Composite fertilizer containing magnesium ammonium phosphate and polyglutamic acid

Disclosed is a composite fertilizer containing magnesium ammonium phosphate and polyglutamic acid. The weight ratio of the polyglutamic acid to the magnesium ammonium phosphate is 1:100-10000, preferably 1:200-8000. An experimental result indicates that the composite fertilizer of the present invention can well regulate the growth of crops, improve the disease resistance and stress tolerance, promote the healthy effect of the crops, and increase the yield of the crops.

Preparation method and application of antibacterial active substances of Bacillus pumilus

Abstract Disclosed relates to a preparation method and application of antibacterial active substances of Bacillus pumilus. A Bacillus pumilus BP strain was collected in the China General Microbiological Culture Collection Center on March 21, 2019, Address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing; Collection Number: CGMCC No.17424. Disclosed also relates to antibacterial active substances prepared by using the strain and relevant application. Three antibacterial active fatty alcohol compounds are first extracted from Bacillus pumilus, but are not found in the existing Bacillus pumilus.

Cyclohexyl acid triazole azines as LPA antagonists

The present invention provides compounds of Formula (I): Formula (I) or a stereoisomer, tautomer, or pharmaceutically acceptable salt or solvate thereof, wherein all the variables are as defined herein. These compounds are selective LPA receptor inhibitors.

Device for cage jamming buffer of large-tonnage hoisting system of ultra-deep shaft

A device for cage jamming buffer of large-tonnage hoisting system of ultra-deep shaft is provided. End cage jamming buffer devices are added at both ends of an automatic wire rope tension balancing mechanism, wherein the end cage jamming buffer mechanisms comprise an end buffer module and an end fixing module, and the end buffer module and the end fixing module are respectively mounted on shafts of the automatic wire rope tension balancing mechanisms at two ends. The end buffer module mainly consists of a buffer bearing pedestal, a limit block, a buffer block, and a stop block sequentially mounted on the shaft of the automatic wire rope tension balancing mechanism at one end. The end fixing module mainly consists of a fixing bearing pedestal and a fixing block mounted on the shaft, wherein the fixing bearing pedestal is connected to a transmission gear by means of an adjusting bolt, and the fixing block is located between the transmission gear and the fixing bearing pedestal. Before rotation ...

Pyridone GPR119 G protein-coupled receptor agonists

Fluoropolymer compositions and treated substrates

A polymer having at least one urea linkage prepared by: (i) reacting (a) at least one diisocyanate, polyisocyanate, or mixture thereof, having isocyanate groups, and (b) at least one fluorinated compound selected from the formula (I): R ...

A WIND ENERGY ENGINE AND WIND ENERGY POWER SYSTEM & WINDENERGY POWER GENERATION SYSTEM RELATES TO THE TECHNICAL AND EQUIPMENT FIELDOF UTILIZING WIND ENERGY TO GENERATE AND OUTPUT POWER AND ELECTRIC ENERGY

A wind energy power machine includes several groups of frameworks (2) eve nly set around a center revolving body (1), every framework has at least a s et of power generating part (3), a shape frame of the power generating part has a turnover and return assistant mean (3g) for controlling the turnover s peed, every framework has a brake (8) and an opening degree adjusting mean ( 7), the brake can release or limit the turnover of the power generating part by a distributor (21) controlling open and close of circuit. The wind energ y power machine can keep a generating system running stably at various wind speed and improve efficiency.

ATTENUATED YELLOW FEVER VIRUS AND USES THEREOF FOR THE TREATMENT OF CANCER

The present invention is the use of designed recombinant viruses for the treatment of various forms of malignant tumors using attenuated Yellow Fever virus. The method of the present invention is particularly useful for the treatment of malignant tumors in various organs, such as: breast, skin, colon, bronchial passage, epithelial lining of the gastrointestinal, upper respiratory and genito-urinary tracts, liver, prostate and the brain. Astounding remissions in experimental animals have been demonstrated for the treatment of treatment of breast cancer and melanoma.

THIAZOLINE AND OXAZOLINE DERIVATIVES AND THEIR METHODS OF USE

The invention relates to compounds of formula I selected from compounds. The compounds of formula (I) in treating conditions and disorders that are r egulated by the nicotinic acetylcholine receptors.

AMINOCHROMANE, AMINOTHIOCHROMANE AND AMINO-1,2,3,4-TETRAHYDROQUINOLINE DERIVATIVES, PHARMACEUTICAL COMPOSITIONS CONTAINING THEM, AND THEIR USE IN THERAPY

The present invention relates to aminochromane, aminothiochromane and amino-1,2,3,4- tetrahydroquinoline derivatives of the formula (I) or a physiologically tolerated salt thereof. The invention relates to pharmaceutical compositions comprising such aminochromane, aminothio-chromane and amino-1,2,3,4-tetrahydroquinoline derivatives, and the use of such aminochromane, aminothiochromane and amino-1,2,3,4-tetrahydroquinoline derivatives for therapeutic purposes. The aminochromane, aminothiochromane and amino-1,2,3,4-tetrahydroquinoline derivatives are GlyT1 inhibitors.

P-40/ANNEXIN I AND RELATED PROTEINS AND THEIR ROLE IN MULTIDRUG RESISTANCE

The present invention relates in general to multidrug resistance (MDR) in cells. In particular, the present invention relates to the identification of a new member of the MDR gene family, P-40, as well as to the identification of P40 related genes (homologs) as being additional members of the MDR gene family. The present invention therefore relates to nucleic acid molecules encoding P-40 protein and P-40 protein homologs, to multidrug resistant cells containing these nucleic acid molecules; to hybridomas containing antibodies to P-40 and P-40 homologs; to nucleic acid probes for the detection of these nucleic acid molecules; to a method of detection of such nucleic acid molecules or of the P-40 protein or P-40 homologs, to bioassays comprising the nucleic acid molecules encoding P-40 or P-40 homologs, P-40 protein or P-40 protein homologs, or antibodies of the present invention to diagnose, assess or prognose MDR in an animal; to therapeutic uses of the nucleic acid molecules of the present ...

