollutants with high efficiency, such as formaldehyde, benzene, toluene, volatile organic matters and other harmful substances.

Method for fixing lead pollution in soil using seashore paspalum turfgrass

The invention relates to a method for fixing lead pollution in soil by utilizing seashore paspalum lawns, which belongs to the field of environmental improvement. The seashore paspalum lawns are planted on the soil with different lead pollution degrees by the method and the lead in the soil is absorbed and fixed through the dense underground root networks of the seashore paspalum lawns so as to prevent the rain water leaching loss of lead infectants in the soil. The seashore paspalum lawns can form dense ground surface lawn coverage, thereby preventing the lead polluted soil from spreading through raise dust. The lead content in leaves on the seashore paspalum lawns is extremely less and is only 6 to 13 percent of that in the soil and the lead is fixed in leaf tissues, thereby isolating the risk of contacting the lead pollution of people. In addition, the seashore lawns also have better sight effect and soil fixing effect and have double effects of fixing plants of the polluted soil and ...

Fast robust approximately same video detection and exclusion method

The invention relates to a method for quickly detecting and eliminating similar or identical videos of fast robust, which belongs to the technical field of information mining. The method comprises the followings stages: an extraction stage for the characteristics of key frame of the video to be detected; video characteristics generation stage of generated video global characteristics and a pattern matching stage capable of completing detection for similar or identical videos by comparing the global characteristic vector of the video to be detected with the global characteristic vector of the existing video, wherein, the video characteristics generation stage comprises the following steps: partitioning images of the key frame; extracting the average gray of each block, so as to serve as key frame characteristic; performing binaryzation quantification on the key frame characteristic by utilizing principal component analysis method; and generating global characteristic on the basis of the ...

INSECTICIDAL PROTEINS FROM PLANTS AND METHODS FOR THEIR USE

INSECTICIDAL PROTEINS AND METHODS FOR THEIR USE

Compositions and methods for controlling pests are provided. The methods involve transforming organisms with a nucleic acid sequence encoding an insecticidal protein. In particular, the nucleic acid sequences are useful for preparing plants and microorganisms that possess insecticidal activity. Thus, transformed bacteria, plants, plant cells, plant tissues and seeds are provided. Compositions are insecticidal nucleic acids and proteins of bacterial species. The sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest including plants, as probes for the isolation of other homologous (or partially homologous) genes. The pesticidal proteins find use in controlling, inhibiting growth or killing Lepidopteran, Coleopteran, Dipteran, fungal, Hemipteran and nematode pest populations and for producing compositions with insecticidal activity.

Rare earth and cement activated grinding aid

The invention discloses a rare earth and cement activated grinding aid, which solves the problems that the traditional cement grinding aid has poor grinding aid effect and cannot simulate and activate the strength of cement. The rare earth and cement activated grinding aid is characterized by comprising 7-10 percent of rare earth compound, 33-48 percent of inorganic compound, 40-50 percent of organic compound and 5-7 percent of high molecular polymer. The rare earth and cement activated grinding aid is formed by mixing various raw materials which are fine particles with the particle size of 100-200 meshes with water and then compounding. The rear earth and cement activated grinding aid has the advantages that the strength of the cement at each age is improved, the consumption of cement clinker is reduced and the doping amount of a cement mixed material and the quality of the cement are improved. In addition, the rare earth and cement activated grinding aid is suitable for cement production ...

INSECTICIDAL PROTEINS WITH ACTIVITY AGAINST HEMIPTERA AND METHODS OF USE

INSECTICIDAL PROTEINS AND METHODS FOR THEIR USE

Compositions and methods for controlling pests are provided. The methods involve transforming organisms with a nucleic acid sequence encoding an insecticidal protein. In particular, the nucleic acid sequences are useful for preparing plants and microorganisms that possess insecticidal activity. Thus, transformed bacteria, plants, plant cells, plant tissues and seeds are provided. Compositions are insecticidal nucleic acids and proteins of bacterial species. The sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest including plants, as probes for the isolation of other homologous (or partially homologous) genes. The pesticidal proteins find use in controlling, inhibiting growth or killing Lepidopteran, Coleopteran, Dipteran, fungal, Hemipteran and nematode pest populations and for producing compositions with insecticidal activity.

INSECTICIDAL PROTEINS AND METHODS FOR THEIR USE

Compositions and methods for controlling pests are provided. The methods involve transforming organisms with a nucleic acid sequence encoding an insecticidal protein. In particular, the nucleic acid sequences are useful for preparing plants and microorganisms that possess insecticidal activity. Thus, transformed bacteria, plants, plant cells, plant tissues and seeds are provided. Compositions are insecticidal nucleic acids and proteins of bacterial species. The sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest including plants, as probes for the isolation of other homologous (or partially homologous) genes. The pesticidal proteins find use in controlling, inhibiting growth or killing Lepidopteran, Coleopteran, Dipteran, fungal, Hemipteran and nematode pest populations and for producing compositions with insecticidal activity.

Radioactive sustained-release particle and preparation and use thereof

The invention discloses a radioactive slow-release particle and a preparation method and the application thereof, pertaining to the field of radiation medicine. The particle mainly consists of <32> P-chromium phosphate and poly-L-lactic acid and can better solve the problem of targeted delivery of drugs in the treatment of tumors. The transplant of the particles in a tumor body or around a tumor can increase the local concentration of the drug, prolong the time of drug action and reduce systemic toxic and side effects.

INSECTICIDAL PROTEINS AND METHODS FOR THEIR USE

System for controlling gas circuit of chromatographic sample

The invention belongs to a real-time monitoring system, is a system for controlling a gas circuit of a chromatographic sample aiming at the pressure change in a gas circuit of a chromatographic sample of a data logging unit in the oil industry, and is characterized in that the sample gas is divided into two circuits by a tri-way valve, one circuit leads to a chromatograph via a sample pump and a vacuum gauge; the other circuit leads to an air pressure sensor, the output end of the air pressure sensor is connected with the input end of an instrumentation amplifier, the output end of the instrumentation amplifier is electrically connected with the signal input end of an A/D converter, and the data output end and the control end of the A/D converter are electrically connected with the data end and the control end of a singlechip respectively; the I/O port of the singlechip is electrically connected with a sound-light alarm circuit and an LED numeral tube display; and the I/O port of the singlechip ...

Method for forming automobile glass covered edge, window and mould

The invention relates to a method for forming an automobile glass covered edge, a window and a mould. Specifically, the method for forming the automobile glass covered edge includes: forming a polymer solution containing a bubble nucleus, which is formed through a foaming agent; and by means of inhibiting expansion of the bubble nucleus on at least part of a cavity inner wall, injecting a bubble nucleus containing polymer solution into the mould to conduct injection moulding treatment, thus forming the automobile glass covered edge. The automobile glass covered edge formed according to the invention has no chromatic aberration or raised grain.

'Jindan' soft capsule, and its prepn. method

Chinese globeflower soft capsule and its preparation method

Layout optimization method and device for distributed power supply, equipment and storage medium

The invention discloses a layout optimization method and device for a distributed power supply, equipment and a storage medium. The method comprises the steps of obtaining network frame parameters of a power distribution network; a distributed power supply layout model of the power distribution network is determined according to the network frame parameters, and the distributed power supply layout model comprises a to-be-optimized variable, a constraint condition of the to-be-optimized variable and a target function; and determining an optimal solution of the distributed power supply layout model, and determining the optimal solution as a layout optimization parameter of the distributed power supply to optimize the layout of the distributed power supply. The network frame influence of the power distribution network is included in the layout optimization factors of the distributed power supply, so that the problem that the existing distributed power supply layout determination mode is single ...

FREQUENCY-COMPENSATED TRANSCONDUCTANCE AMPLIFIER

The present invention provides a frequency-compensated transconductance amplifier, includes an input stage consisting of NMOS transistors M and M, a first-stage active load consisting of PMOS transistors M and M, a first-stage tail current source consisting of a constant current source Iss, a second-stage input transistor consisting of a PMOS transistor M, a second-stage constant current source consisting of an NMOS transistor M, a load capacitor consisting of a capacitor C, and a frequency compensation network formed by sequentially connecting a gain stage GAIN, a compensating resistor Rc and a compensating capacitor Cc in series. 1123456. A frequency-compensated transconductance amplifier , comprising: an input stage consisting of NMOS transistors M and M , a first-stage active load consisting of PMOS transistors M and M , a first-stage tail current source consisting of a constant current source Iss , a second-stage input transistor consisting of a PMOS transistor M , a second-stage constant current source consisting of an NMOS transistor M , a load capacitor consisting of a capacitor C , and a frequency compensation network where a gain stage GAIN , a compensating resistor Rc and a compensating capacitor Cc are connected in series; wherein{'b': 1', '2', '1', '2', '1', '3', '3', '4', '2', '4', '5, 'gates of the NMOS transistors M and M are connected to an input signal Vin, sources of the NMOS transistors M and M are grounded through a constant current source Iss, a drain of the NMOS transistor M is connected to one end of the gain stage GAIN, a drain of the PMOS transistor M and gates of the PMOS transistors M and M, a drain of the NMOS transistor M is connected to a drain of the PMOS transistor M and a gate of the PMOS transistor M;'}{'b': 3', '4', '5', '5', '6', '6', '6, 'sub': L', 'L, 'sources of the PMOS transistors M, M and M are connected to a supply voltage vdd, a drain of the PMOS transistor M, one end of a compensation capacitor Cc, a drain of the NMOS ...

Pressure automatic control system and method

The invention discloses a pressure automatic control system and method. The pressure automatic control system comprises an upper computer, a PLC (programmable logic controller), an external device, a signal collector and an external device controller, wherein the signal collector and the external device controller are connected with the PLC; the PLC samples, analyzes and controls the external device through the signal collector and the external device controller; the control method of the pressure automatic control system comprises the following steps of working personnel operation, operationto the upper computer, sampling and analyzing to the signal collector by the PLC, controlling to the external device controller by the PLC and action of the corresponding external device. The pressure automatic control system has a fine tuning function for automatically increasing and reducing pressure according to the actual requirements of different construction stages, thus, influence of artificial ...

Well logging quantitative interpretation method based on fast chromatographic analyzer

The invention relates to the field of petroleum well logging, in particular to a well logging quantitative interpretation method based on a fast chromatographic analyzer, which is characterized by at least comprising the following steps of: (1) extracting samples; (2) outputting volume percentage parameters of sample de-aerated gas by the fast chromatographic analyzer; (3) submitting the data of the fast chromatographic analyzer (7) to a processing unit for processing; (4) classifying each well obtained by a sampling well drilling system according to the performance of oil contained in the stratum layer by layer; (5) storing the parameters calculated at the step (3) and the stratum contained oil classifying layers obtained at the step (4) in the same layer, finding out common options of each stratum contained oil classifying layer distributed in all sampling drilled wells and corresponding layer analyzing parameters, solving the minimum of the common options of all sampling drilled wells ...

Method for treating oily sewage

The invention discloses a method for treating oily sewage, which treats the oily sewage by using microwave radiation heating. In the invention, the microwave radiation which has the characteristics of short time, less energy consumption and high efficiency is utilized to treat the oily sewage, and the efficiency is improved by 20 times compared with the conventional heat treatment efficiency; the settled sewage oil length after the microwave heating is decreased by 6.1-91.8% compared with the settled oil length without heating; and under the condition of the same heating and settlement treatment, the sewage-remaining oil length through the microwave heating is reduced by 10.03-282.78% compared with the sewage-remaining oil length through water bath heating. The sewage treated by using the method is easy to recycle oils; the method is a clean and energy-saving technology for efficiently treating and separating the oily sewage in an oil-gas field and has excellent application prospect in ...

Macrolide analogue drug double sidechain illotycin A derivative, synthesis method and uses

The invention relates to double side-chain abomacetin A derivatives, process for preparing them, method for preparing the medicinal compositions and their use in preparing potential medicament for antibiosis and antivirus. Their constitutional formula is disclosed in the specification.

Method and apparatus for manufacturing pure spirit

The invention relates to a method and an apparatus for manufacturing pure spirits, belonging to the technical field of brewing of distilled liquor and other alcoholic beverages. The apparatus comprises a rectification device, an active carbon adsorption tank, a filtering device and a pure spirit storage tank; the rectification device comprises a distillation still, a rectifying tower and a condenser, the top of the distillation still communicates with the bottom of the rectifying tower, and a steam inlet of the condenser communicates with a steam outlet on the top of the rectifying tower; thedischarge outlet of the distillation still of the rectification device communicates with the feed inlet of the active carbon adsorption tank, the discharge outlet of the active carbon adsorption tankcommunicates with the feed inlet of the filtering device, and the discharge outlet of the feed inlet of the filtering device communicates with the feed inlet of the pure spirit storage tank. According to ...

Method for synthesizing nickel oxide nano particles by one step

The invention relates to a method for preparing nickel oxide nano particles, and discloses a method for synthesizing nickel oxide nano particles by one step. The method is characterized by comprising the following steps: matching 0.5 to 2 mmol of nickel salt, 2 to 4 mL of surfactant and 5 to 10 mL of 1-octadecene solvent, and selecting the nickel salt, the surfactant and the 1-octadecene for later use; mixing the nickel salt, the surfactant and the 1-octadecene, placing the mixture into three flasks, removing air of the system by adopting water-free oxygen-free technology, and stirring the mixture at the temperature under the protection of nitrogen till the solid is fully dissolved; then, heating the mixture to between 280 and 330 DEG C, reacting the mixture for 5 to 60 minutes after the solution is turbid, and cooling a reaction product to the room temperature; and washing the reaction product twice to thrice by mixed solution of normal hexane and ethanol, and then drying the washed product ...

Method for preventing smell of excrement of dorking

The invention specifically relates to a method for preventing smell of excrement of the general dorking during raising. The method comprises the following step of feeding fresh sugarcane and diluted EM beneficial bacterium solution on the basis of the general daily feed of the dorking. According to the method, the fed EM beneficial bacterium can effectively deodorize, sterilize and disinfect; the dorking can obtain a lot of sugar after eating the sugarcane; sugar is used as the carbon source of the EM beneficial bacterium, and sufficient carbon source enables more EM beneficial bacterium reproduced in the dorking body, and therefore, the deodorizing, sterilizing and disinfecting effects are obviously improved, and as a result, the smell of the excrement of the dorking is removed after the sugarcane and EM beneficial bacterium are fed; the problems of the smell of the excrement of the dorking and the environmental pollution can be effectively solved; the plague incidence rate in the dorking ...

System for realizing heterogeneous network QoS dynamic mapping and method thereof

The invention relates to a system for realizing heterogeneous network QoS dynamic mapping and a method thereof. The system comprises a CQA and an AQA; the AQA is configured at an access end for classifying and dynamically parameter matching the QoS which is accessed into the network and sending QoS control information which is generated by the QoS classifying and parameter matching information which is accessed into the network to the CQA; when dynamic QoS adjustment is required, the QoS control information is updated and sent to the CQA; and the CQA is configured at a core network end for building QoS initiate homeostatic mapping according to the QoS control information sent by the AQA and adjusting QoS mapping relationship according to the updated QoS control information sent by the AQA.Therefore, the system and the method guarantee the operation of the service quality of the heterogeneous network, optimize network resource management, and maximally obtain better customer satisfaction ...

Metal texture rock plate

The invention belongs to the technical field of post-treatment of ceramics, and particularly discloses a metal texture rock plate. The metal texture rock plate sequentially comprises a green body, metal ground glaze, digital cover glaze, digital glue, metal dry particles and protective glaze from inside to outside, the metal ground glaze comprises an auxiliary agent, calcium silicate, metal powder, a modified metal oxide and a solvent; the modified metal oxide is obtained by reacting 5-carboxyphthalide with L-tertiary leucine to generate a dicarboxylic acid derivative and modifying a metal oxide. The prepared rock plate is fine and smooth in metallic luster, and has good antifouling and wear-resistant properties.

Permanent-magnet type electricity loss brake electricity-saving control device

Method for separating and purifying phycophage from blue algae outbreak water body

The invention discloses a method for separating and purifying phycophage from a blue algae outbreak water body. The method is characterized by comprising the following steps of: A) acquiring a water sample of the surface layer of a blue algae outbreak natural water area, filtering the water sample through a micropore filter membrane, and concentrating the filtered water sample to obtain a concentrated water sample; B) preparing mixed solution of the concentrated water sample and patina microcystis liquid of a logarithmic phase, obtaining patina microcystis cracked solution by culturing, and judging that the water sample contains the phycophage when the color of the water sample becomes transparent; and C) filtering the cracked solution through the micropore filter membrane, removing patina microcystis cracked fragments, concentrating the solution by an ultra-filtration system, centrifuging and purifying the phycophage by using CsCl density gradient, putting a strip sucking viruses in the ...

Infrared gas detection system suitable for oil-containing gas analysis of reservoir

The invention relates to the technical field of gas detection, in particular to an infrared gas detection system suitable for oil-containing gas analysis of a reservoir, which is characterized by comprising a vacuum pump, wherein the vacuum pump is used for dedusting and drying gas desorbed in a drilling process and conveying the desorbed gas into a constant-current stabilizer through a gas pipeline; after the flow of the gas is stabilized by the constant-current stabilizer, the gas enters from an inlet of a detection chamber and is continuously exhausted from an outlet of the detection chamber; the detection chamber comprises a temperature control mechanism used for thermostatically heating and controlling a heating element in the detection chamber so that the detection chamber forms a constant-temperature gas chamber; three infrared light sources, namely a light hydrocarbon gas infrared light source, a heavy hydrocarbon gas infrared light source and a CO2 infrared light source, which ...

Wide-angle lens and atomic filter-based optical signal detection system

The invention discloses a wide-angle lens and atomic filter-based optical signal detection system, which belongs to the field of photoelectric signal detection. The system comprises a wide-angle lens, an atomic filter and an photoelectric sensor which are arranged in turn in the propagation direction of light, wherein the wide-angle lens is a wide-view field lens or a fish-eye lens with the view field angle reaching over 60 degrees; the atomic filter is a Faraday-type atomic filter or a Voigt-type atomic filter; and the photoelectric sensor is a high-forming quality image sensor or a commonly used photoelectric detection sensor such as a complementary metal-oxide-semiconductor transistor (CMOS), charged-coupled device (CCD) or the like. In the system, the view field angle of the wide-angle lens is large, so that the wide-view field detection is easy to realize, system capture time is reduced, and software and hardware cost are reduced. The atomic filter has the characteristic of extremely ...

Preparation method of laser modified titanium dioxide photocatalyst

The invention discloses a preparation method of a laser modified titanium dioxide photocatalyst, which belongs to the technique field of environmental pollution treatment and the research field of new energy sources, and the method comprises the following steps: 1) surface treatment of a high-strength and high-elasticity porous polyester fiber net; 2) loading the titanium dioxide photocatalyst; and 3) modification of a titanium dioxide film by laser. The method is to sequentially carry out the protective sorting to the polyester fiber net according to the cleaned fiber net surface, then coat a film on the fiber net surface by using a sol-gel-coating method and taking tetra-iso-propyl titanate and isobutyl alcohol as raw materials under the weak base condition, and modify the film in a textile laser processor. The invention has advantages of extensive sources of raw materials, simple process, low cost, good stability of the prepared titanium dioxide film, and high photo-catalytic activity ...

Task allocation method of heterogeneous multi-robot system

The invention belongs to the field of automatic control, in particular relates to a task allocation method of a heterogeneous multi-robot system, which comprises the following steps: S1, initializing robots and subtask parameters; S2, executing subtasks with high information concentration near the robots and close to self-capacity and subtask ability requirement by the robots, wherein the robots are skilled in the subtasks. The invention fully considers the influence of a functional structure of the multi-robot system to the task allocation of the multi-robot system, and realizes the task allocation of the heterogeneous multi-robot system.

Three-dimensional quantitative fluorescence spectrum total volume integral method

The invention relates to the technical field of explanation and evaluation of a geological log in petroleum geological exploration, in particular to a three-dimensional quantitative fluorescence spectrum total volume integral method. The method comprises the following steps of: A, continuously applying excitation waves with the wavelengths of between 240 nanometers and 380 nanometers to a collected sample by using a fluorescence analyzer; B, receiving fluorescent light with the wavelengths of between 240 nanometers and 480 nanometers by using the fluorescence analyzer; C, establishing an excitation wavelength-receiving wavelength-fluorescence intensity three-dimensional space system; D, randomly generating random numbers distributed in a three-dimensional space according to a Monte-Carlo principle by using a computer; E, accumulating relative fluorescence intensities corresponding to each random number and accumulating and describing the volume integration values of the sample; and F, calculating ...

Parallel-type vehicle electrical storage energy regeneration brake system and energy-recycling method

The invention relates to a parallel-type vehicle electrical storage energy regeneration brake system and an energy-recycling method. The parallel-type vehicle electrical storage energy regeneration brake system comprises a motor, a super capacitor bank, an accumulator, a harmonic gear retarding mechanism, a torque synthesis device, an electronic control unit, a harmonic gear retarding mechanism controller, a motor controller and a super capacitor controller. A vehicle used in the energy-recycling method is provided with two sets of brake systems: a brake system of a traditional vehicle and a parallel-type electrical storage energy regeneration brake system. The two sets of brake systems singly or simultaneously run on the vehicle according to vehicle speeds, brake depths and accumulator energy values when the vehicle is braked. Energy is recycled by the parallel-type electrical storage energy regeneration brake system, and the vehicle is simultaneously or singly driven by the engine and ...