Multifunctional high-precision temperature adjusting system

The invention discloses a temperature collection, control and processing system. The system mainly comprises parts for temperature collection, temperature display, system control, serial port communication, etc. The system collects the ambient temperature in real time, then inputs temperature information into a control chip for processing, and displays the ambient temperature information on an interaction interface. Meanwhile, the system allows setting an upper temperature limit and a lower temperature limit. And through a lower computer, the system sets temperature limits for different environments to improve the adaptability and widen the application range of a word system. Using a single-line digital temperature sensor DS18B20 for real-time ambient temperature collection and a high-performance 8-bit single-chip microcomputer MCS-51 as a control chip, the system achieves temperature processing and control, displays the temperature information via a nixie tube, and at the same time transmits ...

Pigeon milk substitute as well as preparation method and feeding method thereof

The invention discloses pigeon feed, and in particular discloses a pigeon milk substitute as well as a preparation method and feeding method thereof, belonging to the technical field of special animal feeds. The pigeon milk substitute comprises the following components in percentage by mass: 30%-40% of skimmed milk powder, 5%-8% of glucose, 15%-20% of peanut oil, 25%-30% of rice protein powder, 2%-3% of calcium powder, 1%-2% of calcium hydrogen phosphate, 2%-2.5% of sodium chloride, 2%-2.5% of glutamine, 2.5%-3.0% of an emulsifier, 0.5%-0.8% of a yeast extract and 1% of a compound premix. The pigeon milk substitute disclosed by the invention, by combining various trace elements and vitamins, is more scientific and more comprehensive compared to independent use of one or more trace elements or vitamins; complete feed is prepared by combining various components, which is beneficial to popularization and use of the substitute; the pigeon milk substitute can meet nutrient substances required ...

1,5-dehydrated sorbitol immunodetection kit as well as preparation and detection methods thereof

The invention relates to the field of 1,5-dehydrated sorbitol detection and in particular relates to a 1,5-dehydrated sorbitol immunodetection kit as well as preparation and detection methods thereof. The kit comprises an anti-1,5-dehydrated sorbitol specificity antibody, and an indication reagent used for detecting an anti-1,5-dehydrated sorbitol specificity antibody and 1,5-dehydrated sorbitol compound, wherein the anti-1,5-dehydrated sorbitol specificity antibody is obtained from a 1,5-dehydrated sorbitol immunogen-immunized animal. The kit has the benefits as follows: 1,5-dehydrated sorbitol immunogen is high in immunogenicity, and the prepared anti-1,5-dehydrated sorbitol specificity antibody is strong in specificity and high in titer; a homogeneous enzyme immunodetection reagent containing the anti-1,5-dehydrated sorbitol specificity antibody can be used for conveniently, quickly and accurately determining the content of 1,5-dehydrated sorbitol and measuring a plurality of samples ...

Three-node GaAs solar cell with surface roughening structure and preparation method thereof

The invention relates to the technical field of preparation of multi-node solar cells, in particular to a three-node GaAs solar cell with a surface roughening structure and a preparation method thereof. An AlGaInP roughening layer between main electrodes is roughened, and an antireflection film is manufactured on the surface of the roughened AlGaInP roughening layer. The cell of an inverted structure is adopted, the open-circuit voltage of the solar cell is improved, the efficiency of the cell can reach 31.5-32 percent, a roughening graph is manufactured on an illuminated face of the cell, and the whole structure is made to be a current vertical structure through a conductive Si substrate and the electrode, can be directly applied to the current mature packaging technology on the basis of keeping vertical conduction, and is suitable for assemblies of different shapes. The three-node GaAs solar cell with the surface roughening structure and the preparation method thereof improve the short-circuit ...

Beating-up method and beating-up mechanism of non-circular gear planetary gear system

The invention discloses a beating-up method and a beating-up mechanism of a non-circular gear planetary gear system. A non-circular gear planetary system mechanism is adopted to convert the uniform rotation of a weaving machine spindle into the non-uniform intermittent swinging of a sley. A planet carrier is driven by the weaving machine spindle, and a driving sun gear is movably sleeved on the weaving machine spindle, wherein the driving sun gear is immovable. A planet shaft is driven by the planet carrier, and two non-circular gears are fixedly connected to the planet shaft, wherein one non-circular gear is engaged with the driving sun gear, while the other non-circular gear is engaged with a driven sun gear; the driven sun gear is fixedly connected to an output shaft, i.e. a rocking shaft; and the beating-up sley is fixedly connected to the rocking shaft. Through establishing a two-stage non-circular gear driving mathematical model, a non-circular gear pitch curve is designed according ...

Energy detection device for photoetching machine

The invention discloses an energy detection device for a photoetching machine, which is characterized by comprising a reflector, an integral rod, a detector, a detector signal processing circuit, a signal acquisition card and a computer sequentially along the light advancing direction, wherein the integral rod is located on the focal plane of the reflector; the output end of the detector is connected with a current signal input end of the detector signal processing circuit; and the output end of the detector signal processing circuit is connected with the input end of the computer via the signal acquisition card. The reflector is adopted to bend a light path, thereby reducing the entire height of the photoetching machine; the detector signal processing circuit can perform amplification, integration and keeping on narrow pulse signals, thereby reducing demands of a subsequent signal acquisition circuit and effectively eliminating influences of aperture jitter on a measurement result during ...