Method for treating sulfur- and hydrocarbon-containing foul waste gas

The invention discloses a method for treating sulfur- and hydrocarbon-containing foul waste gas. The waste gas enters a heat exchanger for cooling, condensed water is separated, the cooled waste gas enters an absorption tower to be absorbed by an absorbent distillate, a fresh absorbent exchanges heat with a rich absorbent discharged by the absorption tower and then is cooled by a cooling system, and the cooled absorbent enters the absorption tower; and the waste gas subjected to absorptive purification enters an adsorption tower for adsorptive purification, the adsorption tower is segmentally filled and respectively filled with silica gel adsorbents and activated carbon adsorbents, and heat exchangers are arranged among the adsorbents in each segment. The method can thoroughly purify the sulfur- and hydrocarbon-containing foul waste gas discharged by chemical engineering storage tanks, refining devices and the like, and has the advantages of simple treatment process and no potential safety ...

Hemorrhagic bacillus coli of intestine 0157:H7 shiga toxin IIB epitope peptide and uses thereof

The invention belongs to the pharmaceutical biotechnology field, and relates to enterohemorrhagic E.coli O157:H7 Shiga toxin IIB epitope peptide and the application thereof. Four preferred polypeptides are derived from B-cell epitope of the subunit (Stx2A1) of EHEC O157:H7 Shiga toxin IIB epitope peptide. The product can be applied for preparing pharmaceuticals for the diagnosis and treatment of EHEC O157 infection and complications thereof.

COMPOSITIONS AND METHODS COMPRISING SEQUENCES HAVING MEGANUCLEASE ACTIVITY

Compositions and methods comprising polynucleotides and polypeptides having meganuclease activity are provided. Further provided are nucleic acid constructs, yeast, plants, plant cells, explants, seeds and grain having the meganuclease sequences. Various methods of employing the meganuclease sequences are provided. Such methods include, for example, methods for producing a meganuclease with increased activity at a wide range of temperatures, methods for producing a yeast, plant, plant cell, explant or seed comprising a meganuclease with increased activity. 1. An isolated or recombinant polynucleotide comprising a nucleotide sequence encoding a meganuclease polypeptide , said polypeptide comprising:a) an amino acid sequence having at least one amino acid modification at an amino acid position corresponding to a position of SEQ ID NO: 1 selected from the group consisting of positions 2, 12, 16, 22, 23, 31, 36, 43, 50, 56, 58, 59, 62, 71, 72, 73, 80, 81, 82, 86, 91, 95, 98, 103, 113, 114, 116, 117, 118, 121, 124, 128, 129, 131, 147, 151, 153, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 194, 195, 196, 197, 200, 203, 204, 209, 222, 232, 236, 237, 246, 254, 258, 267, 278, 281, 282, 289, 308, 311, 312, 316, 318, 319, 334, 339, 340, 342, 345, 346, 348 and combinations thereof; or,b) an amino acid sequence having at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43 or 44 of any of the amino acid modification of (a);2. The isolated or recombinant polynucleotide of claim 1 , wherein said nucleotide sequence encodes a meganuclease polypeptide having at least 80% sequence identity to SEQ ID NO: 1.3. The isolated or recombinant polynucleotide of claim 1 , wherein said at least one amino acid modification comprises;a) an aspartic acid (D) at a ...

SYSTEM AND METHOD FOR CONVERTING DISK PARTITION FORMAT

An electronic device includes a hard disk drive for data storage. One or more programs are executed to cause the electronic device to perform a disk partition format conversion procedure. The procedure includes reading a first disk partition table (DPT) from the HDD of a first disk partition format, converting the first DPT into a second DPT in compliance with a second disk partition format, converting the HDD of the first disk partition format into the second disk partition format, and writing the second DPT to the HDD of the second disk partition format.

Comprehensive exploitation method for refuse dump

The invention aims at the problems of the comprehensive exploitation and resource utilization of a wasteyard, in particular the ancient wasteyard in which urban waste is buried or accumulated, and discloses a comprehensive exploitation method of the wasteyard. The comprehensive exploitation method comprises the following steps: firstly digging the waste in the wasteyard for sieving, separating oversized substance and undersized substance, at the same time forming a big hole in the digged wasteyard; secondly mixing the oversized substance and undersized substance as a brick making material for making the brick; thirdly crushing the oversized substance after sorting, then adding sludge which is dehydrated and calcium oxide and mixing uniformly; fourthly pressing and molding the mixture and sunning for paving or backfilling into the big hole in the wasteyard. With the method of the invention, the waste is effectively treated, simultaneously, the problems of the urban land and the consumption ...

NOVEL INSECTICIDAL PROTEINS FROM PLANTS

Compositions and methods for controlling pests are provided. The methods involve transforming organisms with a nucleic acid sequence encoding an insecticidal protein. In particular, the nucleic acid sequences are useful for preparing plants and microorganisms that possess insecticidal activity. Thus, transformed bacteria, plants, plant cells, plant tissues and seeds are provided. Compositions are insecticidal nucleic acids and proteins of bacterial species. The sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest including plants, as probes for the isolation of other homologous (or partially homologous) genes. The pesticidal proteins find use in controlling, inhibiting growth or killing Lepidopteran, Coleopteran, Dipteran, fungal, Hemipteran and nematode pest populations and for producing compositions with insecticidal activity. 1. (canceled)2. (canceled)3. (canceled)4. (canceled)5. (canceled)6. (canceled)7. (canceled)8. (canceled)9. (canceled)10. (canceled)11. (canceled)12. (canceled)13. (canceled)14. (canceled)15. (canceled)16. (canceled)17. (canceled)18. (canceled)19. (canceled)20. (canceled)21. (canceled)22. (canceled)23. (canceled)24. (canceled)25. A recombinant PtIP-65 polypeptide operably linked to a heterologous signal or leader sequence , wherein said PtIP-65 polypeptide comprises an amino acid sequence having at least 95% sequence identity , across the entire length of the amino acid sequence , compared to the amino acid sequence of SEQ ID NO: 22 , wherein said PtIP-65 polypeptide has insecticidal activity against an insect selected from Soy Bean Looper , Corn Earworm , European Corn Borer and Velvet Bean Caterpillar in combination with a PtIP-50 polypeptide comprising an amino acid sequence having at least 95% identity to SEQ ID NO: 71.26. (canceled)27. (canceled)28. (canceled)29. (canceled)30. (canceled)31. (canceled)32. (canceled)33. (canceled)34. (canceled)35. The recombinant PtIP-65 ...

Method for synthesizing manganese oxide nano-particles in one step

The invention relates to a method for preparing manganese oxide nano-particles. The method for synthesizing the manganese oxide nano-particles in one step is characterized by comprising the following steps: selecting manganese salt, a surfactant and 1-octadecylene for standby in a proportion of the manganese salt to the surfactant to the 1-octadecylene of (0.5-2)mmol:(2-4)mL:(5-10)mL; mixing the manganese salt, the surfactant and the 1-octadecylene, placing the mixture in a three-neck flask, removing air in a system by adopting waterless oxygen-free technology, and stirring the mixture under nitrogen protection at room temperature until the solid is completely dissolved; heating the solution to a temperature of between 280 and 330 DEG C, leading the solution to react for 5 to 60 minutes after the solution generates turbidness, and cooling the solution to room temperature; and washing the solution with mixed liquor of normal hexane and ethanol for 2 to 3 times, drying the solution in vacuum ...

Method for controlling cyanobacteria bloom

A method for controlling cyanobacteria bloom is characterized in that the method comprises the following steps: A) collecting a water sample of the surface layer of a natural water area where cyanobacteria bloom occurs, allowing the water sample to pass through a microporous membrane, and concentrating the water sample by an ultrafiltration system to obtain a phycophage concentrate; B) preparing a mixed solution of the phycophage concentrate and a log-phase microcystic aeruginosa solution with degradable polyurethane foam as a carrier, adding the mixed solution into a container, adding the carrier simultaneously to fix the phycophage on the carrier; C) adding the carrier into the natural water area where cyanobacteria bloom occurs with an adding amount of the fixed phycophage carrier being 0.5-1 kg per one square meter water area. Compared with the prior art, the invention has the following outstanding advantages: 1) the phycophage obtained from a water area where cyanobacteria bloom occurs ...

Electromagnetic induction insulator high-voltage current detector

This invention relates to a kind of insulator high-tension current detector of electromagnetic induction. This detector includes support insulator (1), exploring coil (2) and signal detecting circuit(3). The exploring coil built in interior of support insulator, after connect connecting terminal of support insulator's lower end, and join to signal detection circuit by signal cable. Input end of signal multiplication circuit (4) in signal detection circuit connect with connecting terminal of support insulator lower end. Output port of signal multiplication circuit connects with input end of signal identification circuit (5). Electric current indicating circuit (6) connects with output port of signal identification circuit (5). electric current indicating circuit(6) by single-chip microcomputer chip to control blazing of seven segment nixie tube to complete detecting of high tension bus bar electric current.

Self reset curvature-prevention support component

The invention relates to a self reset curvature-prevention support component, which relates to a curvature-prevention support component. The invention aims at solving the problems that the existing structure for installing a traditional curvature-prevention support component generates excessive residual deformation after major earthquake or moderate earthquake, so the maintenance and rebuilding cost after the earthquake is greatly increased, and the existing friction type self reset support component can not consume the earthquake energy because of the looseness of connecting screw bolts of afriction plate and easy ageing of the friction surface. A square inner sleeve pipe, two energy consumption inner core plates and a first convex connecting plate are connected in a square inner sleevepipe, each connecting plate is fixedly connected with a pair of angle irons, one end of each reset rib is connected with a first end plate, the other end of each reset rib is connected with a second end ...

NOVEL INSECTICIDAL PROTEINS AND METHODS FOR THEIR USE

INSECTICIDAL PROTEINS AND METHODS FOR THEIR USE

Compositions and methods for controlling pests are provided. The methods involve transforming organisms with a nucleic acid sequence encoding an insecticidal protein. In particular, the nucleic acid sequences are useful for preparing plants and microorganisms that possess insecticidal activity. Thus, transformed bacteria, plants, plant cells, plant tissues and seeds are provided. Compositions are insecticidal nucleic acids and proteins of bacterial species. The sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest including plants, as probes for the isolation of other homologous (or partially homologous) genes. The pesticidal proteins find use in controlling, inhibiting growth or killing Lepidopteran, Coleopteran, Dipteran, fungal, Hemipteran and nematode pest populations and for producing compositions with insecticidal activity.

NITRATE TRANSPORT COMPONENTS

This invention relates to isolated nucleic acid fragments encoding high affinity nitrate transport components. The invention also relates to the construction of recombinant DNA constructs encoding all or a portion of nitrate transport components, in sense or antisense orientation, wherein expression of the recombinant DNA construct may alter levels of the nitrate transport components in a transformed host cell. 1. An isolated polynucleotide comprising:(a) a nucleotide sequence encoding a high affinity nitrate transporter polypeptide, wherein the polypeptide has an amino acid sequence of at least 85% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NOs: 36-or 49; or(b) a complement of the nucleotide sequence, wherein the complement and the nucleotide sequence consist of the same number of nucleotides and are 100% complementary.2. (canceled)3. The polynucleotide of claim 1 , wherein the amino acid sequence of the polypeptide has at least 90% sequence identity claim 1 , based on the Clustal V method of alignment claim 1 , when compared to SEQ ID NO: 49.4. The polynucleotide of claim 1 , wherein the amino acid sequence of the polypeptide has at least 95% sequence identity claim 1 , based on the Clustal V method of alignment claim 1 , when compared to SEQ ID NO: 49.5. The polynucleotide of claim 1 , wherein the amino acid sequence of the polypeptide has at least 99% sequence identity claim 1 , based on the Clustal V method of alignment claim 1 , when compared to SEQ ID NO: 49.6. The polynucleotide of claim 1 , wherein the amino acid sequence of the polypeptide comprises one of SEQ ID NO: 49.7. The polynucleotide of wherein the nucleotide sequence comprises one of SEQ ID NO: 48.8. The isolated polynucleotide of claim 1 , wherein the polypeptide sequence comprises at least two motifs selected from group consisting of SEQ ID NOs: 50 claim 1 , 51 and 52.9. (canceled)10. A recombinant DNA construct comprising an isolated polynucleotide ...

UV-CURABLE, WEAR RESISTANT AND ANTISTATIC COATING FILLED WITH CARBON NANOTUBES

A methodology is provided for making UV-curable, wear resistant and antistatic coating filled with carbon nanotubes (CNTs). The composition consists of a mixture of CNTs, an acrylate-based monomer, a urethane-acrylate oligomer and a photoinitiator. The present invention provides a coating of which the wear resistance and antistatic properties are dramatically improved in comparison with the polymer substrate. This coating is suitable for protecting a variety of polymer substrates from scratch and electrostatic accumulation. 119.-. (canceled)20. A coating composition comprisingA) a urethane-acrylate oligomer,B) carbon nanotubes,C) at least one acrylate-based monomer (as diluent and reactive component) andD) a photoinitiator.21. The composition according to claim 20 , wherein at least a part of the carbon nanotubes B) comprise functional groups containing oxygen.22. The composition according to claim 20 , wherein at least a part of the carbon nanotubes B) comprise function oxygen containing functional groups which are obtained by oxidation of carbon nanotubes.23. The composition according to claim 21 , wherein the carbon nanotubes with oxygen containing functional groups are obtained by oxidation with a gas comprising ozone.24. The composition according to claim 21 , wherein the carbon nanotubes have been oxidized by simultaneous treatment with oxygen/ozone in the gas phase comprising the steps(a) placing carbon nanotubes into a reaction zone(b) passing a mixture of ozone, oxygen and water through the carbon nanotubes.25. The composition according to claim 21 , wherein the carbon nanotubes have been oxidized by applying a mixture of ozone claim 21 , oxygen and water which is passed continuously through carbon nanotubes agglomerates.26. The composition according to claim 24 , wherein during the oxidation process of the carbon nanotubes the temperature in the reaction zone is kept below 200° C.27. The composition according to claim 24 , wherein during the oxidation ...

Water vapour assisted ozonolysis of carbon nanotubes

The present invention relates to an improved process of ozonolysis of carbon nanotubes assisted by water vapour. The improved methodology provides an eco-friendly, cheaper, practical and efficient approach to functionalize carbon nanotubes with oxygen-containing moieties for further chemical functionalization and composite dispersion.

Navigation device with augmented reality navigation functionality

A navigation device includes a display, a recording medium, a navigation camera, a global positioning system (GPS), and a processor. The processor is operable to determine a current position for generating a navigation route to a destination. Based on a real-time traffic image received from the navigation camera, the processor adjusts a display scale and a display position of the navigation route, superimposes the navigation route on the real-time traffic image to generate a superimposed image, and outputs the superimposed image for viewing on the display and storage in the recording medium.

Rubisco Activase with Increased Thermostability and Methods of Use Thereof

The present invention provides thermostable polypeptides related to Rubisco Activase polypeptides. Nucleic acids encoding the polypeptides of the invention are also provided. Methods for using the polypeptides and nuclei acids of the invention to enhance resistance of plants to heat stress are encompassed. 1. An isolated nucleic acid molecule comprising any of SEQ ID NOS: 3 , 5 , 7 , 9 , 11 , 13 , 15 , 17 , 19 , 21 or a complement thereof.2. An isolated nucleic acid molecule selected from the group consisting of:a. a nucleic acid molecule comprising a nucleotide sequence which is at least 95% identical to the nucleotide sequence of any of SEQ ID NOS: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 or a complement thereof;b. a nucleic acid molecule that encodes a polypeptide comprising the amino acid sequence of any of SEQ ID NOS: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22; andc. a nucleic acid molecule that hybridizes under stringent conditions with a nucleic acid probe consisting of the nucleotide sequence of any of SEQ ID NOS: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 or a complement thereof.3. The isolated nucleic acid molecule of or , wherein the nucleic acid molecule encodes a polypeptide with increased thermostability as compared to a polypeptide of SEQ ID NO: 2.4. A vector comprising a nucleic acid molecule of or .5. The vector of that is an expression vector.6. A host cell which comprises the vector of .7. An isolated polypeptide comprising any one of SEQ ID NOS: 4 claim 4 , 6 claim 4 , 8 claim 4 , 10 claim 4 , 12 claim 4 , 14 claim 4 , 16 claim 4 , 18 claim 4 , 20 claim 4 , 22.8. An isolated polypeptide selected from the group consisting of:a. a polypeptide that is at least 95% identical to the amino acid sequence of any of SEQ ID NOS: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22;b. a polypeptide that is encoded by a nucleic acid molecule comprising a nucleotide sequence that is at least 95% identical to any one of SEQ ID NOS: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 or a complement thereof;c. ...

Anti-nematode peptides and methods of use thereof

The invention provides novel polypeptides, and variants and fragments thereof, having pesticidal activity against nematodes. Particular embodiments of the invention provide isolated nucleic acids encoding pesticidal proteins, biopesticide compositions, expression cassettes, and transformed microorganisms and plants comprising a nucleic acid of the invention. These compositions find use in methods for controlling pests, especially plant parasitic nematodes. 1. An isolated polypeptide comprising an amino acid sequence selected from the group consisting of:(a) the amino acid sequence set forth in SEQ ID NO: 1; and,(b) an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein said amino acid sequence is not SEQ ID NO:3, and wherein said polypeptide has nematicidal activity.2. An isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of:(a) the nucleotide sequence set forth in SEQ ID NO: 2;(b) a nucleotide sequence encoding an amino acid sequence comprising SEQ ID NO: 1;(c) a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 2, wherein said polynucleotide encodes a polypeptide having nematicidal activity, and wherein said polypeptide does not have the amino acid sequence set forth in SEQ ID NO:3; and,(d) a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity to SEQ ID NO: 1, wherein said amino acid sequence is not SEQ ID NO:3, and wherein said polynucleotide encodes a polypeptide having nematicidal activity.3. An expression cassette comprising the polynucleotide of .4. The expression cassette of claim 3 , wherein said polynucleotide is operably linked to a promoter that drives expression in a plant.5. A plant comprising a heterologous polynucleotide operably linked to a promoter that drives expression in the plant claim 3 , wherein said heterologous polynucleotide comprises a nucleotide sequence selected from the group consisting of:(a) the ...

Nitrate transport components

This invention relates to isolated nucleic acid fragments encoding high affinity nitrate transport components. The invention also relates to the construction of recombinant DNA constructs encoding all or a portion of nitrate transport components, in sense or antisense orientation, wherein expression of the recombinant DNA construct may alter levels of the nitrate transport components in a transformed host cell.

System and Method for Generating a Manifold Surface for a 3D Model of an Object Using 3D Curves of the Object

Various embodiments of a system and methods for generating a manifold surface of an object from a set of 3D curves which define the shape of the object are described. The set of 3D curves may be directly tessellated in the 3D domain to form a manifold surface with boundary. The tessellation may be a Delaunay tetrahedralization which represents the set of 3D curves. The surface of the tetrahedralization may contain a set of possible manifold surface solutions. A dual complex form of the tetrahedralization may be generated to reduce the number of possible manifold surface solutions. Surface patches may be generated from the dual complex form, dependent on a set of metrics that may further reduce the number of possible manifold surface solutions. Compatible surface patches may be combined to form a set of possible manifold surface solutions which may be displayed to a user. 1. A method , comprising:receiving a plurality of three-dimensional (3D) curves which define a shape of an object;generating, in a 3D domain, a tessellation which represents the plurality of 3D curves;generating, dependent on the tessellation and one or more metrics, a plurality of manifold surface solutions, wherein each one of the plurality of manifold surface solutions represents a different potential surface for a 3D model of the object; anddisplaying a representation of at least one of the plurality of manifold surface solutions.2. The method of claim 1 , wherein the plurality of 3D curves are non-intersecting curves claim 1 , wherein the plurality of 3D curves comprises open and closed 3D curves claim 1 , and wherein each one of the plurality of 3D curves has a capacity value that indicates whether a surface of the object is adjacent to one or two sides of the respective 3D curve.3. The method of claim 1 , wherein the tessellation forms a surface that connects the plurality of 3D curves claim 1 , wherein the surface comprises the plurality of manifold surface solutions claim 1 , wherein the ...

SYSTEMS AND METHODS FOR EVENT STREAM PROCESSING

Disclosed are systems and methods for processing events in an event stream using a map-update application. The events may be embodied as a key-attribute pair. An event is processed by one or more instances implementing either a map or an update function. A map function receives an input event from the event stream and publishes one or more events to the event stream. An update function receives an event and updates a corresponding slate and publishes zero or more events. Systems and methods are also disclosed herein for implementing a map-update application in a multithreaded architecture and for handling overloading of a particular thread or node. Systems and methods for providing access to slates updated according to update operations are also disclosed. 1. A method for performing event processing comprising:processing an event stream by an application executed by a computers system, the application comprising a plurality event handlers each receiving an input stream from the event stream, each event handler performing an event handling function and at least one of outputting an output stream to the event stream and updating a state;detecting an overload condition for an event handler of the plurality of event handlers; andin response to detection of an overload condition, processing at least a portion of a plurality of events received from the input stream according to a degraded handling function, the degraded handling function having lower latency than the event handling function.2. The method of claim 1 , wherein the degraded handling function is a bypass function placing at least a portion of the plurality of events received form the input stream into the output stream.3. The method of claim 1 , wherein the event handling function requires a greater number of computations than the degraded handling function.4. The method of claim 1 , wherein the event handling function accesses an external resource and the degraded handling function does not require access to ...

SYSTEMS AND METHODS FOR EVENT STREAM PROCESSING

Disclosed are systems and methods for processing events in an event stream using a map-update application. The events may be embodied as a key-attribute pair. An event is processed by one or more instances implementing either a map or an update function. A map function receives an input event from the event stream and publishes one or more events to the event stream. An update function receives an event and updates a corresponding slate and publishes zero or more events. Systems and methods are also disclosed herein for implementing a map-update application in a multithreaded architecture and for handling overloading of a particular thread or node. Systems and methods for providing access to slates updated according to update operations are also disclosed. 1. A method for performing event processing comprising:receiving, by an updater executed by a computer system, an input event from an input event stream, the updater having a slate associated therewith;deserializing a first serialization of the slate to generate a slate object;performing, by the updater, an update operation on the slate object using the input event;storing the slate object;receiving a request for the slate;in response to receipt of the request, retrieving the slate object and generating a second serialization of the slate; andreturning the second serialization responsive to the request.2. The method of claim 1 , further comprising storing the second serialization.3. The method of claim 1 , further comprising setting a flag indicating that the first serialization is invalid upon performance of the update operation on the slate object; andwherein retrieving the slate object and generating the second serialization of the slate is performed in response to an evaluation of the flag upon receiving the request for the slate.4. The method of claim 1 , further comprising setting a flag indicating the slate object is dirty upon performance of the update operation on the slat object; andwherein retrieving ...

SYSTEMS AND METHODS FOR EVENT STREAM PROCESSING

Disclosed are systems and methods for processing events in an event stream using a map-update application. The events may be embodied as a key-attribute pair. An event is processed by one or more instances implementing either a map or an update function. A map function receives an input event from the event stream and publishes one or more events to the event stream. An update function receives an event and updates a corresponding slate and publishes zero or more events. Systems and methods are also disclosed herein for implementing a map-update application in a multithreaded architecture and for handling overloading of a particular thread or node. Systems and methods for providing access to slates updated according to update operations are also disclosed. 1. A method for performing event processing comprising:evaluating an event stream;for each event of a plurality of events in the event stream, mapping the event to a mapped target instance of a plurality of target instances and adding the event to at least one queue of a plurality of queues each corresponding to a thread of a plurality of threads, each thread having at least one target instance of the plurality of target instances assigned thereto;evaluating loading of the plurality of queues;in response to the evaluation, reassigning a selected target instance of the one or more target instances associated with a first thread of the plurality of threads to a second thread of the plurality of threads; and evaluating the mapped target instance for the event; and', 'if the mapped target instance corresponds to the selected target instance, adding the event to the queue corresponding to the second thread., 'processing events in the queue corresponding to the first thread by2. The method of claim 1 , wherein each event includes an attribute and value pair.3. The method of claim 1 , wherein the plurality of target instances comprise event handlers operable to publish events to the event stream.4. The method of claim 3 ...

SYSTEMS AND METHODS FOR EVENT STREAM PROCESSING

Disclosed are systems and methods for processing events in an event stream using a map-update application. The events may be embodied as a key-attribute pair. An event is processed by one or more instances implementing either a map or an update function. A map function receives an input event from the event stream and publishes one or more events to the event stream. An update function receives an event and updates a corresponding slate and publishes zero or more events. Systems and methods are also disclosed herein for implementing a map-update application in a multithreaded architecture and for handling overloading of a particular thread or node. Systems and methods for providing access to slates updated according to update operations are also disclosed. 1. A method for performing event processing comprising:evaluating an event stream; mapping the event to at least one selected node of a plurality of worker nodes, each of the nodes executing a multithreaded process;', 'mapping the event to a target instance, the target instance including one of a map function and an update function;', 'selecting a selected thread from one of a primary thread and a secondary thread of the multithreaded process, the primary thread and secondary thread being assigned to the target instance; and', 'performing the one of a map function and an update function of the target instance on the event in the selected thread., 'for each event in the event stream2. The method of claim 1 , wherein selecting the selected thread from one of the primary thread and the secondary thread further comprises:evaluating if one of the primary thread and the secondary thread is a hotspot thread for the target instance; andselecting the hotspot thread as the selected thread if one of the primary thread and secondary thread is the hotspot thread for the target instance.3. The method of claim 2 , wherein selecting the selected thread from one of the primary thread and the secondary thread further comprises ...

Systems and methods for event stream processing

Disclosed are systems and methods for processing events in an event stream using a map-update application. The events may be embodied as a key-attribute pair. An event is processed by one or more instances implementing either a map or an update function. A map function receives an input event from the event stream and publishes one or more events to the event stream. An update function receives an event and updates a corresponding slate and publishes zero or more events. Systems and methods are also disclosed herein for implementing a map-update application in a multithreaded architecture and for handling overloading of a particular thread or node. Systems and methods for providing access to slates updated according to update operations are also disclosed.

REVERSIBLY WATER-SOLUBLE NANOCRYSTALS

A general, facile, and reversible nanocrystal (NCs) phase transfer protocol via ligand exchange using nucleotides and/or nucleosides is provided to generate reversibly water-soluble nanocrystals. This phase transfer strategy can be employed on a wide variety of chemically synthesized nanostructured materials including semiconductors, metal oxides and noble metals with different sizes and shapes. The nucleotide/nucleoside-capped nanocrystals can disperse homogeneously in aqueous or alcohol media retaining, for example, high photoluminescence quantum yields. The disclosed water-soluble nanocrystals have excellent colloidal and photoluminescent stability independent on the pH and ionic strength, minimal hydrodynamic size, and are stable in cells and suitable for in vitro cell labeling, cell tracking, and other bioimaging applications. 1. A reversibly water-soluble nanocrystal comprising a core nanocrystal capped by a plurality of nucleotides , a plurality of nucleosides or a combination thereof.2. The reversibly water-soluble nanocrystal of claim 1 , wherein the core nanocrystal is a quantum dot claim 1 , a nanorod claim 1 , a metal oxide nanocube claim 1 , or a noble metal nanodot.3. The reversibly water-soluble nanocrystal of claim 1 , wherein the core nanocrystal comprises a quantum dot having a core/shell/shell structure.46.-. (canceled)7. The reversibly water-soluble nanocrystal of claim 1 , wherein the plurality of nucleotides comprises adenosine 5′-monophosphate claim 1 , guanosine 5′-monophosphate claim 1 , cytidine 5′-monophosphate claim 1 , uridine 5′-monophosphate claim 1 , thymidine 5′-monophosphate claim 1 , or combinations thereof claim 1 , and wherein the plurality of nucleosides comprises adenosine claim 1 , guanosine claim 1 , cytidine claim 1 , uridine claim 1 , thymidine claim 1 , inosine claim 1 , or combinations thereof.8. The reversibly water-soluble nanocrystal of claim 1 , wherein the plurality of nucleotides comprises adenosine 5′-diphosphate ...

Novel Insecticidal Proteins and Methods for Their Use

Compositions and methods for controlling pests are provided. The methods involve transforming organisms with a nucleic acid sequence encoding an insecticidal protein. In particular, the nucleic acid sequences are useful for preparing plants and microorganisms that possess insecticidal activity. Thus, transformed bacteria, plants, plant cells, plant tissues and seeds are provided. Compositions are insecticidal nucleic acids and proteins of bacterial species. The sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest, as probes for the isolation of other homologous (or partially homologous) genes. The insecticidal proteins find use in controlling, inhibiting growth or killing lepidopteran, coleopteran, dipteran, fungal, hemipteran, and nematode pest populations and for producing compositions with insecticidal activity. 1. A recombinant nucleic acid molecule encoding a PIP-1 polypeptide having insecticidal activity against an insect pest in the order Hemiptera and/or an insect pest in the order Lepidoptera.2. The recombinant nucleic acid molecule of claim 1 , wherein the PIP-1 polypeptide comprises any one or more amino acid motifs as represented by positions 171-183 of SEQ ID NO: 213; positions 149-159 of SEQ ID NO: 213; and positions 64-79 of SEQ ID NO: 213.4. The recombinant nucleic acid molecule of claim 1 , or wherein the PIP-1 polypeptide has at least 80% identity to the amino acid sequence of SEQ ID NO: 2.5. The recombinant nucleic acid molecule of selected from:a) a recombinant nucleic acid molecule comprises a polynucleotide of SEQ ID NO: 1, a fragment or a complement thereof;b) a recombinant nucleic acid molecule a PIP-1 polypeptide comprises an amino acid sequence of SEQ ID NO: 2 or a fragment thereof;c) a recombinant nucleic acid molecule that hybridizes under stringent conditions to a polynucleotide of SEQ ID NO: 1;d) a recombinant nucleic acid molecule having a polynucleotide sequence of SEQ ...

Novel Insecticidal Proteins and Methods for Their Use

Compositions and methods for controlling pests are provided. The methods involve transforming organisms with a nucleic acid sequence encoding an insecticidal protein. In particular, the nucleic acid sequences are useful for preparing plants and microorganisms that possess insecticidal activity. Thus, transformed bacteria, plants, plant cells, plant tissues and seeds are provided. Compositions are insecticidal nucleic acids and proteins of bacterial species. The sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest including plants, as probes for the isolation of other homologous (or partially homologous) genes. The pesticidal proteins find use in controlling, inhibiting growth or killing Lepidopteran, Coleopteran, Dipteran, fungal, Hemipteran and nematode pest populations and for producing compositions with insecticidal activity. 1. A recombinant nucleic acid molecule encoding an AfIP-1A polypeptide.2. The recombinant nucleic acid molecule of claim 1 , wherein the AfIP-1A polypeptide comprises any one or more amino acid motifs as represented by positions 15-26 of SEQ ID NO: 257 claim 1 , positions 33-53 of SEQ ID NO: 257 claim 1 , positions 71-84 of SEQ ID NO: 257 claim 1 , and positions 100-107 of SEQ ID NO: 257.3. The recombinant nucleic acid molecule of claim 1 , wherein the AfIP-1A polypeptide has at least 80% identity to the amino acid sequence of SEQ ID NO: 2.5. The recombinant nucleic acid molecule of claim 1 , wherein the nucleic acid molecule encodes an AfIP-1A polypeptide comprising an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 94.6. A transgenic plant claim 1 , transgenic plant cell or progeny thereof claim 1 , comprising the recombinant nucleic acid molecule of .7. A transgenic plant claim 1 , transgenic plant cell or progeny thereof stably transformed with the recombinant nucleic acid molecule of .8. The transgenic plant claim 7 , transgenic plant cell or progeny thereof of claim 7 , ...

FUNCTIONAL EXPRESSION OF SHUFFLED YEAST NITRATE TRANSPORTER (YNT1) IN MAIZE TO IMPROVE NITRATE UPTAKE UNDER LOW NITRATE ENVIRONMENT

The present invention provides methods and compositions relating to altering NT activity, nitrogen utilization efficiency and/or uptake in plants. The invention relates to a method for the production of plants with maintained or increased yield under low nitrogen fertility. The invention provides isolated nitrate transporter variant (NT variant) nucleic acids and their encoded proteins. The invention further provides recombinant expression cassettes, host cells, and transgenic plants. Plants transformed with nucleotide sequences encoding the NT variant enzyme show improved properties, for example, increased yield. 1. An isolated or recombinant nucleic acid comprising a nitrate transporter (NT) variant polynucleotide or nitrate reductase (NR) polynucleotide;wherein said NT variant polynucleotide comprises a member selected from the group consisting of,(a) an NT variant polynucleotide comprising a nucleotide that has been substituted, wherein the nucleotide substitution is one or more of the substitutions shown in Table 3, and wherein the polynucleotide encodes a polypeptide having NT activity,(b) an NT variant polynucleotide encoding a polypeptide comprising an amino acid sequence that has been substituted, wherein the amino acid substitution is one or more of the substitutions shown in Table 2, and wherein the polypeptide has NT activity,(c) a polynucleotide that encodes a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 4, 6, 8 or 10,(d) a polynucleotide comprising the nucleotide sequence set forth in SEQ ID NO: 3, 5, 7, 9 or 11,(e) a polynucleotide comprising at least 30 nucleotides in length which hybridizes under stringent conditions to the complement of at least one nucleotide sequence selected from the group consisting of (a), (b), (c) and (d), wherein the conditions include hybridization in 40 to 45% formamide, 1 M NaCl, 1% SDS at 37° C. and a wash in 0.5× to 1×SSC at 55 to 60° C., and wherein the polynucleotide encodes a polypeptide ...

Fluid Treatment Methods and Systems

Methods and systems for treatment of wastewater. In some embodiments, the system may comprise one or more modules such as an electrochemical module, an electrocoagulation module, a flotation module, an evaporation module, and an ultrafiltration module. One or more detection modules may also be provided to analyze the concentration of one or more wastewater components in the wastewater. Data from such modules may be used to adjust one or more operational parameters or conditions in the treatment system. The system may also comprise one or more features designed to minimize adverse effects on the environment, such as avoiding adding chemicals to the stream, extracting salt or other chemicals for re-use, and/or use of carbon dioxide gas from on-site combustion processes. 113-. (canceled)14. A method for treating wastewater comprising:analyzing the composition of the wastewater in real-time to produce real-time data;modifying one or more modules or parameters in a wastewater treatment system using the real-time data; andincreasing a pH of the wastewater using an electrochemical treatment process and without adding any chemicals to the wastewater.15. The method of wherein the composition of the wastewater is analyzed before the water is treated by the wastewater treatment system.16. The method of wherein analyzing the composition of the wastewater includes analyzing the composition of the wastewater using Laser-Induced Breakdown Spectroscopy.17. The method of wherein analyzing the composition of the wastewater includes analyzing the concentration of one or more constituents in the wastewater.18. The method of wherein modifying one or more modules or parameters in the wastewater treatment system comprises at least one of disabling one or more modules in the wastewater treatment system claim 14 , adjusting an operational parameter of one or more modules in the wastewater treatment system claim 14 , diverting the wastewater to bypass one or more modules in the wastewater ...

INSECTICIDAL PROTEINS AND METHODS FOR THEIR USE

Compositions and methods for controlling pests are provided. The methods involve transforming organisms with a nucleic acid sequence encoding an insecticidal protein. In particular, the nucleic acid sequences are useful for preparing plants and microorganisms that possess insecticidal activity. Thus, transformed bacteria, plants, plant cells, plant tissues and seeds are provided. Compositions are insecticidal nucleic acids and proteins of bacterial species. The sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest including plants, as probes for the isolation of other homologous (or partially homologous) genes. The pesticidal proteins find use in controlling, inhibiting growth or killing Lepidopteran, Coleopteran, Dipteran, fungal, Hemipteran and nematode pest populations and for producing compositions with insecticidal activity. 1. A recombinant insecticidal polypeptide having at least 80% sequence identity to the amino acid sequence of any one of SEQ ID Nos: 3-39 , wherein the recombinant insecticidal polypeptide has insecticidal activity.2. The recombinant insecticidal polypeptide of claim 1 , wherein recombinant insecticidal polypeptide is joined to a heterologous signal sequence or a transit sequence.3. The recombinant insecticidal polypeptide of claim 1 , wherein the amino acid sequence comprises a variant of SEQ ID NO: 4 claim 1 , and wherein the amino acid at position 6 is F claim 1 , M claim 1 , or P; the amino acid at position 48 is R claim 1 , E claim 1 , L claim 1 , A claim 1 , F claim 1 , or Y; the amino acid at position 80 is V claim 1 , L claim 1 , S claim 1 , M claim 1 , A claim 1 , or T; the amino acid at position 132 is S claim 1 , G claim 1 , or E; the amino acid at position 179 is A claim 1 , E claim 1 , S claim 1 , or G; the amino acid at position 278 is A claim 1 , V claim 1 , or G; any amino acid substitution identified in Table 8; or any combination thereof.4. A composition ...

QUINOLINE DERIVATIVE USED FOR TREATING SMALL CELL LUNG CANCER

The present application relates to the field of medicine, and provided thereby is a quinoline derivative used for treating small cell lung cancer. The 1-[[[4-(4-fluoro-2-methyl-1H-indol-5-yl)oxy-6-methoxyquinolin-7-yl]oxy]methyl]cyclopropylamine or a pharmaceutically acceptable salt thereof as provided by the present application may be used for the treatment of small cell lung cancer, especially for patients suffering from refractory relapsed small cell lung cancer, which may significantly prolong the survival time thereof; in addition, the therapeutic effect on brain metastatic small cell lung cancer is also very significant. 18-. (canceled)10. The method according to claim 9 , wherein the small cell lung cancer is one that has failed with at least two chemotherapy regimens.11. The method according to claim 9 , wherein the small cell lung cancer is one that has failed with second-line and/or higher-line chemotherapy.12. The method according to claim 10 , wherein the chemotherapy is one or more of cisplatin claim 10 , etoposide claim 10 , carboplatin claim 10 , nedaplatin claim 10 , oxaliplatin claim 10 , miriplatin claim 10 , lobaplatin claim 10 , irinotecan claim 10 , topotecan claim 10 , paclitaxel claim 10 , docetaxel claim 10 , temozolomide claim 10 , vinorelbine claim 10 , gemcitabine claim 10 , cyclophosphamide claim 10 , doxorubicin claim 10 , vincristine claim 10 , bendamustine claim 10 , epirubicin claim 10 , methotrexate and amrubicin.13. (canceled)14. The method according to claim 9 , wherein the pharmaceutically acceptable salt thereof is a salt formed by the compound of formula I and any of the following acids: hydrochloric acid claim 9 , hydrobromic acid claim 9 , sulfuric acid claim 9 , nitric acid claim 9 , phosphoric acid claim 9 , acetic acid claim 9 , trifluoroacetic acid claim 9 , propionic acid claim 9 , hexanoic acid claim 9 , heptanoic acid claim 9 , cyclopentane propionic acid claim 9 , glycolic acid claim 9 , pyruvic acid claim 9 , lactic ...

INSECTICIDAL PROTEINS FROM PLANTS AND METHODS FOR THEIR USE

Compositions and methods for controlling pests are provided. The methods involve transforming organisms with a nucleic acid sequence encoding an insecticidal protein. In particular, the nucleic acid sequences are useful for preparing plants and microorganisms that possess insecticidal activity. Thus, transformed bacteria, plants, plant cells, plant tissues and seeds are provided. Compositions are insecticidal nucleic acids and proteins of bacterial species. The sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest including plants, as probes for the isolation of other homologous (or partially homologous) genes. The pesticidal proteins find use in controlling, inhibiting growth or killing Lepidopteran, Coleopteran, Dipteran, fungal, Hemipteran and nematode pest populations and for producing compositions with insecticidal activity. 1. A recombinant insecticidal polypeptide comprising an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 16.2. The recombinant insecticidal polypeptide of claim 1 , wherein the polypeptide is insecticidal against a Lepidopteran agricultural pest.3. The recombinant insecticidal polypeptide of claim 1 , wherein the insecticidal polypeptide is joined to a heterologous signal sequence or a transit sequence.4. A chimeric insecticidal protein comprising:{'claim-ref': {'@idref': 'CLM-00001', 'claim 1'}, 'a portion of a first recombinant polypeptide of , and'}{'claim-ref': {'@idref': 'CLM-00001', 'claim 1'}, 'a corresponding portion of a second recombinant polypeptide of .'}5. The chimeric insecticidal protein of claim 4 , wherein the chimeric insecticidal protein has altered insect specificity and/or broaden insecticidal spectrum compared to the individual recombinant insecticidal polypeptide components alone.6. A fusion protein comprising the recombinant insecticidal polypeptide of .7. An agricultural composition comprising at least one recombinant insecticidal ...

FLEXIBLE DEVICE CARRIER AND METHOD FOR ATTACHING MEMBRANE ON FLEXIBLE DEVICE

The present invention provides a flexible device carrier for a flexible display panel and a method for attaching a membrane on the flexible device. The flexible device carrier comprises: a bottom plate; a position-limiting plate provided opposite to the bottom plate and detachably mounted on the bottom plate through a position-limiting mechanism, wherein a slotted hole is provided on the position-limiting plate to match with one side of the bottom plate facing the position-limiting plate, so as to form a positioning groove for the flexible device. By using the flexible device carrier, the membrane can be tightly attached on the side of the flexible device away from the bottom plate of the flexible device carrier, reducing probability of defects such as occurrence of bubbles between the membrane and the flexible device, improving quality of attaching the membrane on the flexible device and improving product yield of the flexible display panel.