Method and device for managing Femtocell

The invention discloses a method and a device for managing an Femtocell. The method comprises the following steps: judging the type of a received message, and sending the message to a corresponding module; de-encapsulating and filtering the received RUA message; judging whether the RUA message belongs to the information needed by webmaster statistics according to the type of the RANAP message; if yes, copying and bypassing the RUA message; if not, directly bypassing the RUA message; classifying the contents of the RANAP message, carrying out statistics by utilizing the classified contents of the message; obtaining statistics data according to the contents of a received HNBAP message; comparing a statistics result with a predicted value to obtain a difference, and carrying out judging and reporting; reporting in an alarming manner if the difference is larger than a preset threshold value; and reporting in a common data reporting manner if the difference is no larger than the preset threshold ...

Double-mode planet series-parallel connecting system and control system thereof

The invention relates to the field of a hybrid power vehicle, in particular to a double-mode planet series-parallel connecting system and a control system thereof. The double-mode planet series-parallel connecting system is characterized in that a torque sensor is connected between an output shaft of an engine and a planet row system in series, the torque sensor is connected with a whole vehicle controller, accurate torque Eng_Trq actually output by the engine can be obtained through the feedback of the torque sensor, and closed loop PI correction on the torque control of the engine is realized, i.e. (1) the situation that the torque output of the engine is enlarged when the torque is smaller than a target torque is realized; (2) the situation that when an actual torque is greater than the target torque, the engine stops outputting a target command, and a load of the engine is in reverse drawing is realized. When the double-mode planet series-parallel connecting system disclosed by the ...

Preparation method for ternary positive electrode material of graphene composite lithium ion battery

The invention particularly relates to a preparation method for a ternary positive electrode material of a graphene composite lithium ion battery. The preparation method comprises the following steps of firstly preparing a ternary positive electrode material precursor by a crystallization control-coprecipitation method; performing multi-step sintering to prepare the ternary positive electrode material, wherein the mole ratio of nickel to manganese to cobalt (namely x to y to z) is equal to (0.30-0.90) to (0.50-0.80) to (0.05-0.50), and x+y+z=1; and finally preparing the ternary positive electrode material of the graphene composite lithium ion battery. According to the preparation method disclosed by the invention, the problem that graphene is difficult to disperse in the ternary positive electrode material is solved, the internal polarization resistance is greatly reduced, and high-current rate discharge is realized; furthermore, high discharge capacity and long cycle life are kept. The ...

Newton-process power flow calculation method for study purpose

The invention discloses a Newton-process power flow calculation method for study purpose and provides a Newton-process power flow calculation method which is easy to correct and maintain for research personnel conducting further researches on the basis of Newton-process power flow calculation. Adopting the basic principle steps of a polar coordinate Newton method, the invention provides a method for improving the speed of power flow calculation by avoiding unnecessary calculation through simple logic judgment on the basis of the analysis of the components of the power flow calculation. In thetechnical scheme of the invention, unnecessary calculation is avoided by making simple judgment in a Jacobimatrix forming module and a correction equation Gaussian elimination module. When the methodis used for performing calculation on a 445 node actual large-size grid, the calculation time is 0.484s, and the calculation speed can meet requirements for scientific research completely.

High-efficiency protection liquid for storage of microcapsule leaven

The invention relates to a formula of high-efficiency protection liquid for the storage of a microcapsule leaven, which belongs to the technical field of biological engineering. The protection liquid is prepared from the following components in the optimum formula ratio: 0.9% of sodium chloride, 3% of glucose, 5% of cane sugar, 10% of glycerol, 0.2% of calcium carbonate and the like. The invention can solve the storage problem of the microcapsule leaven and effectively prolongs the service life of the leaven.

Method for treating potassium feldspar according to sub-molten salt method to prepare potassium carbonate

The invention discloses a method for treating potassium feldspar according to the sub-molten salt method to prepare potassium carbonate. The method comprises the following steps: potassium feldspar reacts in a sub-molten salt NaOH liquid-phase medium, wherein the mass ratio of the NaOH solution to potassium feldspar power is (4:1) to (6:1); acidizing is carried out after reaction, so as to obtain a mother liquid containing potassium; purified sodium carbonate and potassium carbonate products are obtained after acidizing, filtering, and evaporative crystallization are conducted on the mother liquid. The reaction temperature is 145 to 210 DEG C; the potassium dissolution rate is higher than 98 percent. The method for extracting soluble potassium from potassium feldspar has the advantages that the defects in the conventional process are overcome; potassium, aluminum and silicon in potassium feldspar are comprehensively utilized; the energy consumption is low; the process is simple; environmental ...

Method and device for controlling information display

The invention discloses a method and device for controlling information display. The method and the device are used for reducing the display of repeated information. The method comprises the following steps: obtaining plugins related to displayed information in a current interface; detecting whether pre-set target plugins exist in the obtained plugins or not; when the pre-set target plugins exist in the obtained plugins, hiding information the same as the target plugins in an operating system. The method and the device provided by the embodiment of the invention can hide repeated information and reduce the interference of redundant information to users.

coronary disease testing method and reagent kit

The invention discloses a method for detecting atherosclerosis and/or coronary heart disease susceptibility, which includes detecting whether variation exists in individual platelet derived growth factor receptor Alpha peptide (PDGFRA), transcript and/or albumen in comparison with normal. The existence of variation shows that the possibility that an individual contracts atherosclerosis and/or coronary heart disease is higher than that of a normal person. The invention also discloses a corresponding detection kit.