STABLE COLOR-CHANGING INK

The present invention discloses a stable color-changing ink, which includes the following components in parts by weight: 10 to 60 parts of water, 0.1 to 2 parts of a pH regulator, 0.1 to 1 part of a corrosion inhibitor, 0.1 to 3 parts of a dispersant, 0.1 to 3 parts of an emulsion type lubricant, 0.5 to 10 parts of a water soluble resin, 10 to 50 parts of a microcapsule color-changing pigment, and 0.1 to 3 parts of a thickener. The present invention achieves the stability of an ink system and the stability of the writing effect, and can be used in different application fields, involving color-changing gel inks, color-changing watercolor inks, color-changing water-based inks, color-changing medium oil inks, color-changing fountain pen inks, color-changing writing brush inks, color-changing writing brush inks, color-changing inkjet inks, anti-counterfeiting inks, high-temperature disappearing inks, and other application systems. 1. A stable color-changing ink , comprising the following components in parts by weight:10 to 60 parts of water,0.1 to 2 parts of a pH regulator,0.1 to 1 part of a corrosion inhibitor,0.1 to 3 parts of a dispersant,0.1 to 3 parts of an emulsion type lubricant,0.5 to 10 parts of a water soluble resin,10 to 50 parts of a microcapsule color-changing pigment, and0.1 to 3 parts of a thickener.2. The stable color-changing ink according to claim 1 , wherein the water is deionized water or distilled water having conductivity of less than or equal to 0.5 μs/cm.3. The stable color-changing ink according to claim 2 , further comprising 0.1 to 1 part by weight of anti-mildew bactericide.4. The stable color-changing ink according to claim 3 , further comprising 5 to 25 parts by weight of a solvent.5. The stable color-changing ink according to claim 3 , wherein the anti-mildew bactericide is a water-based low-toxicity broad-spectrum bactericide.6. The stable color-changing ink according to claim 1 , wherein the pH regulator is one or more selected from ...

GAME SCENE DESCRIPTION METHOD AND APPARATUS, DEVICE, AND STORAGE MEDIUM

A game scene description method and apparatus, a device, and a storage medium is provided. The method includes: obtaining at least one video frame from a game live video stream; capturing a game map region image in the at least one video frame; inputting the game map region image into a first target detection model to obtain a display region of a game element on the game map region image; inputting an image of the display region of the game element into a classification model to obtain a state of the game element; and forming description information of a game scene displayed by the at least one video frame by the display region and the state of the game element. 1. A game scene description method , comprising:acquiring at least one video frame in a game live broadcast video stream;capturing a game map area image in the at least one video frame;inputting the game map area image to a first target detection model to obtain a display area of a game element in the game map area image;inputting an image of the display area of the game element to a classification model to obtain a state of the game element; andforming description information of a game scene displayed by the at least one video frame by adopting the display area and the state of the game element.2. The method of claim 1 , wherein capturing the game map area image in the at least one video frame comprises:inputting the at least one video frame to a second target detection model to obtain a game map detection area in the at least one video frame;correcting the game map detection area by performing feature matching on a route feature in the game map detection area and a reference feature, to obtain a game map correction area; andin a case where a deviation distance of a game map correction area of one video frame of the at least one video frame relative to a game map detection area of the one video frame exceeds a deviation threshold, capturing an image of the game map detection area in the one video frame.3. ...

FOLDABLE SUBSTRATE, METHOD FOR FORMING THE SAME AND FLEXIBLE DISPLAY DEVICE

A foldable substrate, a method for forming the same, and a flexible display device are provided. The foldable substrate includes a plurality of rigid supporting portions separated from each other, every two of which are not in contact with each other, and a flexible foldable portion connecting two adjacent rigid supporting portions of the plurality of rigid supporting portions. 1. A foldable substrate , comprising:a plurality of rigid supporting portions separated from each other, every two of which are not in contact with each other; anda flexible foldable portion connecting two adjacent rigid supporting portions of the plurality of rigid supporting portions;the flexible foldable portion is made of an organic material;the plurality of rigid supporting portions each comprises:an organic base substrate provided with a groove; anda hard substrate arranged in and adapted to the groove, wherein the hard substrate fits tightly to the groove.2. (canceled)3. The foldable substrate according to claim 1 , wherein the organic material comprises polyethylene naphthalene claim 1 , polyethylene terephthalate claim 1 , polyimide and cyclic polyolefin.4. (canceled)5. The foldable substrate according claim 1 , wherein the hard substrate is a glass substrate.6. The foldable substrate according claim 1 , wherein the organic base substrate is formed integrally with the flexible foldable portion.7. The foldable substrate according to claim 1 , wherein the plurality of rigid supporting portions separated from each other claim 1 , every two of which are not in contact with each other claim 1 , comprises two rigid supporting portions claim 1 , and the foldable substrate further comprises the flexible foldable portion connecting two rigid supporting portions.8. A flexible display device comprising the foldable substrate according to and a display component arranged on the foldable substrate.9. A method for forming a foldable substrate claim 1 , comprising:arranging a plurality of hard ...

MECHANISMS FOR SERVICE LAYER RESOURCE RANKING AND ENHANCED RESOURCE DISCOVERY

A ranking service implemented at a service layer may be configured to provide mechanisms for ranking resources through service layer contexts called ranking events. The ranking service may enable the service layer to augment internally generated rankings, provide resource owners the ability to specify the targeted audience for their resources, and provide the ability for users to specify indications of ranking types that may be available to customize resource discovery results. 1. A method performed at a service layer entity of a communications network , the method comprising:determining a ranking profile that indicates, for one or more resources, one or more ranking events and one or more rank values associated with the one or more ranking events;receiving an indication of the occurrence of one or more of the ranking events; andupdating, based on the occurrence of the one or more of the ranking events, and based on one or more of the rank values associated with the one or more ranking events, a resource rank of a resource hosted at the service layer entity.2. The method of claim 1 , wherein updating the resource rank of the resource hosted at the service layer entity comprises at least one of:determining, based on the occurrence of the one or more of the ranking events and the one or more rank values associated with the one or more of the ranking events, to increase the resource rank of the resource; anddetermining, based on the occurrence of the one or more of the ranking events and the one or more rank values associated with the one or more of the ranking events, to decrease the resource rank of the resource.3. The method of claim 1 , wherein the one or more ranking events comprise:a resource discovery selection event;a create, retrieve, update, or delete (CRUD) operation associated with the resource;an update to a number of subscriptions and notification targets for the resource;a determination that the resource has been announced; anda response to a group fan- ...

NOVEL INSECTICIDAL PROTEINS AND METHODS OF USE

Compositions and methods for controlling pests are provided. The methods involve transforming organisms with a nucleic acid sequence encoding an insecticidal protein. In particular, the nucleic acid sequences are useful for preparing plants and microorganisms that possess insecticidal activity. Thus, transformed bacteria, plants, plant cells, plant tissues and seeds are provided. Compositions are isolated insecticidal proteins and nucleic acids. The sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest, as probes for the isolation of other homologous (or partially homologous) genes. The insecticidal proteins find use in controlling or killing lepidopteran, coleopteran, dipteran, fungal, hemipteran, and nematode pest populations and for producing compositions with insecticidal activity. 1. An isolated three-domain insecticidal protein having a structure comprising:a. a Domain I, comprising a surface hydrophobic patch and a type 1′ β-turn;b. a Domain II; andc. a Domain III, wherein the surface of Domain II and Domain III comprise a stripe of solvent exposed serine and threonine residues.2. The isolated three-domain insecticidal protein of claim 1 , wherein Domain I further comprises an anti-parallel β-sheet with four short strands and four α-helices designated as helix 1 claim 1 , helix 2 claim 1 , helix 3 claim 1 , and helix 4.3. The isolated three-domain insecticidal protein of claim 2 , wherein the anti-parallel β-sheet of Domain I further comprises the C-terminal end of strand 11 claim 2 , strand 12 claim 2 , and the type 1′ β-turn joins strand 11 and strand 12.4. The isolated three-domain insecticidal protein of any one of to claim 2 , wherein Domain I further comprises a β-hairpin between helix 2 and helix 3.53. The isolated three-domain insecticidal protein of any one of to claims 1 , wherein the surface hydrophobic patch comprises the residues from strand 12 claims 1 , helix 2 claims 1 , helix 3 ...

ADVANCED RESOURCE LINK BINDING MANAGEMENT

A link binding chain is disclosed that enables multiple hops of link bindings to be cascaded to form a chain of link bindings. The binding chain can be leveraged when a one-hop link binding is infeasible or fails to be established. Dynamic binding method switching is disclosed for updating the binding method after a link binding has been established such that the link binding may be selected for a more proper or efficient link binding method to adapt to the changing environment. Methods for broker assisted link binding are disclosed to facilitate link binding functionalities between a source resource and a destination resource that are connected through a binding broker. 1. A method performed at an intermediate resource host , the method comprising:receiving, from a source resource host that is connected to a destination resource host by an existing link binding, a request for the intermediate resource host to create an intermediate resource between the source resource host and the destination resource host, wherein the request to create the intermediate resource comprises information associated with the existing link binding between the source resource host and the destination resource host;creating the intermediate resource;sending, to the source resource host, an indication that the intermediate resource has been created;receiving, from the source resource host, a request to create a plurality of link binding entries, wherein the plurality of link binding entries comprise a first link binding entry between the source resource host and the intermediate resource host and a second link binding entry between the intermediate resource host and the destination resource host; andcreating the plurality of link binding entries.2. The method of claim 1 , wherein the intermediate resource host is configured to receive information from one of the source resource host or the destination resource host and to send the information to the other one of the source resource host or ...

FLEXIBLE DISPLAY SUBSTRATE AND METHOD FOR MANUFACTURING THE SAME

Disclosed is a flexible display substrate and a method for manufacturing the same which can avoid break and peeling of film layers disposed on a flexible base and further reduce degree of a warpage occurred in the flexible base when separating the support substrate from the flexible base located above the support substrate. The flexible display substrate comprises the flexible base, a first buffer layer and a second buffer layer disposed on an upper surface and a lower surface of the flexible base, respectively, and a plurality of display modules disposed on the first buffer layer, each display module includes at least one thin film transistor and at least one electrode corresponding to the thin film transistor. 1. A flexible display substrate comprising:a flexible base;a first buffer layer and a second buffer layer disposed on an upper surface and a lower surface of the flexible base, respectively; anda plurality of display modules disposed on the first buffer layer, each display module including at least one thin film transistor and at least one electrode corresponding to the thin film transistor.2. The flexible display substrate according to claim 1 , wherein the first buffer layer and the second buffer layer are made of the same material and have the same thickness.3. The flexible display substrate according to claim 2 , whereinany one of the first buffer layer and the second buffer layer includes at least one buffer film layer; andall the buffer film layers of the first buffer layer and all the buffer film layers of the second buffer layer are symmetrically disposed with respect to the flexible base, respectively.4. The flexible display substrate according to claim 2 , wherein a thickness of each of the first buffer layer and the second buffer layer is set between 1000 and 5000 Å.5. The flexible display substrate according to claim 1 , wherein a plurality of auxiliary film layers are disposed on one side of the second buffer layer which is away from the ...

Deep-Ultraviolet Chemically-Amplified Positive Photoresist

The invention discloses a deep-ultraviolet chemically-amplified positive photoresist. The deep-ultraviolet chemically-amplified positive photoresist according to one embodiment of the invention includes a cyclopentenyl pimaric acid, a divinyl ether, a photoacid generator and an organic solvent. The deep-ultraviolet chemically-amplified positive photoresist according to the invention has a good sensitivity and a good transparency. 2. The positive photoresist according to claim 1 , wherein the divinyl ether is at least one selected from the group consisting of ethylene glycol divinyl ether claim 1 , propylene glycol divinyl ether claim 1 , butylene glycol divinyl ether claim 1 , diethylene glycol divinyl ether claim 1 , 1 claim 1 ,3-di-(ethyleneoxy ethoxy)benzene claim 1 , 1-methyl-1 claim 1 ,2-diethyleneoxy ethane and 1 claim 1 ,7-di-(ethyleneoxy ethoxy)naphthalene.3. The positive photoresist according to claim 2 , wherein claim 2 , the divinyl ether is ethylene glycol divinyl ether claim 2 , propylene glycol divinyl ether claim 2 , diethylene glycol divinyl ether claim 2 , or 1 claim 2 ,3-di-(ethyleneoxy ethoxy)benzene.4. The positive photoresist according to claim 1 , wherein the photoacid generator is at least one selected from the group consisting of triphenylsulfonium trifluoromethanesulphonate claim 1 , S-(2-naphthoyl)methyltetrahydrothiophenium trifluoromethanesulphonate claim 1 , tri(4-methylphenyl)sulfonium trifluoromethanesulphonate claim 1 , heptafluoropropane sulphonate claim 1 , (4-methylphenyl)diphenyl trifluoromethanesulphonate claim 1 , (p-tert-butylphenyl)diphenylsulfonium trifluoromethanesulphonate and tri(p-tert-butylphenyl)sulfonium trifluoromethanesulphonate.5. The positive photoresist according to claim 5 , wherein the photoacid generator is triphenylsulfonium trifluoromethanesulphonate.6. The positive photoresist according to claim 1 , wherein the organic solvent is at least one selected from the group consisting of acetone claim 1 , ...

FLEXIBLE DISPLAY DEVICE

The present disclosure provides a flexible display device, wherein there is a flexible support structure fixed on a surface of the flexible display module, which is used to disperse stress. During use of the flexible display device, the flexible support structure can be used to disperse the point force or linear force that the flexible display device is subject to when being bent into even planar force. Besides, the flexible support structure can reduce the stress exerted on the flexible display module, avoiding delamination among the film layers caused by local stress concentration on the flexible display module. In addition, given the same thickness of the flexible display module, the flexible display device can be bent to a smaller bending radius. 1. A flexible display device , comprising:a flexible display module, anda flexible support structure fixed on the surface of the flexible display module, which is used to disperse stress.2. The flexible display device according to claim 1 , wherein the flexible display module is a flexible display panel claim 1 , and the flexible support structure comprises:A first flexible support portion fixed on a display surface of the flexible display panel; anda second flexible support portion fixed on a back face of the flexible display panel.3. The flexible display device according to claim 2 , wherein the flexible display panel is provided with a protective cover plate to protect the display surface claim 2 , and the protective cover plate can be used instead of the first flexible support portion.4. The flexible display device according to claim 2 , wherein the first flexible support portion is an upper cover plate fixed on the display surface of the flexible display panel.5. The flexible display device according to claim 2 , wherein the second flexible support portion is a lower support plate fixed on the entire back face of the flexible display panel.6. The flexible display device according to claim 5 , wherein an inner ...

MULTISTAGE SET PROCEDURE FOR PHASE CHANGE MEMORY

Phase change material can be set with a multistage set process. Set control logic can heat a phase change semiconductor material (PM) to a first temperature for a first period of time. The first temperature is configured to promote nucleation of a crystalline state of the PM. The control logic can increase the temperature to a second temperature for a second period of time. The second temperature is configured to promote crystal growth within the PM. The nucleation and growth of the crystal set the PM to the crystalline state. The multistage ramping up of the temperature can improve the efficiency of the set process relative to traditional approaches.

THIN ELECTROMAGNETIC HANDWRITING PEN AND METHOD OF MANUFACTURING THE SAME

A thin electromagnetic handwriting pen includes a casing unit, a circuit unit, an electromagnetic unit and a pen core unit. The casing unit includes a thin pen-shaped casing structure. The circuit unit includes a circuit substrate disposed inside the thin pen-shaped casing structure. The electromagnetic unit includes a hollow holder and an electromagnetic coil wound around the hollow holder. Both the hollow holder and the electromagnetic coil are embedded in the thin pen-shaped casing structure, and the electromagnetic coil is fixed between the thin pen-shaped casing structure and the hollow holder and electrically connected to the circuit substrate. The pen core unit includes a pen core structure movably disposed inside the thin pen-shaped casing structure and passing through the hollow holder, and one portion of the pen core structure is exposed outside the thin pen-shaped casing structure. 1. A thin electromagnetic handwriting pen , comprising:a casing including a thin pen-shaped casing structure having an axis;circuitry including a circuit substrate disposed inside the thin pen-shaped casing structure;an electromagnetic unit including a hollow holder and an electromagnetic coil wound around the hollow holder, wherein the electromagnetic unit is received in the thin pen-shaped casing structure, the hollow holder includes a coil winding portion and a coil guiding portion adjacent to each other along the axis, the coil winding portion has a coil winding outer surface around which the electromagnetic coil is wound, the coil guiding portion has an outer surface fitted to an inner surface of the thin pen-shaped casing structure, the outer surface of the coil guiding portion defines two coil guiding grooves extending along the axis in which two end portions of the electromagnetic coil are respectively received, and the two end portions of the electromagnetic coil exiting the two coil guiding grooves are electrically connected to the circuit substrate;a pen core ...

Pseudo-boehmite, manufacturing process and application thereof

A pseudo-boehmite has a dry basis content of 55-85 wt % and contains a phosphoric acid ester group. The sodium oxide content is not greater than 0.5 wt %, and the phosphorus content (in terms of phosphorus pentoxide) is 1.2-5.7 wt %, relative to 100 wt % of the total weight of the pseudo-boehmite. The pseudo-boehmite has a low sodium content. 1. A pseudo-boehmite having a dry basis content of 55-85 wt % (preferably 65-75 wt %) and containing a phosphoric acid ester group , wherein the sodium oxide content is not greater than 0.5 wt % (preferably not greater than 0.05 wt % , more preferably not greater than 0.03 wt %) , and the phosphorus content (in terms of phosphorus pentoxide) is 1.2-5.7 wt % (preferably 1.4-4.2 wt %) , relative to 100 wt % of the total weight of the pseudo-boehmite.3. The pseudo-boehmite of claim 1 , wherein the gibbsite content is <3.0 wt % claim 1 , relative to 100 wt % of the total weight of the pseudo-boehmite.4. The pseudo-boehmite of claim 1 , which further contains at least one auxiliary selected from Si claim 1 , B and Ti claim 1 , the content of said at least one auxiliary (in term of oxide) is 1-8 wt % (preferably 2-6 wt %) claim 1 , relative to 100 wt % of the total weight of the pseudo-boehmite.6. The manufacturing process of claim 5 , wherein the weight ratio of the alkaline aluminium source (in term of alumina) to the organic acid source is 1.2:1 to 24:1 (preferably 5:1 to 20:1) claim 5 , and/or claim 5 , the carbon atom number of the organic acid source is up to 30 (preferably up to 20 claim 5 , more preferably up to 15) claim 5 , and/or claim 5 , the HLB value of the organic acid source is 3-8 (preferably 3-6) claim 5 , and/or claim 5 , the particle size of the cation-exchange resin is 20-150 mesh (preferably 40-80 mesh) claim 5 , and/or claim 5 , the organic-based refers to a group represented by the structural formula RO—R— claim 5 , wherein Ris hydrogen atom or optionally substituted Chydrocarbyl (preferably selected from ...

INSECTICIDAL PROTEINS AND METHODS FOR THEIR USE

Compositions and methods for controlling pests are provided. The methods involve transforming organisms with a nucleic acid sequence encoding an insecticidal protein. In particular, the nucleic acid sequences are useful for preparing plants and microorganisms that possess insecticidal activity. Thus, transformed bacteria, plants, plant cells, plant tissues and seeds are provided. Compositions are insecticidal nucleic acids and proteins of bacterial species. The sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest including plants, as probes for the isolation of other homologous (or partially homologous) genes. The pesticidal proteins find use in controlling, inhibiting growth or killing Lepidopteran, Coleopteran, Dipteran, fungal, Hemipteran and nematode pest populations and for producing compositions with insecticidal activity. 1. A recombinant insecticidal polypeptide selected from:a) a polypeptide comprising an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 1 or fragments thereof having insecticidal activity;b) a polypeptide comprising an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 2 or fragments thereof having insecticidal activity;c) a polypeptide comprising an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 27 or fragments thereof having insecticidal activity;d) a polypeptide comprising an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 28 or fragments thereof having insecticidal activity;e) a polypeptide comprising an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 121 or fragments thereof having insecticidal activity;f) a polypeptide comprising an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 136 or fragments thereof having insecticidal activity;g) a polypeptide comprising an amino acid sequence having at least 80% sequence identity to SEQ ID NO: ...