Single chip microcomputer control method of brushless direct-current torque motor

Provided is a single chip microcomputer control method of a brushless direct-current torque motor. Three photoelectric devices VP1, VP2 and VP3 are installed at an interval of 120 degrees and are uniformly distributed at one end of the motor. By means of the role of a rotary shading plate installed on a motor shaft, light emitted from a light source is irradiated on the optoelectronic devices in sequence, and the positions of poles of a rotor are judged according to whether one optoelectronic device is irradiated by light or not. As the photoelectric device VP1 is irradiated by light at the moment, a power transistor V1 is switched on, current flows into a winding A-A', and the torque generated after the winding interacts with the poles of the rotor drives the poles of the rotor to rotate. The rotary shading plate directly installed on the rotor synchronously rotates, shades VP1 and enables VP2 to be irradiated by light so that the transistor V1 is switched off, a transistor V2 is switched ...

Method, system and device for improving system security

The invention discloses a method for improving system security, which comprises the following steps of: judging whether the security capability information of a UE is juggled or not by an MME according to the security capability information of the UE sent by a target eNB; if the MME judges that the security capability information of the UE is juggled, then notifying the target eNB to release the UE contextual information stored in the target eNB by the MME. The invention solves the problem that the MME notifies the target eNB when the security capability information of the UE is juggled in the switching process, so that the target eNB can release the UE context after finding an unsafe phenomenon, thereby avoiding the target eNB from being attacked and saving target eNB resources.

Anti-explosion tank

The invention relates to an anti-explosion tank which belongs to the field of anti-explosion equipment. A high polymer energy-absorbing material is adopted as a buffer layer in the invention, and a fire-extinguishing liner is configured on the inner wall of an inner barrel, thereby not only the weight of a tank body can be lightened, but also high temperature and flames generated by explosion canbe effectively inhabited, thereby solving the defects of heavy tank body, maneuverability lack and the like existing in a traditional anti-explosion tank and the problems of difficult inhabitation ofhigh temperature and flames generated by explosion. The anti-explosion tank comprises a top cover, a seal ring, the fire-extinguishing liner, the inner barrel, the buffer layer, an outer barrel, a foaming material layer, a shell and a truckle, wherein the inner barrel, the outer barrel and the buffer layer form three layers of protection, thereby the protecting capability is improved, and the personnel ...

Amplitude modulation design method of hyperstatic prestressed concrete structure bending-moment redistribution

The invention provides an amplitude modulation design method of hyperstatic prestressed concrete structure bending-moment redistribution, relating to an amplitude modulation design method of concrete structure bending-moment redistribution. The problem of not high accuracy of calculation results caused by unclear amplitude modulation objects and the problem of lower calculation efficiency, of an existing design method are solved. The method comprises the following steps of determining a tension-caused bending moment Mp at the support control section, a main bending moment MF of a structure, a tension-caused secondary bending moment Msec and an externally-applied-load bending moment design value Mload through calculation; calculating to determine the ultimate curvature phiu, the yielding curvature phiy, the plasticity corner thetap and the plasticity bending-moment design value of the control section of a prestressed concrete flexural member; obtaining a bending moment amplitude modulation ...

Anthropomorphic dummy anti-explosion evaluation device provided with sensors

The invention discloses an anthropomorphic dummy anti-explosion evaluation device provided with sensors. The device comprises an anthropomorphic dummy; the body of the anthropomorphic dummy is provided with police protection equipment; the sensors are respectively arranged at the head, the ears, the neck, the knees, the waist and the feet of the anthropomorphic dummy; the sensors are connected with a data acquisition module through data lines; after being processed through a data processing module, data acquired by the data acquisition module is transmitted to a data evaluation module; the exterior of the anthropomorphic dummy is provided with free field testing jigs; the free field testing jigs are respectively provided with a free field pressure sensor; the exterior of the anthropomorphic dummy is also provided with cameras; the cameras are connected with the data evaluation module through an image processing module. According to the device, the anthropomorphic dummy can be applied to ...

Pneumatic blockage-preventing and seed-leakage-free plug seedling and precision seed arrangement method and device

The invention discloses a pneumatic blockage-preventing and seed-leakage-free plug seedling and precision seed arrangement method and device. A piston block detection switch is adopted for detecting seed leakage and blockage of a suction nozzle in seed sucking unit parts of a precision seed arrangement device and controlling the movement of a multi-suction nozzle seed sucking system. Seed sucking unit parts on the multi-suction nozzle seed sucking system are arranged corresponding to positions of holes in a seedling plug, and each seed sucking unit part is provided with a piston block detection switch; a piston block is in a middle balance position when not working, and when a pneumatic force changes, a piston movement relative to an air chamber is generated, and thus a corresponding switching function is realized. When the suction nozzles do not suck seeds, the pressure in the suction nozzles is a smaller negative pressure, the piston block does not move, and a leak-suction-preventing ...

Flupirtine maleate capsule composition and preparation method thereof

The invention provides a flupirtine maleate capsule composition. The flupirtine maleate capsule composition contains flupirtine maleate and a solubilizer. The solubilizer is copovidone S630. The invention also provides a flupirtine maleate capsule preparation method having simple processes and quality controllability. a flupirtine maleate raw material and calcium hydrophosphate are mixed and sieved by a sieve of 60 meshes so that raw material and auxiliary material uniform mixing is guaranteed, a yield is improved and a production cost is reduced. The preparation method utilizes a dry granulation technology so that granule bulk density is large, and compared with the existing granules having small bulk density, the same weight of the granules obtained by the preparation method can be put into a small-volume capsule. The products obtained by the preparation method and the formula have qualified quality and stable drug effects and are conducive to large-scale production realization.

Duffing oscillator weak signal time domain detection method based on phase-locked loop

The invention relates to a weak periodic signal detecting method based on a phase-locked loop and a Duffing oscillator, and belongs to the field of signal processing. According to the method, the phase-locked loop and the Duffing oscillator are used for setting up a combined weak signal detecting system; signal frequency is detected through the phase-locked loop to detect weak periodic signals with unknown frequency; according to the curve characters of a time history of chaotic signals, and a sequence diagram method and a phase plane diagram method are matched to serve as the criterion for detecting a system state and detecting whether the system state changes or not; a precise threshold value at which the system jumps into a periodic state from a chaotic state is obtained, and the threshold and quality for detecting the weak periodic signal are improved. Compared with a traditional method, the weak periodic signal detecting method can detect the signals with the unknown frequency, is ...

Cold extrusion forming mold of aluminum shell of power battery and forming method thereof

The invention discloses a cold extrusion forming mold of an aluminum shell of a power battery. The mold is divided into an upper mold part and a lower mold part, wherein the upper mold part comprises an upper mold punch bar, an upper mold base, a cushion block, a clamping sleeve, a clamping nut and a fixed bolt; and the lower mold part comprises a lower mold, a margin, a concave mold base, a concave mold nut, a plurality of clamping blocks and a plurality of bolts. The invention further discloses a cold extrusion forming method of the aluminum shell of the power battery; light zinc stearate powder is mixed and coated on an aluminum blank; and a horizontal multi-link elbow rod type cold extrusion press is used for performing the once cold extrusion for the aluminum blank coated by the light zinc stearate powder to form the aluminum shell of the power battery. The horizontal multi-link elbow rod type cold extrusion press is used for performing the once cold extrusion for the aluminum blank ...

Triazole Cu-boric acid complex with potential ferroelectric function and preparation method thereof

The invention provides a triazole Cu-boric acid complex with a potential ferroelectric function and a preparation method thereof. The invention discloses a preparation method of {[Cu(L)](BF4)2.0.5H2O}(1)(L=4-(3-(4H-1,2,4-triazole-4-yl)phenyl)-4H-1,2,4-triazole) and an potential application value of the complex as a ferroelectric material. The complex is prepared by a hydrothermal method, namely reactions between Cu(BF4)2 and L at a temperature of 100 DEG C under hydrothermal conditions. The invention further discloses applications of {[Cu(L)](BF4)2.0.5H2O}(1)(L=4-(3-(4H-1,2,4-triazole-4-yl)phenyl)-4H-1,2,4-triazole) as a potential ferroelectric material.

Pipeline steel with good and stable low-temperature flexibility and method for rolling hot rolled coils thereof

The invention discloses pipeline steel with good and stable low-temperature flexibility and a method for rolling hot rolled coils thereof. The pipeline steel comprises the following compositions in percentage by weight: 0.03 to 0.070 percent of carbon, 0.19 to 0.30 percent of silicon, 1.50 to 1.90 percent of manganese, 0.010 to 0.020 percent of titanium, 0.015 to 0.040 percent of aluminum, less than or equal to 0.30 percent of nickel, less than or equal to 0.02 percent of chromium, less than or equal to 0.0002 percent of boron, less than or equal to 0.018 percent of phosphorus, less than or equal to 0.005 percent of sulfur, 0.002 to 0.003 percent of calcium, 0.20 to 0.40 percent of molybdenum, less than or equal to 0.30 percent of copper, 0.02 to 0.10 percent of niobium, less than or equal to 0.006 percent of nitrogen, less than or equal to 0.004 percent of oxygen, less than or equal to 0.00025 percent of hydrogen, and the balance of iron and impurities. The manufactured pipeline steel ...

Cell switching control method, device and communication system

The embodiment of the invention discloses a cell switching control method, which comprises the following steps: after receiving a measurement report, determining a plurality of preparation cells; sending a switching request message to a base station eNB of each preparation cell, wherein when a plurality of cells of one eNB belong to the preparation cells, the switching request message carrying information for indicating corresponding preparation cells is sent to the eNB; receiving response information of each eNB; and selecting a switching target cell, and indicating UE to perform cell switching. The embodiment of the invention also discloses a device for implementing the method and a communication system. The embodiment of the invention provides a signaling transmission system and methodin the process of preparing the switching of the plurality of preparation cells, ensures the normal cell switching process under the condition that the plurality of preparation cells belong to one eNB, ...

Method for measuring weight of airplane

The invention discloses a method for measuring the weight of an airplane. In the method, aiming at the characteristic that the measured value of an oil volume sensor has high real-time property as well as a big transient error, while the theoretically estimated value of the oil volume has high stability as well as a big accumulated error, a principle of complementary advantages is adopted. The method comprises: firstly, filtering the acquired values of the oil volume sensor to obtain measured values of the oil volume, and further determining empty weight; and secondly estimating the oil volume according to the flight condition and oil consumption rate of the airplane, comprehensively comparing the measured value with an theoretically estimated value to obtain the weight of the airplane accurately for obtaining the corresponding flight speed of the airplane and ensuring the flight safety of the airplane.

Novel medical department of stomatology temporomandibular joint restorer

The utility model discloses a novel medical department of stomatology temporomandibular joint restorer, left side pincers handle and right forceps handle intercrossing connect, left side pincers handle and right forceps handle's one end is clamping portion, left side pincers handle and right forceps handle's the other end is for holding the portion, and the left side pincers handle and the right forceps handle that are close to the portion of holding locate to be equipped with the mounting, the inside location mouth that is equipped with of mounting, left side pincers handle and right forceps handle can be at side -to -side movements in the location mouthful, are close to to be equipped with to hold in the palm on the left side pincers handle of clamping portion and close the setting element, close the piece of coordinating near being equipped with the support on the right forceps handle of clamping portion, the support is closed and is equipped with a plurality of fixed orificess on the ...