ANALOGUE-DIGITAL CONVERTER OF NON-BINARY CAPACITOR ARRAY WITH REDUNDANT BIT AND ITS CHIP

An analog-to-digital converter of non-binary capacitor array with redundancy bits and its chip. The non-binary capacitor array with redundancy bits comprises a common-mode voltage, analog signal input, no less than one redundancy bit capacitor and multiple capacitors; each capacitor of capacitors with redundancy bits and multiple capacitors is connected in parallel between common-mode voltage and analog signal input and marked in a sequence from highest to lowest/lowest to highest bit; the sum of the capacitance of capacitors from the lowest bit capacitor to an random capacitor must be no less than the capacitance of the higher bit capacitor adjacent to the random capacitor. The ratio of the capacitance of each capacitor to the capacitance of unit capacitor is set to be positive. The capacitor array is applied into an analog-to-digital converter or fabricated as a chip. 1. A non-binary capacitor array with redundancy bits for analog sampling , characterized in that , including a common-mode voltage , analog signal input , no less than one capacitor with redundancy bits and multiple capacitors , whereinall capacitors of said no less than one capacitor with redundancy bits and multiple capacitors are connected in parallel between common-mode voltage and analog signal input and marked in a sequence from highest to lowest/lowest to highest bit; the sum of the capacitance of capacitors from the lowest bit capacitor to an random capacitor must be no less than the capacitance of the higher bit capacitor adjacent to the random capacitor. The ratio of the capacitance of each capacitor to the capacitance of unit capacitor is set to be positive.2. The non-binary capacitor array with redundancy bits according to claim 1 , characterized in that claim 1 , the capacitance of each capacitor with redundancy bits is no less than the minimum capacitance among multiple capacitors and no larger than the maximum capacitance among multiple capacitors.3. The non-binary capacitor array with ...

Compositions and methods comprising sequences having meganuclease activity

Compositions and methods comprising polynucleotides and polypeptides having meganuclease activity are provided. Further provided are nucleic acid constructs, yeast, plants, plant cells, explants, seeds and grain having the meganuclease sequences. Various methods of employing the meganuclease sequences are provided. Such methods include, for example, methods for producing a meganuclease with increased activity at a wide range of temperatures, methods for producing a yeast, plant, plant cell, explant or seed comprising a meganuclease with increased activity.

INSECTICIDAL COMBINATIONS OF PIP-72 AND METHODS OF USE

Compositions and methods for controlling pests are provided. The methods involve transforming organisms with one or more nucleic acid sequence encoding insecticidal protein(s) and one or more silencing element(s). In particular, the nucleic acid sequences are useful for preparing plants and microorganisms that possess insecticidal activity. Thus, transformed bacteria, plants, plant cells, plant tissues and seeds are provided. Compositions are insecticidal nucleic acids and proteins of bacterial species. The sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest including plants, as probes for the isolation of other homologous (or partially homologous) genes. The molecular and breeding stacks find use in controlling, inhibiting growth or killing Lepidopteran, Coleopteran, Dipteran, fungal, Hemipteran and nematode pest populations and for producing compositions with insecticidal activity. 1. A DNA construct comprising i) a nucleic acid molecule encoding a PIP-72 polypeptide having insecticidal activity and ii) a silencing element targeting RyanR or RPS10 having insecticidal activity.2. The DNA construct of claim 1 , wherein the nucleic acid molecule encoding the PIP-72 polypeptide and silencing element are operably linked to a heterologous regulatory element.3. The DNA construct of claim 1 , wherein the silencing element is a sense suppression element claim 1 , an antisense suppression element claim 1 , a double stranded RNA claim 1 , a siRNA claim 1 , a amiRNA claim 1 , a miRNA claim 1 , or a hairpin suppression element.4. A molecular stack comprising i) a nucleic acid molecule encoding a PIP-72 polypeptide having insecticidal activity and ii) a silencing element targeting RyanR or RPS10 having insecticidal activity.5. The molecular stack of claim 4 , wherein the nucleic acid molecule encoding the PIP-72 polypeptide and silencing element are operably linked to a heterologous regulatory element.6. The ...

TAILORING CURRENT MAGNITUDE AND DURATION DURING A PROGRAMMING PULSE FOR A MEMORY DEVICE

Technology for a memory device is described. The memory device can include an array of memory cells and a memory controller. The memory controller can receive a request to program a memory cell within the array of memory cells. The memory controller can select a current magnitude and a duration of the current magnitude for a programming set pulse based on a polarity of access for the memory cell, a number of prior write cycles for the memory cell, and electrical distances between the memory cell and wordline/bitline decoders within the array of memory cells. The memory controller can initiate, in response to the request, the programming set pulse to program the memory cell within the array of memory cells. The selected current magnitude and the selected duration of the current magnitude can be applied during the programming set pulse. 1. A memory device , comprising:an array of memory cells; anda memory controller comprising logic to:receive a request to program a memory cell within the array of memory cells;select a current magnitude and a duration of the current magnitude for a programming set pulse based on a polarity of access for the memory cell, a number of prior write cycles for the memory cell, and electrical distances between the memory cell and wordline/bitline decoders within the array of memory cells; andinitiate, in response to the request, the programming set pulse to program the memory cell within the array of memory cells, wherein the selected current magnitude and the selected duration of the current magnitude are applied during the programming set pulse.2. The memory device of claim 1 , wherein the memory controller further comprises logic to:select the current magnitude and the duration of the current magnitude for a termination stage of a multi-stage programming set pulse based on the polarity of access, the number of prior write cycles, and the electrical distances, wherein the selected current magnitude and the selected duration of the current ...

FLEXIBLE DISPLAY SUBSTRATE MOTHER BOARD AND METHOD OF MANUFACTURING FLEXIBLE DISPLAY SUBSTRATE

A flexible display substrate mother board and a method of manufacturing a flexible display substrate are provided. The method includes: forming a heating pattern layer on a support substrate, wherein the heating pattern layer includes a plurality of regional blocks spaced apart from each other; forming a flexible substrate on the substrate provided with the heating pattern layer, and forming display elements on the flexible substrate; and heating the flexible substrate by utilization of the heating pattern layer, cutting the flexible substrate, stripping the flexible substrate corresponding to the regional block from the support substrate, and forming flexible display substrates. The method can avoid the damage of the display elements on the flexible substrate when the flexible substrate and the support substrate are separated from each other, and avoid uneven separation. 1. A flexible display substrate mother board , comprising:a support substrate;a heating pattern layer provided on the support substrate and provided with a plurality of regional blocks spaced apart from each other; anda flexible substrate provided on the heating pattern layer and display elements provided on the flexible substrate.2. The mother board according to claim 1 , wherein the flexible substrate has an area greater than that of the heating pattern layer.3. The mother board according to claim 1 , wherein the heating pattern layer further comprises at least two protrusions connected with each regional block; and the protrusions are configured to provide a voltage to the regional blocks.4. The mother board according to claim 1 , wherein the heating pattern layer is made from material including at least one or a combination of more selected from metal claim 1 , alloy and metal oxide.5. The mother board according to claim 1 , wherein each of the plurality regional blocks corresponds to a flexible display substrate with a predetermined size to be formed; and the flexible display substrate ...

COVER STRUCTURE, MANUFACTURING METHOD THEREOF AND DISPLAY DEVICE

The present disclosure discloses a cover structure, a manufacturing method thereof and a display device. The cover structure includes a first and a second transparent flexible film layer, a glass panel, and a first optical adhesive layer. The first transparent flexible film layer has a folded region and a non-folded region. The glass panel is disposed on the first transparent flexible film layer, and a projection of the glass panel on the first transparent flexible film layer is located inside the non-folded region. A part of the first optical adhesive layer is formed at a side of the glass panel facing away from the first transparent flexible film layer, and a part of the first optical adhesive layer covers the folded region of the first transparent flexible film layer. The second transparent flexible film layer is formed at a side of the first optical adhesive layer facing away from the first transparent flexible film layer. 1. A cover structure , comprising:a first transparent flexible film layer having a folded region and a non-folded region;a glass panel disposed at a side of the first transparent flexible film layer, wherein a projection of the glass panel on a side of the first transparent flexible film layer is located inside the non-folded region;a first optical adhesive layer, wherein a part of the first optical adhesive layer is formed at a side of the glass panel facing away from the first transparent flexible film layer, and a part of the first optical adhesive layer covers the folded region of the first transparent flexible film layer; anda second transparent flexible film layer formed at a side of the first optical adhesive layer facing away from the first transparent flexible film layer.2. The cover structure according to claim 1 , wherein the glass panel is adhered to the first transparent flexible film layer.3. The cover structure according to claim 2 , wherein an adhesive material between the glass panel and the first transparent flexible film ...

INSECTICIDAL PROTEINS AND METHODS FOR THEIR USE

Compositions and methods for controlling pests are provided. The methods involve transforming organisms with a nucleic acid sequence encoding an insecticidal protein. In particular, the nucleic acid sequences are useful for preparing plants and microorganisms that possess insecticidal activity. Thus, transformed bacteria, plants, plant cells, plant tissues and seeds are provided. Compositions are insecticidal nucleic acids and proteins of bacterial species. The sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest including plants, as probes for the isolation of other homologous (or partially homologous) genes. The pesticidal proteins find use in controlling, inhibiting growth or killing Lepidopteran, Coleopteran, Dipteran, fungal, Hemipteran and nematode pest populations and for producing compositions with insecticidal activity. 1. An insecticidal polypeptide selected from:a) a IPD078-1 polypeptide comprising an amino acid sequence having greater than 80% sequence identity compared to the amino acid sequence of SEQ ID NO: 43;b) a IPD078-2 polypeptide comprising an amino acid sequence having greater than 80% sequence identity compared to the amino acid sequence of SEQ ID NO: 44;c) a IPD084 polypeptide comprising an amino acid sequence having greater than 80% sequence identity compared to the amino acid sequence of SEQ ID NO: 45;d) a IPD084 polypeptide comprises the amino acid sequence of any one of SEQ ID NOs: 46-50;e) a IPD085 polypeptide comprising an amino acid sequence having greater than 80% sequence identity compared to SEQ ID NO: 51;f) a IPD085 polypeptide comprising the amino acid sequence of any one of SEQ ID NOs: 52-55;g) a IPD086-1 polypeptide comprising an amino acid sequence having greater than 80% sequence identity compared to the amino acid sequence of SEQ ID NO: 56;h) a IPD086-1 polypeptide comprising the amino acid sequence of SEQ ID NO: 58, SEQ ID NO: 61, SEQ ID NO: 64 or SEQ ID NO: 66 ...

Diffraction Imaging using Pseudo Dip-Angle Gather

Systems, methods, and apparatuses for generating a subsurface image using diffraction energy information are disclosed. The systems, methods, and apparatuses may include converting a shot gather into one or more plane-wave gather using a Radon transform. The plane-wave gathers may be extrapolated into source-side wavefields and receiver-side wavefields and further generate a pseudo dip-angle gather. The diffraction energy information may be extracted from the pseudo dip-angle gather, and an image containing subsurface features may be generated from the extracted diffraction energy information. The receiver-side wavefields may be decomposed using a recursive Radon transform. 1. A computer-implemented method performed by one or more processors for generating an image of subsurface features of a portion of the earth using diffraction energy , the method comprising the following operations:receiving shot gathers formed from a plurality of shots;converting the shot gather into one or more plane-wave gathers;selecting one of the plane-wave gathers;extrapolating source-side wavefields of the plane-wave gather;extrapolating and decomposing receiver-side wavefields of the plane-wave gather;forming a pseudo dip-angle gather by applying an imaging condition to the extrapolated plane-wave source-side wavefields and the extrapolated and decomposed plane-wave receiver-side wavefields;extracting the diffraction image information from the pseudo dip-angle gather; andgenerating a stacked diffraction image representative of subsurface features of a portion of the earth.2. The computer-implemented method of claim 1 , further comprising: extrapolating the source-side wavefields of the plane-wave gather;', 'extrapolating and decomposing the receiver-side wavefields of the plane-wave gather; and', 'forming the pseudo-dip angle gather by applying the imaging condition to the extrapolated plane-wave source-side wavefields and the extrapolated and decomposed plane-wave receiver-side ...

Variable refresh rate video capture and playback

A method for rendering and displaying video. The method includes executing an application at a processor. As instructed by the processor when executing the application, the method includes rendering a plurality of image frames at a plurality of graphics processing units (GPUs). The method includes determining information related to relative timing between renderings of the plurality of image frames. The method includes encoding the plurality of image frames into a video file. The method includes encoding the information into the video file.

METHODS TO ENABLE AUTOMATED M2M/IOT PRODUCT MANAGEMENT SERVICES

Methods and apparatuses are described herein for an automated product management (APM) service. An apparatus may receive from a second apparatus, at least one first request to enroll a third apparatus with a service layer associated with the second apparatus. The apparatus may send a second request to verify authenticity of the third apparatus and to generate a customized firmware or software for the third apparatus. The apparatus may send a third request to configure the third apparatus based on consent of a user of the third apparatus. The apparatus may send a response indicating whether the third apparatus has been enrolled with the service layer. The apparatus may receive a fourth request to diagnose or troubleshoot the third apparatus and a fifth request comprising information and the consent and requesting the fourth apparatus to perform at least one operation on the third apparatus. 1. An apparatus comprising a processor , a memory , and communication circuitry , the apparatus being connected to a network via its communication circuitry , the apparatus further comprising computer-executable instructions stored in the memory of the apparatus which , when executed by the processor of the apparatus , cause the apparatus to perform operations comprising:receiving, from a second apparatus, at least one first request to enroll one or more third apparatuses with a service layer associated with the second apparatus;sending, to a fourth apparatus, a second request for the fourth apparatus to verify authenticity of the one or more third apparatuses and to generate a customized firmware or software for the one or more third apparatuses;sending a third request to configure the one or more third apparatuses based on consent of a user of the one or more third apparatuses; andsending a response indicating whether the one or more third apparatuses have been enrolled with the service layer.2. The apparatus of claim 1 , further comprising computer-executable instructions ...

OLED DISPLAY APPARATUS AND METHOD FOR PREPARING THE SAME

Disclosed are an OLED display apparatus and a method for preparing the same. The OLED display apparatus includes a flexible substrate, an array layer disposed on the flexible substrate, an organic light-emitting layer disposed on the array layer, a package layer disposed on the organic light-emitting layer, and a base film disposed on a side of the flexible substrate facing away from the array layer, a plurality of protruded microstructures being provided on the side of the flexible substrate facing away from the array layer. 1. An organic light-emitting device (OLED) display apparatus , comprising:a flexible substrate,an array layer disposed on the flexible substrate,an organic light-emitting layer disposed on the array layer,a package layer disposed on the organic light-emitting layer, anda base film disposed on a side of the flexible substrate facing away from the array layer,wherein a plurality of protruded microstructures is provided on the side of the flexible substrate facing away from the array layer.2. The OLED display apparatus according to claim 1 , wherein the plurality of microstructures and the flexible substrate are integral.3. The OLED display apparatus according to claim 1 , wherein the plurality of microstructures are distributed uniformly.4. The OLED display apparatus according to claim 1 , wherein each of the microstructures is hemispherical.5. The OLED display apparatus according to claim 4 , wherein each hemispherical microstructure has a radian of 1 rad to 10 rad.6. The OLED display apparatus according to claim 1 , wherein each of the microstructures is semi-ellipsoidal.7. The OLED display apparatus according to claim 2 , wherein each of the microstructures is hemispherical.8. The OLED display apparatus according to claim 2 , wherein each of the microstructures is semi-ellipsoidal.9. The OLED display apparatus according to claim 1 , wherein each of the microstructures is a protrusion.10. The OLED display apparatus according to claim 9 , ...

Preparation Method of Display Apparatus and Display Apparatus

Provided are a preparation method of a display apparatus and the display apparatus, relating to a field of display technologies; wherein an edge of at least a side of a flexible display module of the display apparatus is bent to a back side of the flexible display module to form a first bending portion; the preparation method includes providing a flexible display assembly, which includes a flexible display module and a first supporting plate fitted to a display surface of the flexible display module; the first supporting plate is made of a rigid material; an edge of at least a side of the first supporting plate is bent toward a side where the flexible display module is located to form a second bending portion. 1. A preparation method for a display apparatus ,wherein the display apparatus comprises a machine body and a flexible display module assembled on the machine body, an edge of at least one side of the flexible display module is bent toward a back side of the flexible display module to form a first bending portion, and the preparation method comprises:providing a flexible display assembly, wherein the flexible display assembly comprises a flexible display module and a first supporting plate fit to a display surface of the flexible display module; the first supporting plate is made of a rigid material; an edge of at least one side of the first supporting plate is bent toward a side where the flexible display module is located to form a second bending portion; and a first surface of the first bending portion fits to the second bending portion to maintain a bending shape of the first bending portion;installing the flexible display assembly on the machine body, and removing the first supporting plate, making the first surface of the first bending portion pressed against the machine body to maintain the bending shape of the first bending portion.2. The preparation method for the display apparatus of claim 1 , wherein claim 1 , the flexible display module comprises a ...

ENABLING DISTRIBUTED SEMANTIC MASHUP

Distributed Semantic Mashup Service (DSMS) architecture may address the limitations of centralized mashup service. DSMS may leverage a group of SMS Hosts to conduct mashup operations in a distributed manner, such as each involved SMS Host conducts certain mashup operations locally on its own, and finally conducts mashup operation on the Master SMS Host based on these distributed Child Semantic Mashup Instances s to generate more advanced Hierarchical Semantic Mashup Instances to be returned to SMS Requestors. 1. A method for enabling distributed semantic mashup , the method comprising:receiving a request from an entity to associate a parent semantic mashup job profile (SMJP) with a child SMJP, wherein the request comprises one or more parameters of the child SMJP;determining whether the one or more parameters of the child SMJP matches one or more parameters of the parent SMJP;linking the child SMJP and the parent SMJP when the one or more parameters of the child SMJP matches the one or more parameters of the parent SMJP, wherein the linking establishes a parent-child relationship between the child SMJP and the parent SMJP; andsending a response to the entity for confirming the establishment of the parent-child relationship between the child SMJP and the parent SMJP.2. The method of claim 1 , wherein the one or more parameters of the of the request comprises input descriptor claim 1 , output descriptor claim 1 , function descriptor claim 1 , member filter claim 1 , or semantic descriptor.3. The method of claim 1 , wherein the determining whether the one or more parameters of the child SMJP matches one or more parameters of the parent SMJP comprises determining if output parameters described in an output descriptor matches member resources criteria described in a member filter of the parent SMJP.4. The method of claim 1 , wherein the determining whether the one or more parameters of the child SMJP matches one or more parameters of the parent SMJP comprises determining ...

VINYL ETHER GROUP-CONTAINING COPOLYMER, PREPARATION PROCESS AND USE THEREOF

The invention provides a vinyl ether group-containing copolymer, preparation process and use thereof. The copolymer comprises of the structural units represented by the following general formulae I, II and III, wherein, Ris O or HN, Ris an alkyl group with a carbon atom number of 1-4, cyclohexyl or a group represented by the following general formula IV (m represents a positive integer of 1-3), n is a positive integer of 1-4, the molar numbers of the structural units represented by the general formulae I, H and III are x, y and z, respectively, and x:y:z=3-8:1-4:1-5, the weight average molecular weight of the copolymer is 5000-20000. A color light blocking agent added with the copolymer can increase sensitivity. Furthermore, the copolymer has solubility in an alkaline solution, and thus, the color light blocking agent added with the copolymer has a superior developing property. 2. The copolymer according to claim 1 , wherein the copolymer is a random copolymer or a block copolymer.3. The copolymer according to claim 1 , wherein x:y:z=4-6:2-3:2-4 claim 1 , and the weight average molecular weight of the copolymer is 14000-17000.4. The copolymer according to claim 1 , wherein Ris methyl claim 1 , ethyl claim 1 , or butyrolactone group claim 1 , and n is a positive integer of 2-4.6. The process according to claim 5 , wherein the step (1) is performed by reacting methacrylic acid claim 5 , the methacrylate represented by the general formula VI and methacryloyl chloride claim 5 , in the presence of an initiator claim 5 , at 50-90° C. for 8-20 h to obtain the copolymer 1; and the step (2) is performed by adding dropwise the vinyl ether represented by the general formula V into the copolymer 1 at 35-50° C. over 1-3 h and then reacting for 5-20 hours to obtain the vinyl ether group-containing copolymer.7. The process according to claim 6 , wherein the initiator is one or more selected from azobisisobutyronitrile claim 6 , azobisisoheptylnitrile claim 6 , dimethyl ...

FLEXIBLE DISPLAY MODULE AND DISPLAY DEVICE

A flexible display device includes a flexible substrate; a display layer, disposed on the flexible substrate; a reinforcement layer, disposed on a side of the display layer distal to the flexible substrate; and a protective layer, disposed on a side of the reinforcement layer distal to the flexible substrate; wherein material of the reinforcement layer comprises glass and a thickness of the reinforcement layer ranges from 10 μm to 150 μm.

FLEXIBLE DISPLAY SUBSTRATE AND METHOD FOR MANUFACTURING THE SAME

Disclosed is a flexible display substrate and a method for manufacturing the same which can avoid break and peeling of film layers disposed on a flexible base and further reduce degree of a warpage occurred in the flexible base when separating the support substrate from the flexible base located above the support substrate . The flexible display substrate comprises the flexible base, a first buffer layer and a second buffer layer disposed on an upper surface and a lower surface of the flexible base, respectively, a plurality of display modules disposed on the first buffer layer, each display module includes at least one thin film transistor and at least one electrode corresponding to the thin film transistor, and a plurality of auxiliary thin film transistors disposed on one side of the second buffer layer which is away from the flexible base, the auxiliary thin film transistors corresponding to the thin film transistors one by one, respectively. 1. A flexible display substrate comprising:a flexible base;a first buffer layer and a second buffer layer disposed on an upper surface and a lower surface of the flexible base, respectively;a plurality of display modules disposed on the first buffer layer, each display module including at least one thin film transistor and at least one electrode corresponding to the thin film transistor; anda plurality of auxiliary thin film transistors disposed on one side of the second buffer layer which is away from the flexible base, the auxiliary thin film transistors corresponding to the thin film transistors one by one, respectively.2. The flexible display substrate according to claim 1 , wherein the first buffer layer and the second buffer layer are made of the same material and have the same thickness.3. The flexible display substrate according to claim 2 , whereinany one of the first buffer layer and the second buffer layer includes at least one buffer film layer; andall the buffer film layers of the first buffer layer and all the ...