Concrete mixer

The utility model discloses a concrete mixer, including feed cylinder, rabbling mechanism, water delivery mechanism, the feed cylinder top is equipped with the feed inlet, sets up transparent viewingwindow on the lateral wall, and the lateral wall lower extreme is equipped with the discharge gate, and the bottom is equipped with the support frame, the rabbling mechanism includes driving motor, (mixing) shaft, first agitator, second agitator, water delivery mechanism is connected with the water pipe including setting up a plurality of hole for water sprayings in feed cylinder lateral wall upper end on, be equipped with the water pump on the water pipe, and the storage water tank is connected to the water pump. The utility model discloses the stirring, it is convenient to wash, simple structure, convenient to use.

Multifunctional grip strength trainer

The utility model provides a multifunctional grip strength trainer which is characterized in that grip strength balls, elastic ribs and finger pieces are arranged on the palm surface of a glove, the grip strength balls are located in the center of the palm, and a pressure sensor, a wireless signal transmitter and a storage battery are arranged in each grip strength ball; a tension spring device is arranged on the back surface of the glove; an induction coil is arranged at the wrist part of the glove; a PCB control main board, a display screen, a wireless signal receiver, a counting sensor and a storage battery are arranged on the induction coil; the radial artery and coronary artery interventional therapy device is suitable for a patient to perform grip strength exercise, the grip strength exercise can effectively reduce the postoperative pain level of the patient who is about to perform radial artery and coronary artery interventional therapy, the limb swelling degree of the patient is ...

Novel oil and gas mixer

The invention provides a novel oil and gas mixer. The novel oil and gas mixer is composed of a gas circulating part, a cone part and an oil and gas mixing part, wherein the gas circulating part, the cone part and the oil and gas mixing part are arranged from right to left, the gas circulating part is in the shape of a cuboid, a main gas channel is formed in the middle of the gas circulating part, a plurality of branch gas channels are formed in one side face, and the branch gas channels are communicated with the main gas channel; a gas channel is formed in the middle of the cone part; the oil and gas mixing part is also in the shape of a cuboid, oil inlet channels are formed in the upper side of the oil and gas mixing part, the number of the oil inlet channels is identical to that of the branch gas channels in the gas circulating part, the positions of the oil inlet channels also correspond to those of the branch gas channels, an oil and gas outlet is formed in the other side of one side ...

Photoelectric encoder

The invention relates to a photoelectric encoder comprising an encoding disc, an inner code track and an outer code track are arranged on the encoding disc, one code track is a positioning code track, the other one is an encoding code track, wherein the positioning code track is formed by alternately arranging 2N uniformly distributed transparent and opaque sections with the same sizes, and N is a positive integer not less than 2; and the encoding code track is formed from 2N transparent and opaquesections with the same radians as those of the sections of the positioning code track, the logic value of the transparent sections is 1, the logic value of the opaque sections is 0, any neighboring N sections on the encoding code track form N-bit binary encoding, any two sets of encoding are different, and 2N sets of encodings are formed in total. The encoder can output the absolute position information of shaft rotation and has the advantages of convenient use, simple fabrication, high resolution ...

High -efficient water sampling bottle

The utility model relates to a high -efficient water sampling bottle, it belongs to environmental monitoring, environmental improvement and water sample collection technical field. It mainly includesthe bottle, bottle upper portion be last water inlet, outer wall be close to bottom department be equipped with delivery port, inside be equipped with down water inlet, outer wall upper portion and carry the rope in the middle of lid device, the bottom continuous, the lid device comprises showy lower cover, connecting rod, clean shot upper cover, the connecting rod top is connected with showy lower cover with clean shot cover connection, below, in the time of on showy lower cover drops on down the water inlet, the clean shot upper cover is just in time sealed with the bottleneck, be equipped with the rotary valve on the delivery port, the water inlet is circular down, it is greater than water inlet diameter down to float the lower cover length of side, the clean shot upper cover passes through ...

Experimental test bench for hydraulic coupler

The invention discloses a hydraulic coupler experiment test bench, which belongs to the technical field of oil and gas well engineering and mechanical engineering, and comprises a test bench base body, a speed regulating motor, a water inlet device, a supporting device, a water outlet device, a coupling, a torque rotating speed tester and a magnetic powder brake. The speed regulating motor is provided with a speed reducer; the water inlet device comprises a transmission shaft, a shell, a left end cover, a right end cover, a water inlet pipe, a water inlet union joint and a water inlet device support and transmits torque and water at the same time. The supporting device comprises a supporting roller, a telescopic arm, a telescopic cylinder and an adjusting bolt, and is used for adjusting the supporting height of the tested tool; the water outlet device transmits torque and discharges water at the same time; the magnetic powder brake simulates a test load. The hydraulic coupler experiment ...

Preparation method of copper-iron-magnesium hydrotalcite and application of copper-iron-magnesium hydrotalcite in low-temperature flue gas denitration

The invention aims to provide a preparation method of copper-iron-magnesium hydrotalcite and application of the copper-iron-magnesium hydrotalcite in low-temperature flue gas denitration, and belongs to the field of novel inorganic layered materials.The preparation method comprises the steps that a mixed salt solution of copper nitrate trihydrate, magnesium nitrate hexahydrate and ferric nitrate nonahydrate and a mixed solution of sodium hydroxide and sodium carbonate are prepared; slowly dripping the two solutions into a beaker at the same time, continuously stirring, controlling the titration speed to keep the pH constant, aging, carrying out suction filtration, washing and drying to obtain a copper-iron-magnesium hydrotalcite precursor; and roasting to obtain the copper-iron-magnesium composite metal oxide catalyst. The prepared catalyst shows good catalytic activity and high N2 selectivity when being used for low-temperature CO selective catalytic reduction of NOx after being tableted ...