ADHESIVE ASSEMBLY, FLEXIBLE MODULE, DISPLAY DEVICE AND MANUFACTURING METHOD FOR FLEXIBLE MODULE

This disclosure relates to the field of display technologies, and in particular to an adhesive assembly, a flexible module, a display device and a manufacturing method of a flexible module. The adhesive assembly comprises an adhesive base layer, which is used for being arranged between two modules. The adhesive base layer comprises a bonding region and a bending load buffer region, the bonding region being used for bonding the two modules, and a bending stress in the bending load buffer region being smaller than that in the bonding region. When two modules are bonded by such an adhesive assembly, the bending stress in the bending load buffer region and corresponding module portion is smaller than that in the bonding region and corresponding module portion for the whole flexible module, which reduces bending stress in the modules as a whole and facilitates spread and application of the flexible module. 1. An adhesive assembly comprising: an adhesive base layer , wherein the adhesive base layer is arranged between two modules to connect the two modules ,wherein the adhesive base layer comprises a bonding region and a bending load buffer region, wherein the bonding region bonds the two modules, and wherein a bending stress in the bending load buffer region is smaller than that in the bonding region.2. The adhesive assembly according to claim 1 , wherein the adhesive base layer is provided with at least one through hole claim 1 , and the bending load buffer region comprises a region of the adhesive base layer where the through hole is located.3. The adhesive assembly according to claim 1 , wherein a material of the bending load buffer region comprises a filler having lubrication characteristics.4. The adhesive assembly according to claim 2 , wherein the filler having lubrication characteristics is provided within the at least one through hole.5. The adhesive assembly according to claim 4 , wherein when the adhesive assembly connects the two modules claim 4 , the filler ...

NOVEL INSECTICIDAL PROTEINS AND METHODS OF USE

Compositions and methods for controlling pests are provided. The methods involve transforming organisms with a nucleic acid sequence encoding an insecticidal protein. In particular, the nucleic acid sequences are useful for preparing plants and microorganisms that possess insecticidal activity. Thus, transformed bacteria, plants, plant cells, plant tissues and seeds are provided. Compositions are isolated insecticidal proteins and nucleic acids. The sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest, as probes for the isolation of other homologous (or partially homologous) genes. The insecticidal proteins find use in controlling or killing lepidopteran, coleopteran, dipteran, fungal, hemipteran, and nematode pest populations and for producing compositions with insecticidal activity. 1. (canceled)2. (canceled)3. (canceled)4. (canceled)5. (canceled)6. (canceled)7. (canceled)8. (canceled)9. (canceled)10. (canceled)11. (canceled)12. (canceled)13. (canceled)14. (canceled)15. (canceled)16. (canceled)17. (canceled)18. (canceled)19. An isolated nucleic acid molecule encoding a three-domain insecticidal protein comprising a polypeptide having at least 80% sequence identity to SEQ ID NO: 2 and wherein the following structure is present: i) residues corresponding to Phe26, Val48, Pro50, Ile52, Tyr56, Met193, Val202, His205, Tyr206, Phe207, Trp208, Phe209, and Leu210 of SEQ ID NO: 2;', 'ii) an anti-parallel β-sheet with four short strands and four α-helices designated as helix 1, helix 2, helix 3 and helix 4; and', 'iii) a type 1′ β-turn comprising an amino acid sequence motif as represented by SEQ ID NO: 25;, 'a) a Domain I, comprising a surface hydrophobic patch comprisingb) a Domain II; andc) a Domain III, wherein the surface of Domain II and Domain III comprises a stripe of solvent exposed serine and threonine residues, wherein the isolated nucleic acid molecule encoding the a three-domain insecticidal ...

PEELING LIQUID FOR A RESIST

The invention discloses a peeling liquid for a resist, which relates to an optical element and is used for removing the color resist and the protective layer on a color filter rapidly and efficiently. The peeling liquid for a color resist on a color filter comprises an alkali metal alkoxide with a mass percentage of 10-45%, an organic amine with a mass percentage of 10-30%, a surfactant with a mass percentage of 5-30%, a solvent with a mass percentage of 20-60%, and an alcohol with a mass percentage of 1-55% in terms of the peeling liquid for a resist with a mass percentage of 100%. The peeling liquid for a resist in invention is used for removing the color resist and the protective layer of the substandard product in a color filter. 1. A peeling liquid for a resist , characterized by comprising an alkali metal alkoxide with a mass percentage of 10-45% , an organic amine with a mass percentage of 10-30% , a surfactant with a mass percentage of 5-30% , a solvent with a mass percentage of 20-60% , and an alcohol with a mass percentage of 1-55% in terms of the peeling liquid for a resist with a mass percentage of 100%.2. The peeling liquid for a resist according to claim 1 , characterized in that the alkali metal alkoxide includes one or more of sodium alkoxide claim 1 , lithium alkoxide claim 1 , and potassium alkoxide.3. The peeling liquid for a resist according to claim 2 , characterized in that the alkali metal alkoxide includes one or more of sodium methoxide claim 2 , sodium ethoxide claim 2 , sodium n-propoxide claim 2 , sodium iso-propoxide claim 2 , sodium tert-butoxide claim 2 , potassium methoxide claim 2 , potassium ethoxide claim 2 , potassium n-propoxide claim 2 , potassium iso-propoxide claim 2 , potassium tert-butoxide claim 2 , lithium methoxide claim 2 , lithium ethoxide claim 2 , lithium n-propoxide claim 2 , lithium iso-propoxide claim 2 , and lithium tert-butoxide.4. The peeling liquid for a resist according to claim 1 , characterized in that the ...

OBJECT POSITIONING METHOD, VIDEO DISPLAY METHOD, APPARATUS, DEVICE, AND STORAGE MEDIUM

Disclosed are an object positioning method, a video display method, an apparatus, a device, and a storage medium. The method includes: continuously intercepting a preset number of video frames in a video stream to be detected; detecting a first frame image in the intercepted video frames by a You Only Look Once (YOLO) object detection method to obtain a first positioning result corresponding to the first frame image; detecting each of other frame images in the intercepted video frames by a Kernel Correlation Filter (KCF) object tracking method according to a positioning result corresponding to a frame image prior to the each of the other frame images to obtain respective second positioning results corresponding to the other frame images; and keeping on continuously intercepting the preset number of video frames in the video stream to be detected and obtaining corresponding positioning results until the video stream to be detected is finished. 1. An object positioning method , comprising:continuously intercepting a preset number of video frames in a video stream to be detected;detecting a first frame image in the intercepted video frames by a You Only Look Once (YOLO) object detection method to obtain a first positioning result corresponding to the first frame image;detecting each of other frame images in the intercepted video frames by a Kernel Correlation Filter (KCF) object tracking method according to a positioning result corresponding to a frame image prior to the each of the other frame images to obtain respective second positioning results corresponding to the other frame images; andkeeping on continuously intercepting the preset number of video frames in the video stream to be detected and obtaining corresponding positioning results until the video stream to be detected is finished.2. The method of claim 1 , wherein before detecting the each of the other frame images in the intercepted video frames by a KCF object tracking method according to the positioning ...

Pixel structure for organic light-emitting diodes, display panel and display device including the same

The present invention provides a pixel structure for organic light-emitting diodes, including three types of pixel groups arranged in array. Each of the three types of pixel groups includes two adjacent sub-pixels having a same color. The sub-pixels in pixel groups of different types have different colors. Any two of the pixel groups of the same type are neither adjacent to each other in the row direction nor adjacent to each other in the column direction. The two sub-pixels of each pixel groups in a same row are both arranged in a first direction or both arranged in a second direction, an included angle between the first direction and the row direction is α, 0°≤α≤90°, and the second direction is perpendicular to the first direction. The present design can achieve a compact arrangement of sub-pixels, improve the pixel density and increases the aperture ratio.

OPTIMIZING INTERACTION BETWEEN APPLICATIONS AND DEVICES IN A COMMUNICATIONS NETWORK

An apparatus can monitor interactions between IoT devices and IoT applications. Based on the monitoring, the apparatus may identify an interaction between a given IoT device and a given IoT application that can be adjusted. In an example, the apparatus may generate a recommendation or instruction in response to identifying the interaction. A first instruction may indicate a change in behavior for one of the IoT device or the IoT application. The apparatus may send the instruction to the one of the IoT device or the IoT application, for example, so as to cause the one of the IoT device or the IoT application to change the respective behavior, thereby adjusting the interaction between the IoT device and the IoT application. 1. An apparatus comprising a processor , a memory , and communication circuitry , the apparatus being connected to a network via its communication circuitry , the apparatus further comprising computer-executable instructions stored in the memory of the apparatus which , when executed by the processor of the apparatus , cause the apparatus to perform operations comprising:monitoring interactions between an IoT device and an IoT application;based on the monitoring, identifying an interaction between the IoT device and an IoT application that can be adjusted;generating a first instruction in response to identifying the interaction, the first instruction indicating a change in behavior for one of the IoT device or the IoT application; andissuing the first instruction to the one of the IoT device or the IoT application, so as to cause the one of the IoT device or the IoT application to change the respective behavior, thereby adjusting the interaction between the IoT device and the IoT application.2. The apparatus as recited in claim 1 , wherein the computer-executable instructions cause the apparatus to perform further operations comprising:generating a second instruction in response to identifying the interaction, the second instruction indicating a ...

FLAVONOID POLYPHENOL DRUG SELF-EMULSIFYING COMPOSITION, PREPARATION METHOD THEREFOR, PHARMACEUTICAL COMPOSITION THEREOF AND APPLICATION THEREOF

A flavonoid polyphenol drug self-emulsifying composition based on a flavonoid polyphenol drug-phospholipid complex being used as an intermediate, the composition comprising a flavonoid polyphenol drug-phospholipid complex, an oil phase, an emulsifier and a co-emulsifier, the flavonoid polyphenol drug comprising one or more selected from baicalein, proanthocyanidin, quercetin, curcumin and resveratrol. The described self-emulsifying composition has the beneficial effects of good stability, a high amount of drug loading, high bioavailability, and so on. 1. A flavonoid polyphenol drug self-emulsifying composition , comprising a flavonoid polyphenol drug-phospholipid complex , an oil phase , an emulsifier and a co-emulsifier , wherein the flavonoid polyphenol drug comprises one or more selected from the group consisting of baicalein , proanthocyanidin , quercetin , curcumin and resveratrol;optionally, the flavonoid polyphenol drug further comprise other flavonoid polyphenol drugs in addition to baicalein, proanthocyanidin, quercetin, curcumin and resveratrol, wherein the other flavonoid polyphenol drugs are one or more selected from the group consisting of wogonin, ferulic acid, catechin, magnolol, honokiol, apigenin, hesperetin, rotenone, isobavachalcone, aureusidin, delphinidin and ginkgetin;optionally, the flavonoid polyphenol drugs are baicalein, proanthocyanidin, quercetin, curcumin or resveratrol;optionally, the flavonoid polyphenol drug self-emulsifying composition has a drug loading of 10-110 mg/g, preferably 10-100 mg/g;optionally, the flavonoid polyphenol drug self-emulsifying composition has a particle size of 10-1000 nm.2. The flavonoid polyphenol drug self-emulsifying composition according to claim 1 , wherein in the flavonoid polyphenol drug-phospholipid complex claim 1 , a mass ratio of the flavonoid polyphenol drug to phospholipid is 1:1-1:15.3. The flavonoid polyphenol drug self-emulsifying composition according to claim 1 , wherein the phospholipids ...

UTILITY AND METHOD FOR CAPTURING COMPUTER-GENERATED VIDEO OUTPUT

A video capture utility and method for a computer system. In one embodiment, the video capture utility includes: (1) a circular buffer allocated in a memory of the computer system to store at most a predefined video length, (2) a video output interceptor executable in a processor of the computer system and operable to receive and store video output most recently generated by an application program and (3) a video output extractor executable in the processor and operable to prompt contents of the circular buffer to be copied from the circular buffer to another location. 1. A video capture utility for a computer system , comprising:a circular buffer allocated in a memory of said computer system to store at most a predefined video length;a video output interceptor executable in a processor of said computer system and operable to receive and store video output most recently generated by an application program; anda video output extractor executable in said processor and operable to prompt contents of said circular buffer to be copied from said circular buffer to another location.2. The video capture utility as recited in wherein said video output extractor is further operable to respond to a user command by prompting said contents of said circular buffer to be copied.3. The video capture utility as recited in wherein said other location is a selected one of:a video file, anda video stream over a network coupled to said computer system.4. The video capture utility as recited in wherein said video output interceptor executes in a background of said processor and said computer application executes in a foreground of said processor.5. The video capture utility as recited in wherein said circular buffer is further operable to store video output most recently generated for an entire display of said computer system.6. The video capture utility as recited in wherein said video output interceptor is further operable to receive and store audio output most recently generated by ...

SET TECHNIQUE FOR PHASE CHANGE MEMORY

One embodiment provides a memory controller. The memory controller includes a memory controller circuitry and a set pulse determination circuitry. The memory controller circuitry is to identify an address of a target memory cell to be set. The set pulse determination circuitry is to select a positive polarity set pulse if the target memory cell is included in a positive polarity deck or to select a negative polarity set pulse if the target memory cell is included in a negative polarity deck. Each set pulse includes a respective nucleation portion and a respective growth portion. Each portion has a respective current amplitude and a respective time duration. 1. A memory controller comprising:a memory controller circuitry to identify an address of a target memory cell to be set; and a set pulse determination circuitry to select a positive polarity set pulse if the target memory cell is included in a positive polarity deck or to select a negative polarity set pulse if the target memory cell is included in a negative polarity deck,each set pulse comprising a respective nucleation portion and a respective growth portion, each portion having a respective current amplitude and a respective time duration.2. The memory controller of claim 1 , wherein a nucleation portion duration of the positive polarity set pulse differs from a nucleation portion duration of the negative polarity set pulse and a growth portion duration of the positive polarity set pulse differs from a growth portion duration of the negative polarity set pulse.3. The memory controller of claim 1 , wherein a nucleation portion duration of the positive polarity set pulse is greater than a nucleation portion duration of the negative polarity set pulse and a growth portion duration of the positive polarity set pulse is less than a growth portion duration of the negative polarity set pulse.4. The memory controller of claim 1 , wherein at least one of a growth portion current amplitude of the positive polarity set ...

FRAMEWORK TO ENABLE CONSUMPTION OF CAPTURED GAMEPLAY DATA OVER MULTIPLE MEDIUMS CONCURRENTLY

A game recording unit includes a gaming data capture section coupled to a game playing unit and configured to capture gameplay audio and video data for processing as directed by a game user control input. The game recording unit also includes a gaming data processing section coupled to the gaming data capture section and configured to process the gameplay audio and video data, wherein the processing includes a manual mode, a gamecast mode and a shadow mode of gameplay capture. Additionally, game recording unit includes a gaming data output section coupled to the gaming data processing section and configured to provide output options for the manual, gamecast and shadow modes. A game recording method and a game recording system are also included. 1. A game recording unit , comprising:a gaming data capture section coupled to a game playing unit and configured to capture gameplay audio and video data for processing as directed by a game user control input;a gaming data processing section coupled to the gaming data capture section and configured to process the gameplay audio and video data, wherein the processing includes a manual mode, a gamecast mode and a shadow mode of gameplay capture; anda gaming data output section coupled to the gaming data processing section and configured to provide output options for the manual, gamecast and shadow modes.2. The unit as recited in wherein the gameplay audio and video data includes frame data captured from a GPU memory of the game playing unit.3. The unit as recited in wherein the game user control input is selected from the group consisting of:a key stroke;a pointing device action; anda touch screen selection.4. The unit as recited in wherein each of the manual claim 1 , gamecast and shadow modes is activated separately.5. The unit as recited in wherein two or more of the manual claim 1 , gamecast and shadow modes are activated concurrently.6. The unit as recited in wherein processing of the gameplay audio and video data ...

METHOD FOR MANUFACTURING FLEXIBLE SUBSTRATE, FLEXIBLE SUBSTRATE AND DISPLAY DEVICE

A method for manufacturing a flexible substrate, a flexible substrate manufactured using the method and a display device including the flexible substrate are disclosed. The method includes steps of: coating a glass carrier with a plurality of film layers, wherein each of at least one pair of adjacent film layers of the plurality of film layers is formed through steps of: S1: coating the glass carrier with a first film layer; and S2: coating the glass carrier with a second film layer over the first film layer so that the second film layer covers the first film layer, wherein the second film layer has an area greater than an area of the first film layer; and peeling off the plurality of formed film layers from the glass carrier to form a flexible substrate. 1. A method for manufacturing a flexible substrate , comprising steps of: S1: coating the glass carrier with a first film layer; and', 'S2: coating the glass carrier with a second film layer over the first film layer so that the second film layer covers the first film layer, wherein the second film layer has an area greater than an area of the first film layer; and, 'coating a glass carrier with a plurality of film layers, wherein each of at least one pair of adjacent film layers of the plurality of film layers is formed through steps ofpeeling off the plurality of film layers from the glass carrier to form the flexible substrate.2. The method according to claim 1 , wherein in step S2 claim 1 , an edge of the first film layer is spaced apart from an edge of the second film layer by a distance of 5 mm or more.3. The method according to claim 1 , further comprising a step of:providing a blocking layer on the first film layer for blocking water and/or oxygen before the step S2, wherein the second film layer covers the blocking layer in the step S2.4. The method according to claim 1 , wherein the glass carrier is coated with the first film layer and the second film layer by means of a slit extrusion coating.5. The ...

ALARM CONTROLLING METHOD AND APPARATUS FOR PATIENT MONITOR, AND ADAPTIVE ALARMING METHOD FOR PATIENT MONITOR

The present invention provides an alarm controlling method, an alarm controlling apparatus and an adaptive alarming method for a patient monitor. The alarm controlling method comprises: acquiring false alarm probabilities of a plurality of current alarms; acquiring a corresponding alarm confidence according to a false alarm probability of each current alarm; and determining a priority of the current alarm based on at least the alarm confidence of the current alarm. 1. An alarm controlling method for a patient monitor , comprising:acquiring false alarm probabilities of a plurality of current alarms;acquiring a corresponding alarm confidence based on a false alarm probability of each current alarm;determining a priority of the current alarm based on at least the alarm confidence of the current alarm.2. The alarm controlling method for a patient monitor according to claim 1 , further comprising:determining a display order of the current alarm according to the priority of the current alarm; anddisplaying the current alarm in the determined display order.3. The alarm controlling method for a patient monitor according to claim 1 , further comprising: displaying the alarm confidence of the current alarm.4. The alarm controlling method for a patient monitor according to claim 1 , wherein the plurality of current alarms have a plurality of alarm levels claim 1 , and for a current alarm with the same alarm level claim 1 , a priority of the current alarm rises as its alarm confidence increases.5. The alarm controlling method for a patient monitor according to claim 1 , wherein the acquiring false alarm probabilities of a plurality of current alarms further comprises:determining a ratio of a false alarm number to an alarm number of each current alarm in historical alarm data, so as to obtain a false alarm probability of each current alarm.6. The alarm controlling method for a patient monitor according to claim 5 , further comprising:accumulating the current alarm into the alarm ...

Insecticidal proteins and methods for their use

Compositions and methods for controlling pests are provided. The methods involve transforming organisms with a nucleic acid sequence encoding an insecticidal protein. In particular, the nucleic acid sequences are useful for preparing plants and microorganisms that possess insecticidal activity. Thus, transformed bacteria, plants, plant cells, plant tissues and seeds are provided. Compositions are insecticidal nucleic acids and proteins of bacterial species. The sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest including plants, as probes for the isolation of other homologous (or partially homologous) genes. The pesticidal proteins find use in controlling, inhibiting growth or killing Lepidopteran, Coleopteran, Dipteran, fungal, Hemipteran and nematode pest populations and for producing compositions with insecticidal activity.

Integrated on-line monitoring and thermostatic heating apparatus for bioartificial liver device

An integrated on-line monitoring and thermostatic heating apparatus for a bioartificial liver device, the apparatus including a blood inlet, a blood pump, an arterial drip chamber, a bioreactor module, a venous drip chamber, and a blood reinfusion port which are connected in sequence. The bioreactor module includes a thermostatic water tank and a bioreactor disposed in the thermostatic water tank. The bioreactor includes a container, and a first partition and a second partition which are disposed in the container. The first partition and the second partition separate the container into three independent parts, that is, a plasma separator, an oxygenator, and a reactor. The plasma separator and the oxygenator are connected through an external connection pipe. The external connection pipe is equipped with a separation pump. The second partition includes a communication hole, and the reactor and the oxygenator are connected through the communication hole.

BIOARTIFICIAL LIVER DEVICE

A bioartificial liver device including a bioreaction chamber having a plurality of semi-permeable membranes and a plurality of filter spaces each confined by two adjacent semi-permeable membranes; a plurality of liver cell perfusion ports each communicating with one of the filter spaces for introducing the liver cells into the filter spaces, and a positive peristaltic pump. In the device, the semi-permeable membranes are disposed substantially horizontal with respect to the ground, and the positive peristaltic pump is adapted to drive the plasma flow from the bottom wall of the device to the top wall. The device of the invention improves the cell loading and the area for substance exchange between the blood and the liver cells. 1. A bioartificial liver device comprising:a housing comprising a top wall, a bottom wall, and a side wall;a chamber confined by the housing;a first semi-permeable membrane that is disposed within the chamber and subdivides the chamber into a plasma-separation chamber and a bioreaction chamber;a plurality of hollow fiber filaments disposed in the plasma-separation chamber;a blood inlet;a blood cell outlet;a first plasma opening;a second plasma opening;a separation pump;a plurality of second semi-permeable membranes disposed in the bioreaction chamber;a plurality of filter spaces;a plurality of liver cell perfusion port;a plasma outlet; anda positive peristaltic pump;wherein:the top wall and the bottom wall are adapted to be disposed substantially horizontal with respect to the ground;the top wall is adapted to be disposed above the bottom wall with respect to the ground;the side wall connects the top wall with the bottom wall;the blood inlet is disposed on the top wall and communicates with the plasma-separation chamber, for the purpose of introducing blood of a patient into the plasma-separation chamber;the blood cell outlet is disposed on the bottom wall and communicates with the plasma-separation chamber;one end of each hollow fiber ...

COLLISION JUDGMENT SYSTEM, METHOD, APPARATUS, AND DEVICE

The present disclosure provides a collision judgment method and apparatus. The method includes: determining, by a moving device, according to acceleration data collected by an acceleration sensor, that the moving device collides; sending collision information to the corresponding control device, including at least a moving device identifier and a collision time; sending, by the corresponding control device, the collision information to a collision judgment device; detecting, by the collision judgement device, whether at least two collision information sent by the at least two control devices is received within a predetermined time interval; when the at least two collision information is received within the predetermined time interval, and a difference between collision times carried in the at least two collision information is less than a preset threshold, determining that moving devices corresponding to moving device identifiers carried in the at least two collision information collided with one other. 1. A collision judgment method , applied to a collision judgment device , at least two moving devices each having an acceleration sensor , and at least two control devices respectively corresponding to each moving device , comprising:determining, by a moving device, according to acceleration data collected by the acceleration sensor, whether the moving device collides;when determining that the moving device collides, sending, by the moving device, collision information to the corresponding control device, the collision information comprising at least a moving device identifier and a collision time;sending, by the corresponding control device, the collision information to the collision judgment device;detecting, by the collision judgement device, whether at least two collision information sent by the at least two control devices is received within a predetermined time interval;when the at least two collision information sent by the at least two control devices is ...

Prediction model enhancement

An enhanced prediction model utilizing product life cycle segmentation and historic prediction data for generating more accurate future failure rates. Input data is segmented into groups based on failure modes of a corresponding life cycle. A prediction model such as Weibull analysis is implemented for each segmented group. Historical prediction data is also segmented into groups. Prediction parameters for each group of segmented historical prediction data are compared with one another and the comparisons are then used to adjust the prediction parameters generated from the segmented groups of input data. Updated parameters for the input data are then output thereby generating a new future failure rate.

HIGH-SPEED LOW-POWER-CONSUMPTION TRIGGER

A high-speed low-power-consumption trigger, which comprises a control signal generation circuit, an enabling unit, and a latch structure. The latch structure comprises two input ends, two output ends, two enabling ends, a second enabling end, and a ground end. The enabling unit comprises two enabling circuits. An output signal X of the control signal generation circuit and an external control signal D serve as input signals of the first enabling circuit. An output end of the first enabling circuit is connected to the first enabling end. The output signal X of the control signal generation circuit and a phase-inverted signal DB of the external control signal D serve as input signals of the second enabling circuit. An output end of the second enabling circuit is connected to the second enabling end. 1. A high-speed low-power-consumption trigger , comprising a control signal generation circuit , an enabling unit , and a latch structure , wherein the latch structure comprises a first input end , a second input end , a first output end , a second output end , a first enabling end , a second enabling end , and a ground end , the enabling unit comprises a first enabling circuit and a second enabling circuit , an output signal X of the control signal generation circuit and an external control signal D serve as input signals of the first enabling circuit , an output end of the first enabling circuit is connected to the first enabling end , the output signal X of the control signal generation circuit and a phase-inverted signal DB of the external control signal D serve as input signals of the second enabling circuit , and an output end of the second enabling circuit is connected to the second enabling end; and the external control signal D serves as an input signal of the first input end , and the phase-inverted signal DB of the external control signal D serves as an input signal of the second input end.2. The high-speed low-power-consumption trigger as in claim 1 , wherein ...

Flexible device and fabrication method thereof, display apparatus

A method for fabricating a flexible device is provided. The method includes forming a sacrificial layer on a substrate; and forming a reflective layer to reflect a laser for subsequently de-bonding the sacrificial layer from the rigid substrate back to the sacrificial layer to reduce required de-bonding energy of the laser over at least a portion of the rigid substrate. Further, the method includes forming a flexible device over the reflective layer; and separating the substrate from the sacrificial layer by irradiating the sacrificial layer using the laser.

HIGH SPEED SAMPLING FRONT-END CIRCUIT

A high-speed sampling front-end circuit is presented that includes a MDAC sampling network, a reference voltage generator circuit, a comparator array, an operational amplifier, an output short-circuit switch, an adjustable clock duty cycle stabilizer, a status control module and a feedback control module. The circuit features low power, high sampling rate and high input bandwidth of sampling network. The time constant of the MDAC sampling network and the comparator array is precisely matched one another to improve input bandwidth of the sampling network. Sampling capacitors are designed as feedback capacitors and DAC calculation capacitors, thereby the operational amplifier doubles feedback coefficient and features 50% bandwidth and 50% power. The cycle stabilizer is adopted to shorten sampling time and extend amplification phase to greatly improve sampling rate. One input reference voltage tends to simplify the design of the reference voltage generator circuit. The circuit has wide applications in pipelined A/D converters. 1. A high speed sampling front-end circuit , including a MDAC sampling network , a comparator array , an operational amplifier , an output short-circuit switch , a clock duty cycle stabilizer , a reference voltage generator circuit , a status control module and a feedback control module , whereinsaid MDAC sampling network is used for sampling input signals;said comparator array is used for sampling input signals and generating comparison-based signals through comparison between input signals and threshold voltages, wherein the comparison-based signals and the clock signals from the clock duty cycle stabilizer are used to control the working status of the MDAC sampling network through the status control module;said status control module is connected to the MDAC sampling network to control the working status of the MDAC sampling network;one end of said feedback control module is connected to an output end of the operational amplifier with the other ...

FILTRATION MEDIA WITH EXTENDED SURFACE AREA

A filter media and methods are provided. The media is stretchable and exhibits a high degree of elongation which thereby extends its surface area during pleating. By extending surface area of media during pleating, the initial differential pressure is lowered as the area of media is stretched while keeping the same efficiency range with a compressed thickness of media on the affected area. 1. A filter media , comprising:a backing layer;a filtration layer applied to the backing layer, the filtration layer deposited onto the backing layer and comprising thermoplastic polyurethane, wherein the filtration layer has an elongation of about 50% to about 350%; andwherein the filter media has a combined elongation of about 20% to about 80%.2. The filter media of claim 1 , wherein the filtration layer comprises a low molecular weight polyurethane and one of a high molecular weight polyurethane and a medium molecular weight polyurethane.3. The filter media of claim 1 , wherein the backing layer is formed of one of polypropylene claim 1 , bicomponent polyester claim 1 , co-polyester claim 1 , polyethylene-polyester bico material or moldable glass media.4. The filter media of claim 3 , wherein the backing layer has an air permeability of less than about 900 ft/ft/min.5. The filter media of claim 3 , wherein the backing layer has a sheet thickness of less than 1 mm.6. The filter media of claim 2 , wherein the filtration layer comprises the low molecular weight thermoplastic polyurethane and the high molecular weight thermoplastic polyurethane.7. The filter media of claim 6 , wherein the low molecular weight thermoplastic polyurethane is about 60% by weight to about 99.75% by weight of the filtration layer and the high molecular weight thermoplastic polyurethane is about 0.25% by weight to about 40% by weight of the filtration layer.8. The filter media of claim 2 , wherein the filtration layer comprises the low molecular weight thermoplastic polyurethane and the medium molecular ...

FLUID TREATMENT METHODS AND SYSTEMS

Methods and systems for treatment of wastewater. In some embodiments, the system may comprise one or more modules such as an electrochemical module, an electrocoagulation module, a flotation module, an evaporation module, and an ultrafiltration module. One or more detection modules may also be provided to analyze the concentration of one or more wastewater components in the wastewater. Data from such modules may be used to adjust one or more operational parameters or conditions in the treatment system. The system may also comprise one or more features designed to minimize adverse effects on the environment, such as avoiding adding chemicals to the stream, extracting salt or other chemicals for re-use, and/or use of carbon dioxide gas from on-site combustion processes. 1. A system for treatment of wastewater , comprising:a wastewater feed port configured to receive an incoming stream of wastewater;an electro-oxidation module configured to receive an incoming wastewater stream and facilitate precipitation of one of more contaminants from the wastewater stream passing therethrough;an electrocoagulation module comprising at least two electrodes, wherein the electrocoagulation module is configured to receive an incoming wastewater stream and remove one or more contaminants from the wastewater stream passing therethrough;a flotation module configured to receive and separate an incoming wastewater stream into an aqueous phase stream and at least one of an oil phase stream and a sludge phase stream;an evaporation module configured to receive the aqueous phase stream from the flotation module and further configured to precipitate scale-forming elements within the aqueous phase stream;an ultrafiltration module configured to receive an incoming stream, remove precipitated solids formed by the evaporation module, and deliver an outgoing stream of permeate comprising a salt solution; anda detection module configured to analyze the concentration of one or more wastewater ...

DISPLAY SUBSTRATE, MANUFACTURING METHOD THEREOF, AND DISPLAY DEVICE

The display substrate includes: the flexible base substrate and the trace layer, a first adhesion-enhancing layer, and a first insulating layer that are stacked on the flexible base substrate, wherein the first adhesion-enhancing layer is between the first insulating layer and the trace layer, and the first adhesion-enhancing layer is bonded to the first insulating layer and the trace layer respectively. The flexible base substrate is provided with a bending area, and an overlapping area is present between an area which an orthographic projection of the first adhesion-enhancing layer on the flexible base substrate is within and the bending area, and an orthographic projection of the signal trace in the trace layer on the flexible base substrate falls in the bending area. 1. A display substrate comprising: a flexible base substrate and a trace layer a first adhesion-enhancing layer , and a first insulating layer that are stacked on the flexible base substrate , whereinthe first adhesion-enhancing layer is between the first insulating layer and the trace layer, and the first adhesion-enhancing layer is bonded to the first insulating layer and the trace layer respectively;the flexible base substrate is provided with a bending area, and an overlapping area is present between an area which an orthographic projection of the first adhesion-enhancing layer on the flexible base substrate is within and the bending area; andthe trace layer is provided with a signal trace, and an overlapping area is present between an area which an orthographic projection of the signal trace on the flexible base substrate is within and the bending area.2. The display substrate according to claim 1 , wherein a material of the first adhesion-enhancing layer comprises one or more of an acrylic resin claim 1 , a epoxy resin claim 1 , and a polyimide.3. The display substrate according to claim 1 , wherein a thickness of the first adhesion-enhancing layer is in a range of 1 micron to 3 microns.4. The ...

THERMAL VOLUME REDUCTION OF RADIOACTIVE WASTES

A method for thermal volume reduction of waste material contaminated with radionuclides includes feeding the waste material into a fluidized bed reactor, injecting fluidizing gas into the fluidized bed reactor to fluidize bed media in the fluidized bed reactor, and decomposing the waste material in the fluidized bed reactor. A system for thermal volume reduction of the waste material includes one or more of a feedstock preparation and handling system, a fluidized bed reactor system, a solids separation system, and an off-gas treatment system. The method and system may be used to effectively reduce the volume or radioactive wastes generated from the operation of nuclear facilities such as nuclear power plants including wastes such as spent ion exchange resin, spent granular activated carbon, and dry active waste. The majority of the organic content in the waste material is converted into carbon dioxide and steam and the solids, including the radionuclides, are converted into a waterless stable final product that is suitable for disposal or long-term storage. 1. A method of decomposing dewatered waste material contaminated with radionuclides in a fluidized bed reactor , the method comprising:feeding the dewatered waste material into the fluidized bed reactor;injecting fluidizing gas into the fluidized bed reactor to fluidize bed media and form a fluidized bed in the fluidized bed reactor, the fluidizing gas comprising superheated steam; anddecomposing the dewatered waste material in the fluidized bed reactor;wherein the dewatered waste material is not fed into the fluidized bed reactor in a slurry.2. The method of wherein the dewatered waste material comprises spent ion exchange resin and/or spent granular activated carbon.3. The method of wherein the spent ion exchange resin and/or the spent granular activated carbon have a water content of no more than 70 wt %.4. The method of comprising feeding the dewatered waste material into the fluidized bed reactor using a ...

BID ADJUSTMENT SUGGESTIONS BASED ON DEVICE TYPE

Systems and methods for suggesting a bid adjustment value based on device type include receiving parameters for a third-party content provider's campaign to present third-party content on a first type of device. Based on the campaign's parameters, bids from peer providers that use similar campaign parameters for both the first type of device and another type of device may be identified. For example, bids from providers that use similar parameters as the campaign for both mobile and desktop devices may be identified. The identified bids from the peer providers may be used to calculate a bid adjustment value. The bid adjustment value can be provided for presentation to the third-party content provider as a suggested change to his or her bid for the first type of device, to establish a bid for the second type of device. 1. A method of determining a bid adjustment value for a mixed platform campaign comprising:receiving, at a processing circuit, parameters for a third-party content provider's campaign to present third-party content in conjunction with first-party content, the parameters comprising a bid amount for use in content auctions and one or more selection parameters configured to control when the bid amount is used in a content auction, the selection parameters specifying at least a first type of client device associated with the bid amount to which the third-party content is to be provided;identifying bid amounts from other third-party content providers' campaigns that use similar selection parameters as the third-party content provider's campaign, each third-party content provider having a campaign associated with the first type of client device and another campaign associated with a second type of client device;determining an aggregate measure of the bid amounts from the other third-party content providers' campaigns associated with the first type of client device;determining an aggregate measure of the bid amounts from the other third-party content providers ...

BID ADJUSTMENT SUGGESTIONS BASED ON DEVICE TYPE

Systems and methods for suggesting a bid adjustment value based on device type include receiving parameters for a third-party content provider's campaign to present third-party content on a first type of device. Based on the campaign's parameters, bids from peer providers that use similar campaign parameters for both the first type of device and another type of device may be identified. For example, bids from providers that use similar parameters as the campaign for both mobile and desktop devices may be identified. The identified bids from the peer providers may be used to calculate a bid adjustment value. The bid adjustment value can be provided for presentation to the third-party content provider as a suggested change to his or her bid for the first type of device, to establish a bid for the second type of device. 1. A method for determining a bid adjustment value comprising:accessing a first set of bid amounts used in content auctions by a plurality of content providers to provide third-party content to a first type of device;accessing a second set of bid amounts used in content auctions by the plurality of content providers to provide third-party content to a second type of device;determining a relationship between the first set of bid amounts and the second set of bid amounts;identifying the plurality of content providers as using the same selection parameters as a content provider;calculating, by one or more processors, a suggested bid adjustment value for the content provider based on the relationship between the first set of bid amounts and the second set of bid amounts used by the plurality of content providers; andproviding the suggested bid adjustment value for presentation.2. The method of claim 1 , wherein calculating the suggested bid adjustment value comprises:calculating an average of the first set of bid amounts;calculating an average of the second set of bid amounts; anddetermining a ratio between the average of the first set of bid amounts and ...

INSECTICIDAL PROTEINS AND METHODS FOR THEIR USE

Compositions and methods for controlling pests are provided. The methods involve transforming organisms with a nucleic acid sequence encoding an insecticidal protein. In particular, the nucleic acid sequences are useful for preparing plants and microorganisms that possess insecticidal activity. Thus, transformed bacteria, plants, plant cells, plant tissues and seeds are provided. Compositions are insecticidal nucleic acids and proteins of bacterial species. The sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest including plants, as probes for the isolation of other homologous (or partially homologous) genes. The pesticidal proteins find use in controlling, inhibiting growth or killing Lepidopteran, Coleopteran, Dipteran, fungal, Hemipteran and nematode pest populations and for producing compositions with insecticidal activity. 1. A recombinant insecticidal polypeptide having at least 80% sequence identity to the amino acid sequence of SEQ ID NO: 2 , SEQ ID NO: 4 , SEQ ID NO: 6 , SEQ ID NO: 384 or fragments thereof having insecticidal activity.2. The recombinant insecticidal polypeptide of claim 1 , wherein the fragment comprises amino acids 1-315 claim 1 , amino acids 1-330 claim 1 , amino acids 1-349 claim 1 , amino acids 1-450 claim 1 , amino acids 25-315 claim 1 , amino acids 25-330 claim 1 , amino acids 25-349 claim 1 , amino acids 25-450 or amino acids 25-483 of SEQ ID NO: 2 claim 1 , SEQ ID NO: 4 or SEQ ID NO: 6.3. The recombinant insecticidal polypeptide of claim 2 , wherein the polypeptide comprises amino acids 25-483 of SEQ ID NO: 2 claim 2 , SEQ ID NO: 4 or SEQ ID NO: 6.4. The recombinant insecticidal polypeptide of claim 1 , wherein the insecticidal polypeptide is joined to a heterologous signal sequence or a transit sequence.5. A chimeric polypeptide comprising: an N-terminal Region of a first polypeptide having at least 80% sequence identity to the amino acid sequence of SEQ ID NO: 2 ...

COMPOSITIONS AND METHODS COMPRISING SEQUENCES HAVING MEGANUCLEASE ACTIVITY

Compositions and methods comprising polynucleotides and polypeptides having meganuclease activity are provided. Further provided are nucleic acid constructs, yeast, plants, plant cells, explants, seeds and grain having the meganuclease sequences. Various methods of employing the meganuclease sequences are provided. Such methods include, for example, methods for producing a meganuclease with increased activity at a wide range of temperatures, methods for producing a yeast, plant, plant cell, explant or seed comprising a meganuclease with increased activity. 1. An isolated or recombinant polynucleotide comprising a nucleotide sequence encoding a meganuclease polypeptide , said polypeptide comprising:a) an amino acid sequence having at least one amino acid modification at an amino acid position corresponding to a position of SEQ ID NO:1 selected from the group consisting of positions 2, 12, 16, 22, 23, 31, 36, 43, 50, 56, 58, 59, 62, 71, 72, 73, 80, 81, 82, 86, 91, 95, 98, 103, 113, 114, 116, 117, 118, 121, 124, 128, 129, 131, 147, 151, 153, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 194, 195, 196, 197, 200, 203, 204, 209, 222, 232, 236, 237, 246, 254, 258, 267, 278, 281, 282, 289, 308, 311, 312, 316, 318, 319, 334, 339, 340, 342, 345, 346, 348 and combinations thereof; or,b) an amino acid sequence having at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43 or 44 of any of the amino acid modification of (a);2. The isolated or recombinant polynucleotide of claim 1 , wherein said nucleotide sequence encodes a meganuclease polypeptide having at least 80% sequence identity to SEQ ID NO: 1.3. The isolated or recombinant polynucleotide of claim 1 , wherein said at least one amino acid modification comprises;a) an aspartic acid (D) at a ...

Network Isolation in Virtual Desktop Infrastructure

Disclosed are methods and apparatus for isolating a connection between a client machine and a remote desktop application running on a virtual machine (VM), the remote desktop application providing a virtual desktop to the client machine. The VM is configured to execute the remote desktop application and one or more other applications. The connection between the client machine and the remote desktop application, for exchanging remote desktop protocol data, is provided by using a first virtual network interface card (VNIC) on the VM, where the first VNIC is exclusively accessible by the remote desktop application and inaccessible to the one or more other applications. Another connection between a remote server and one of the one or more other applications is provided using a second VNIC on the VM, in response to the remote desktop application receiving an indication from the virtual desktop to execute the one application. 1. A method for isolating a connection between a client machine and a remote desktop application , the method comprising:providing the connection between the client machine and the remote desktop application to exchange remote desktop protocol data by using a first virtual network interface card (VNIC) on a virtual machine (VM),wherein the VM is configured to execute the remote desktop application and one or more other applications, the remote desktop application providing a virtual desktop to the client machine, andwherein the first VNIC is exclusively accessible by the remote desktop application and inaccessible to the one or more other applications; andproviding another connection between a remote server and one of the one or more other applications using a second VNIC on the VM, in response to the remote desktop application receiving an indication from the virtual desktop to execute the one application.2. The method of claim 1 , wherein the first VNIC operates in a kernel space of a guest operating system of the VM.3. The method of claim 2 , ...