Planing equipment for machining outer surface of clutch

The invention discloses planing equipment for machining the outer surface of a clutch, and relates to the technical field of fluid polishing, the planing equipment comprises a polishing groove, a supporting frame is fixedly connected to the polishing groove through bolts, adjusting cavities are formed in the upper ends of the inner walls of the four edges of the polishing groove, and the inner walls of the adjusting cavities are fixedly connected with one ends of first springs; adjusting blocks are fixedly connected to the other ends of the first springs, the adjusting blocks are slidably connected to the interior of the adjusting cavity, and positioning plates used for positioning the clutch shell are fixedly connected to the interiors, close to the polishing groove, of the adjusting blocks; when the positioning plate moves to the position matched with the size of the clutch shell, the clutch shell in the polishing process can be positioned and limited, the problem of deviation in the ...

Page display method, electronic equipment and computer program product

The invention provides a page display method, electronic equipment and a computer program product, and the page display method comprises the steps: setting a dynamic background corresponding to a function service area and entrance identifiers corresponding to all function service entrances in the function service area of a display page, according to the method, organic combination of the entry identifier and the dynamic background of the function service entry is realized, meanwhile, the entry identifier is displayed through the dynamic background or the dynamic background is displayed through the entry identifier in the function service area of the display page, and when a user is guided to know the function service entry through the identifier information, the dynamic background is displayed through the entry identifier. The visual effect of the function service area is improved through the dynamic background.

Wheat whole growth period culture method

The invention relates to the technical field of wheat cultivation and breeding, and particularly discloses a method for cultivating wheat in the whole growth period. Comprising the steps of germination acceleration, vernalization and water culture, the germination acceleration is performed in water, the vernalization is performed in a matrix, and the water culture is performed in a nutrient solution; the used light sources are all LED (light-emitting diode) light supplementing lamps, and the spectral band is 400-780 nm; wherein the illumination intensity of the germination accelerating and vernalization is 3000 to 4000 Lux; the illumination intensity of the water culture is 5,000 to 6,000 Lux. The cultivation method for the whole growth period of the wheat is short in growth period, and the wheat grains are full and high in yield; according to the method, pollutants can be accurately added in any growth stage of wheat while normal growth of the wheat is guaranteed, the influence of heavy ...

Missile-borne radar imaging self-focusing method and device

The invention relates to a missile-borne radar imaging self-focusing method and device, belongs to the field of image processing, and solves the problem that the focusing effect is reduced by the dynamic characteristics of multiple targets in an offshore interference scene, and the method comprises the steps: carrying out the azimuth superposition of echo data, and obtaining one-dimensional range profile echo data; based on the amplitude and the coordinates of the one-dimensional range profile echo data, carrying out difference on the coordinates corresponding to each wave crest in the one-dimensional range profile echo data to obtain a difference result; determining a target area corresponding to the observation target according to the difference result; wherein the target area is used for indicating a distance direction coordinate set; based on the target area, determining whether the observation target is of a non-rigid body structure; and performing local self-focusing on the echo data ...

Cross-scale feature extraction method for visual information

The invention provides a cross-scale feature extraction method for visual information. The cross-scale feature extraction method comprises the following steps: fusing feature maps of different levels to generate a first feature map, a second feature map and a third feature map; the first feature map, the second feature map and the third feature map are fused by features of different levels, and feature information of different levels is reserved; therefore, during identification, more features can be identified, and the identification accuracy is improved.

Refrigerator control method, system and equipment

The invention provides a refrigerator control method, system and equipment, and relates to the technical field of refrigeration control, the method comprises the following steps: determining a first temperature difference between an ith internal temperature and a set temperature; obtaining the refrigeration power of the ith control period through a refrigeration control model; in the (i + 1) th control period, the (i + 1) th internal temperature is obtained; determining a second temperature difference between the (i + 1) th internal temperature and the set temperature; determining whether the refrigeration power needs to be changed and determining whether a refrigeration control model needs to be trained; training a refrigeration control model through the ith internal temperature, the external temperature, the set temperature, the first temperature difference and the second temperature difference; obtaining the refrigeration power of the (i + 1) th control period through the trained refrigeration ...

Atomization data acquisition device and online digital evaluation method for charging atomization

The invention discloses an atomization data acquisition device and an online digital evaluation method for feeding atomization, and the device comprises a base, sliding plates are slidably mounted on the two sides of the interior of the base, placing grooves are formed in the front surfaces and the back surfaces of the two sliding plates, and moving plates are slidably mounted in the placing grooves. A sliding plate drives a moving plate to move, and after the moving plate is propped against two sides of an atomization device and cannot move, the sliding plate still continues to move, so that an outer chuck is clamped with an inner chuck, an annular bevel gear is driven to rotate, a bevel gear and a first threaded rod on the bevel gear are driven to rotate, and a fixed block moves downwards to limit the top of the atomization device; the acquisition device can automatically adapt to and fix the atomization device according to the width and thickness of the atomization device, the use is ...

Unit recovery decision-making method considering coupling characteristics of power grid and natural gas network

The invention provides a unit recovery decision-making method considering coupling characteristics of a power grid and a natural gas network. The method comprises the following steps: establishing an integer linear programming model for power grid unit recovery and load recovery, and solving the integer linear programming model by applying a solver to obtain key load recovery time of a power grid unit; establishing a simulation model of a natural gas network by using natural gas pipeline network simulation software, and operating pipeline network dynamic simulation by using the simulation model to obtain gas supply recovery time of a gas turbine unit; and comprehensively optimizing the key load recovery time of the power grid unit and the gas supply recovery time of the gas unit, and formulating a power grid and natural gas network unit recovery strategy. According to the method, the bidirectional coupling influence of the power grid and the natural gas network can be effectively considered ...