COMPOSITIONS AND METHODS COMPRISING SEQUENCES HAVING MEGANUCLEASE ACTIVITY

Compositions and methods comprising polynucleotides and polypeptides having meganuclease activity are provided. Further provided are nucleic acid constructs, yeast, plants, plant cells, explants, seeds and grain having the meganuclease sequences. Various methods of employing the meganuclease sequences are provided. Such methods include, for example, methods for producing a meganuclease with increased activity at a wide range of temperatures, methods for producing a yeast, plant, plant cell, explant or seed comprising a meganuclease with increased activity. 1. An isolated or recombinant polynucleotide comprising a nucleotide sequence encoding a meganuclease polypeptide , said polypeptide comprising:a) an amino acid sequence having at least 80% sequence identity to SEQ ID NO:283 and at least one amino acid modification at an amino acid position corresponding to a position of SEQ ID NO: 283 selected from the group consisting of positions 16, 19, 22, 50, 54, 56, 81, 103, 121, 132, 153, 244, 258, 281, 308, 316, 319, and combinations thereof; or,b) an amino acid sequence having at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 of any of the amino acid modification of (a).2. (canceled)3. The isolated or recombinant polynucleotide of claim 1 , wherein said at least one amino acid modification comprises:a) an isoleucine (I) at a position corresponding to amino acid position 16 in SEQ ID NO: 283;b) a glycine (G) at a position corresponding to amino acid position 19 in SEQ ID NO: 283;c) a cysteine (C) at a position corresponding to amino acid position 22 in SEQ ID NO: 283;d) an arginine (R) or lysine (K) at a position corresponding to amino acid position 50 in SEQ ID NO: 283;e) an isoleucine (I) at a position corresponding to amino acid position 54 in SEQ ID NO: 283;f) an aspartic acid (D) at a position corresponding to amino acid position 56 in SEQ ID NO: 283;g) a lysine (K) at a position corresponding to amino acid position 81 in SEQ ID NO: 283;h) an ...

CONDUCTIVE COMPOSITION AND THE METHOD FOR PRODUCING THE SAME, COLOR FILTER AND THE METHOD FOR PRODUCING THE SAME

The embodiments of the invention provide a conductive composition and a method for producing the same, a color filter and a method for producing the same. The invention relates to the display technology field, and can simplify the process for producing the transparent conductive layer, and reduce the production cost; the conductive composition comprises a modified epoxy acrylic resin, a polyurethane acrylic resin, a polyaniline, a photo initiator, a fluorine-containing acrylate monomer, and optionally a filler and an auxiliary agent; wherein, in terms of weight ratio, the modified epoxy acrylic resin comprises 15-30 parts; the polyurethane acrylic resin comprises 10-20 parts; the polyaniline comprises 15-30 parts; the photo initiator comprises 2-4 parts; the fluorine-containing acrylate monomer comprises 15-35 parts; the filler comprises 0-25 parts; and the auxiliary agent comprises 0-8 parts; the conductive composition is useful for producing a display device. 119-. (canceled)20. A method for producing a conductive composition , comprising:mixing and dissolving a photo initiator with a fluorine-containing acrylate monomer;adding a modified epoxy acrylic resin, a polyurethane acrylic resin and a polyaniline, and uniformly dispersing them; and optionally, at the same time of adding the modified epoxy acrylic resin, the polyurethane acrylic resin and the polyaniline, adding an auxiliary agent, wherein the auxiliary agent comprises one or more of a leveling agent, an antifoaming agent, and a dispersant;optionally adding a filler and uniformly dispersing it;grinding the uniformly mixed material, to obtain an organic transparent conductive solution;wherein, in terms of weight ratio, the modified epoxy acrylic resin is 15-30 parts; the polyurethane acrylic resin is 10-20 parts; the polyaniline is 15-30 parts; the photo initiator is 2-4 parts; the fluorine-containing acrylate monomer is 15-35 parts; the auxiliary agent is 0-8 parts; and the filler is 0-25 parts.21. The ...

IDENTIFICATION OF INSTALLATION CONVERSION FROM ONLINE ELECTRONIC RESOURCES

Methods, systems, and apparatus, including computer programs encoded on a computer storage medium, for detecting and utilizing conversion data are disclosed. In one aspect, the system can receive an indication of a user interaction with content item presented at a user device. Based at least in part on a device identifier of the user device being received with installation data corresponding to the installation of an application, the system can attribute a conversion of the content item to the user interaction. 1. A system to determine associations between online electronic resources and data transmission to user devices , the system comprising one or more processors that:transmit, over a network to a user device, a content item, the content item comprising instructions for generating a device identifier unique to the user device;receive an indication of a user interaction with the content item transmitted to the user device and the device identifier unique to the user device;store the indication of the user interaction in association with the device identifier unique to the user device;receive, from the user device and responsive to the installation of a first application on the user device; the device identifier unique to the user device;determine, based on a determination that the first application was installed on the user device, receipt of the device identifier unique to the user device, and the stored association between the device identifier unique to the user device and the user interaction with the content item, that the installation of the first application is attributable to the user interaction; andrecord, in response to the determination that the installation of the first application is attributable to the user interaction, a conversion for the content item in a database.2. The system of claim 1 , comprising the one or more processors that:delete the stored indication of the user interaction with the content item responsive to recoding the conversion ...

Identification of installation conversion from online electronic resources

Methods, systems, and apparatus, including computer programs encoded on a computer storage medium, for detecting and utilizing conversion data are disclosed. In one aspect, the system can receive an indication of a user interaction with content item presented at a user device. Based at least in part on a device identifier of the user device being received with installation data corresponding to the installation of an application, the system can attribute a conversion of the content item to the user interaction.

PNEUMATIC VALVE

A valve for a pneumatic system, has: a first enclosure defining a first chamber and a first connection port; a second enclosure defining a second chamber and a second connection port; a first shell subjected to a first pressure differential and movable from a default position to a reversed position via snap-through buckling upon the first pressure differential reaching a threshold; and a second shell having a shape different than a shape of the first shell, the second shell resiliently movable from an initial position to a deformed position when subjected to a second pressure differential, wherein a first flow rate of a fluid via the first connection port induces deformation of the second shell followed by a snapping of the first shell thereby generating a second flow rate greater than the first flow rate. 1. A valve for a pneumatic system , comprising:a first enclosure defining a first chamber and a first connection port of the valve, the first connection port communicating with the first chamber;a second enclosure defining a second chamber and a second connection port of the valve, the second connection port communicating with the second chamber;a first shell subjected to a first pressure differential between a pressure of the first chamber and a pressure of the second chamber or a pressure of an environment outside both of the first chamber and the second chamber, the first shell movable from a default position to a reversed position via snap-through buckling of a membrane of the first shell upon the first pressure differential reaching a threshold; anda second shell having a shape different than a shape of the first shell, the second shell resiliently movable from an initial position to a deformed position when subjected to a second pressure differential between the pressure of the first chamber and the other of the pressure of the second chamber and the pressure of the environment,wherein a first flow rate of a fluid via the first connection port induces ...

ARRAY SUBSTRATE, DISPLAY PANEL, DISPLAY DEVICE, METHOD FOR MANUFACTURING ARRAY SUBSTRATE AND METHOD FOR MANUFACTURING DISPLAY PANEL

An array substrate, a display panel, a display device, a method for manufacturing the array substrate and a method for manufacturing the display panel are provided. The array substrate includes a base substrate, and an organic layer and a passivation layer arranged above the base substrate. The base substrate includes a display region and a non-display region surrounding the display region. Each of the organic layer and the passivation layer is arranged in both the display region and the non-display region. A groove is arranged in the organic layer and the passivation layer in the non-display region, the groove penetrates the organic layer and the passivation layer and is of a closed pattern surrounding the display region. The groove is to be filled with a sealing material. 1. An array substrate , comprising:a base substrate; andan organic layer and a passivation layer arranged above the base substrate,wherein the base substrate comprises a display region and a non-display region surrounding the display region, each of the organic layer and the passivation layer is arranged in both the display region and the non-display region, a groove is arranged in the organic layer and the passivation layer in the non-display region, the groove penetrates the organic layer and the passivation layer and is of a closed pattern surrounding the display region, and the groove is configured to be filled with a sealing material.2. The array substrate according to claim 1 , wherein the non-display region comprises a sealant arrangement region surrounding the display region claim 1 , and the groove is arranged in the sealant arrangement region.3. The array substrate according to claim 1 , further comprising a source-drain metal layer and a first transparent conductive layer arranged above the base substrate claim 1 ,wherein the first transparent conductive layer comprises a portion arranged in the display region and a portion arranged in the non-display region, and in the display region, ...

METHOD OF INSULATING LITHIUM ION ELECTROCHEMICAL CELL COMPONENTS WITH METAL OXIDE COATINGS

Disclosed is a method for making a lithium-ion cell by depositing from an atmospheric plasma deposition device inorganic oxide particles produced from a precursor in an atmospheric plasma as a coating on a surface of a lithium-ion electrochemical cell component. The coating formed by the inorganic oxide particles may be an insulating coating or may provide dimensional stability during a thermal runaway. 1. A method for making a lithium-ion cell , comprising:depositing from an atmospheric plasma deposition device inorganic oxide particles produced from a precursor in an atmospheric plasma as a coating on a surface of a lithium-ion electrochemical cell component.2. A method according to claim 1 , wherein the coating has a thickness of from about 10 nanometers to about 10 micrometers.3. A method according to claim 1 , wherein the coating has a thickness of from about 70 nanometers to about 800 nanometers.4. A method according to claim 1 , wherein the coating covers from about 0.5% to 100% of the area of the surface.5. A method according to claim 1 , wherein the metal oxide is an oxide of a member selected from the group consisting of silicon claim 1 , titanium claim 1 , zirconium claim 1 , aluminum claim 1 , cerium claim 1 , and combinations thereof.6. A method according to claim 1 , wherein the coating forms a repeating pattern on the surface.7. A method according to claim 1 , wherein the lithium-ion electrochemical cell component is a porous separator and the coating provides dimensional stability.8. A method according to claim 7 , wherein the coating does not appreciably reduce porosity of the porous separator.9. A method according to claim 1 , wherein the lithium-ion electrochemical cell component is a current collector or an electrode-coated current collector component; and wherein the coating increases electrical insulation.10. A method according to claim 9 , wherein the coating insulates at least up to about 5 volts.11. A lithium ion cell prepared by the method ...

DISPLAY UNIT, DISPLAY PANEL, DISPLAY DEVICE AND OPTICAL INFORMATION STORAGE DEVICE

Disclosed are a display unit, a display panel, a display device and an optical information storage device. The display unit comprises a photochromic thin film and an optical filter thin film on a side of the photochromic thin film. The photochromic thin film presents a colored state under an irradiation of a first preset light, and presents a transparent state under an irradiation of a second preset light. A wavelength range of the first preset light is different from that of the second preset light. The optical filter thin film is a one-way optical filter thin film that is substantially transparent to lights coming from a photochromic thin film side, and functions as an optical filter to lights coming from a side opposite the photochromic side to allow the first preset light to pass through and to reflect lights of other wavelengths. 1. A display unit comprising:a photochromic thin film; andan optical filter thin film on a side of the photochromic thin film,wherein:the photochromic thin film presents a colored state under an irradiation of a first preset light, and presents a transparent state under an irradiation of a second preset light, a wavelength range of the first preset light being different from a wavelength range of the second preset light; andthe optical filter thin film is a one-way optical filter thin film that is substantially transparent to lights coming from a photochromic thin film side, and functions as an optical filter to lights coming from a side opposite the photochromic thin film side to allow the first preset light to be transmitted through and to reflect lights of other wavelengths.2. The display unit according to claim 1 , wherein the photochromic thin film comprises a reversible photochromic material.3. The display unit according to claim 2 , wherein the reversible photochromic material includes spirooxazines or spiropyrans or a mixture thereof claim 2 , and wherein the first preset light is ultraviolet light and the second preset light ...

RADIO FREQUENCY FILTER SYSTEM FOR A PROCESSING CHAMBER

A radio frequency (RF) filter system for a substrate processing chamber comprises a first RF filter coupled to a first element of the processing chamber and a second RF filter coupled to the first element of the processing chamber. Each of the RF filters comprises a first filter stage configured to reject a first frequency, a second filter stage coupled to the first filter stage and configured to reject a second frequency, and a third filter stage coupled to the second filter stage and configured to reject the first frequency. Further, the first filter stage comprises a first inductor and a first capacitance, the second filter stage comprises a second inductor and a second capacitance, the third filter stage comprises a third inductor and a third capacitance. 1. A radio frequency (RF) filter system for a substrate processing chamber , the RF filter system comprising: a first filter stage configured to reject a first frequency, the first filter stage comprising a first inductor and a first capacitance;', 'a second filter stage coupled to the first filter stage and configured to reject a second frequency, the second filter stage comprising a second inductor and a second capacitance; and', 'a third filter stage coupled to the second filter stage and configured to reject the first frequency, the third filter stage comprising a third inductor and a third capacitance; and, 'a first RF filter configured to be coupled to a first element of the processing chamber, the first RF filter comprising a fourth filter stage configured to reject the first frequency, the fourth filter stage comprising a fourth inductor and a fourth capacitance;', 'a fifth filter stage coupled the fourth filter stage and configured to reject the second frequency, the fifth filter stage comprising a fifth inductor and a fifth capacitance; and', 'a sixth filter stage coupled to the fifth filter stage and configured to reject the first frequency, the sixth filter stage comprising a sixth inductor and a ...

FLEXIBLE DISPLAY PANEL, PRODUCTION METHOD THEREOF AND DISPLAY APPARATUS

This disclosure provides a flexible display panel and a production method thereof, as well as a display apparatus. The flexible display panel comprises: a flexible substrate; an inorganic film layer formed on the flexible substrate, comprising an encapsulating area and a non-encapsulating area, wherein a plurality of micropores are distributed on the inorganic film layer in the non-encapsulating area, and the micropores have a depth greater than or equal to a thickness of the inorganic film layer in the non-encapsulating area. 1. A flexible display panel comprising:a flexible substrate;an inorganic film layer formed on the flexible substrate, and comprising an encapsulating area and a non-encapsulating area,wherein a plurality of micropores are distributed on the inorganic film layer in the non-encapsulating area, and wherein the micropores have a depth greater than or equal to a thickness of the inorganic film layer in the non-encapsulating area.2. The flexible display panel according to claim 1 , wherein a difference between the depth of the micropores and the thickness of the inorganic film layer in the non-encapsulating area is less than or equal to 1 μm.3. The flexible display panel according to claim 1 , wherein the micropores have a diameter of 1 μm-3 μm.4. The flexible display panel according to claim 1 , wherein a distance between any two adjacent micropores is 1 μm-5 μm.5. The flexible display panel according to claim 1 , wherein the micropores have a shape of any one of a circle claim 1 , a triangle claim 1 , a quadrangle claim 1 , a pentagon claim 1 , a hexagon claim 1 , and a pentagram.6. The flexible display panel according to claim 1 , wherein a distribution pattern of the micropores in the non-encapsulating area is any one of a circle claim 1 , a triangle claim 1 , a quadrangle claim 1 , a pentagon claim 1 , and a hexagon.7. The flexible display panel according to claim 1 , wherein the flexible substrate comprises a polyimide substrate.8. A ...

NOVEL INSECTICIDAL PROTEINS FROM PLANTS

Compositions and methods for controlling pests are provided. The methods involve transforming organisms with a nucleic acid sequence encoding an insecticidal protein. In particular, the nucleic acid sequences are useful for preparing plants and microorganisms that possess insecticidal activity. Thus, transformed bacteria, plants, plant cells, plant tissues and seeds are provided. Compositions are insecticidal nucleic acids and proteins of bacterial species. The sequences find use in the construction of expression vectors for subsequent transformation into organisms of interest including plants, as probes for the isolation of other homologous (or partially homologous) genes. The pesticidal proteins find use in controlling, inhibiting growth or killing Lepidopteran, Coleopteran, Dipteran, fungal, Hemipteran and nematode pest populations and for producing compositions with insecticidal activity. 1. An recombinant PtIP-50 polypeptide , wherein the amino acid sequence of the PtIP-50 polypeptide has at least 40% sequence identity , across the entire length of the amino acid2. The recombinant PtIP-50 polypeptide of claim 1 , wherein the amino acid sequence of the PtIP-50 polypeptide has at least 80% sequence identity claim 1 , across the entire length of the amino acid sequence claim 1 , compared to the amino acid sequence of SEQ ID NO: 71.3. The recombinant PtIP-50 polypeptide of claim 1 , wherein the amino acid sequence of the PtIP-50 polypeptide has at least 75% sequence identity claim 1 , across the entire length of the amino acid sequence claim 1 , compared to any on of the amino acid sequences of SEQ ID NO: 71 claim 1 , SEQ ID NO: 77 claim 1 , SEQ ID NO: 84 claim 1 , SEQ ID NO: 78 claim 1 , or SEQ ID NO: 96.4. The recombinant PtIP-50 polypeptide of claim 1 , wherein the amino acid sequence of the PtIP-50 polypeptide has at least 70% sequence identity claim 1 , across the entire length of the amino acid sequence claim 1 , compared to any one the amino acid sequences ...

Display panel and display device

A display panel and a display device are provided. The display panel includes a display assembly, a transparent cover plate, and a fingerprint recognition module situated between the display assembly and the transparent cover plate. An optical film is arranged at a side of the fingerprint recognition module away from the display assembly. The optical film is configured to indicate a fingerprint recognition region on the display panel. A color of the optical film varies as an observation angle changes.

MULTISTAGE SET PROCEDURE FOR PHASE CHANGE MEMORY

Phase change material can be set with a multistage set process. Set control logic can heat a phase change semiconductor material (PM) to a first temperature for a first period of time. The first temperature is configured to promote nucleation of a crystalline state of the PM. The control logic can increase the temperature to a second temperature for a second period of time. The second temperature is configured to promote crystal growth within the PM. The nucleation and growth of the crystal set the PM to the crystalline state. The multistage ramping up of the temperature can improve the efficiency of the set process relative to traditional approaches. 120-. (canceled)21. A circuit to set a chalcogenide material , comprising:a source to provide energy to heat a phase change chalcogenide material (PM); anda control circuit to control the energy output of the source, including to apply an initial energy pulse to amorphize the PM, reduce energy intensity from the initial energy pulse to a nucleation level of intensity, and increase from the nucleation level of intensity to a crystal growth level of intensity higher than the nucleation level of intensity and lower than the initial energy pulse.22. The circuit of claim 21 , wherein the source comprises a current source claim 21 , and wherein the control circuit comprises a circuit coupled to the PM to control an amount of current passing through the PM.23. The circuit of claim 21 , wherein the source comprises a laser light source claim 21 , and wherein the control circuit comprises a circuit to control an intensity of laser light directed to the PM.24. The circuit of claim 21 , wherein nucleation level includes a first nucleation level and a second nucleation level higher than the first nucleation level claim 21 , wherein the control circuit is to apply the first nucleation level of intensity for a first sub-period of time and apply the second nucleation level of intensity for a second sub-period of time.25. The circuit ...

CUTTING METHOD OF FLEXIBLE DISPLAY PANEL, CONTROLLING DEVICE IN THE CUTTING METHOD, AND CUTTING APPARATUS OF FLEXIBLE DISPLAY PANEL

Disclosed are a cutting method of flexible display panel, a controlling device in the cutting method and a cutting apparatus of flexible display panel. The cutting method comprises steps of placing a transparent substrate () carried with a flexible film layer () on a base (); cutting only the transparent substrate () by means of a cutting tool (); obtaining a cutting trace of the cutting tool (); and controlling a laser knife () to cut the flexible film layer () carried on the transparent substrate () along the cutting trace of the cutting tool cutting the transparent substrate. In this way, by controlling the laser knife () to cut the flexible film layer () disposed on the transparent substrate () following the cutting trace of the cutting tool () cutting the transparent substrate (), the flexible film layer () can be completely cut at the same time when or after the transparent substrate () is completely cut, so as to avoid rough selvedges during cutting the flexible film layer (), thereby improving the cutting effect of cutting the flexible display panel; besides, in case that the cutting tool () and the laser knife () operate in parallel cutting mode, it can also improve the cutting efficiency. 1. A cutting method of flexible display panel , comprising steps of:placing a transparent substrate carried with a flexible film layer on a base;cutting only the transparent substrate by means of a cutting tool;obtaining a cutting trace of the cutting tool; andcontrolling a laser knife to cut the flexible film layer carried on the transparent substrate along the cutting trace of the cutting tool.2. The cutting method of flexible display panel of claim 1 , wherein the step of placing a transparent substrate carried with a flexible film layer on a base comprises:allowing one side of the transparent substrate carrying the flexible film layer to face towards the base while allowing the other side of the transparent substrate to face away from the base.3. The cutting method of ...