Intelligent system for intelligent identification access control

The invention relates to the technical field of access control systems, in particular to an intelligent system for intelligently identifying access control, which comprises an intelligent terminal, a management module, a personnel management module, a vehicle management module and a safety monitoring module, the two-dimensional code authentication information on the mobile phone is compared with the two-dimensional code verification information input into the intelligent terminal for confirmation, the fingerprint authentication information is compared with the fingerprint verification information input into the intelligent terminal for confirmation, and the face authentication information is compared with the face verification information input into the intelligent terminal for confirmation. The entrance guard can be opened by comparing input password authentication information with password verification information input into the intelligent terminal for confirmation and through a key, ...

Wind tunnel test device simultaneously using sub-transonic velocity flow field optimal region

The invention discloses a wind tunnel test device simultaneously using sub-transonic flow field optimal regions, and belongs to the technical field of aviation aerodynamic wind tunnel tests. The device comprises a wind tunnel test section and a model support section, the downstream end of the wind tunnel test section is a super-expansion section, the super-expansion section is provided with the model support section, and the wind tunnel test section can be respectively applied to a subtransonic speed test and a supersonic speed test. The research and development aim of the invention is to solve the problem that a model protection mechanism is needed due to large impact load on a model during driving in a supersonic speed test of a transient wind tunnel, and the problem of position movement in a model rotation process also needs to be solved when a connecting rod mechanism form is adopted. The wind tunnel test section can be applied to a subtransonic speed test and a supersonic speed test ...

Efficient assembling and welding integrated production device for forklift cab

According to the efficient assembling and welding integrated production device for the forklift cab, firstly, an assembling mechanism and a welding mechanism are integrated, efficient welding can be conducted immediately after a cab steel frame is rapidly assembled, a production line is optimized, and the production efficiency is also improved; secondly, a multi-point and multi-angle laser head is adopted, large-area synchronous efficient laser welding can be carried out, the welding speed is greatly increased, the efficiency defect that welding needs to be carried out in sequence one by one by adopting a welding machine arm traditionally is overcome, finally, laser welding is divided into three sections, and the welding efficiency is improved; therefore, all-directional welding of the inner side, the top upper end and the bottom lower end of the cab can be achieved, meanwhile, the welding mechanism is not affected to move to the inner side area, the top area and the bottom area of the ...

Heat dissipation integrated chip and preparation method thereof

The invention discloses a heat dissipation integrated chip which comprises a substrate, alloy heat conduction parts and a heat dissipation fin, an active device is formed on one side of the substrate through etching, the other side of the substrate is fixedly connected with the alloy heat conduction parts through bonding, and the alloy heat conduction parts are arranged on the other side of the substrate in an array mode. The side, away from the substrate, of the alloy heat conduction part is fixedly connected with the cooling fins through bonding. The heat dissipation integrated chip has high heat transfer efficiency, so that the high temperature requirement of the chip can be met, and in the heat transfer process, the stress between the heat dissipation sheet and the chip is reduced, so that the close contact between the heat dissipation sheet and the chip is maintained. The invention also discloses a preparation method of the heat dissipation integrated chip.

Clamping structure of modular wall body and steel beam and mounting method

The invention discloses a clamping structure of a modular wall body and a steel beam and an installation method, the clamping structure comprises the steel beam, a ceiling keel, a U-shaped piece, a ceiling keel installation assembly and the modular wall body, and the steel beam is located on the upper side of the modular wall body and arranged in the first direction. The mounting method comprises the steps of mounting the ceiling keel mounting assembly, mounting the ceiling keel, mounting the auxiliary keel and arranging the modular wall body. The invention relates to the field of walls, provides a clamping structure of a modular wall and a steel beam and an installation method, simplifies the structure, can ensure the firmness, and solves the problem of fixing and rooting of the steel beam.

OTFS single-tone interference suppression method based on fast Harris eagle optimization

The invention discloses an OTFS single-tone interference suppression method based on fast Harris eagle optimization, and relates to the technical field of wireless communication. The objective of the invention is to solve the problem of poor single-tone interference suppression effect caused by inaccurate estimation of single-tone interference in an existing single-tone interference suppression method, and the problem that effective suppression of single-tone interference in an OTFS system cannot be realized at the same time. The method comprises the following steps: acquiring an estimated interference center by using single-tone interference data; the population position is initialized by using the estimated interference center, the fitness value of the individual position in the population is calculated according to the fitness function, and the individual position with the minimum fitness value is used as the optimal position to carry out population position iterative updating; obtaining ...

Polygonatum polysaccharide liposome and preparation method thereof

The invention discloses a polygonatum polysaccharide liposome and a preparation method thereof, and relates to the technical field of pharmaceutical preparations, the polygonatum polysaccharide liposome comprises 10-15 parts of polygonatum polysaccharide, 15-25 parts of phospholipid, 10-15 parts of cholesterol, a water phase mixture with the concentration of 1-6 mg/mL, 10-20 parts of an organic solvent, and 20-30 parts of a surfactant. Polygonatum sibiricum polysaccharide is prepared into lipidosome through an organic solvent-active agent, and the polygonatum sibiricum polysaccharide is prepared from polygonatum sibiricum serving as a raw material through a dynamic high-pressure microjet technology by controlling parameters such as the mass ratio of the polygonatum sibiricum polysaccharide, lecithin and cholesterol, sufficient stirring and ultrasonic time by utilizing an absolute ethyl alcohol injection method. The preparation process is simple and easy to operate, the polysaccharide functionality ...

Fallback procedures for two-step random access procedures

Fallback procedures for user equipments (UEs) are described that provide efficient fallback to a four-step random access procedure from a two-step random access procedure. For example, after transmitting a first message of a two-step random access procedure, a UE may start a fallback timer or counter and monitor for a second message of the two-step random access procedure for the duration of the fallback timer or counter. At the expiration of the fallback timer or counter, the UE may fall back to a four-step random access procedure. In some cases, the UE may transmit multiple repetitions of the first message and monitor for responses after transmitting the repetitions or after each repetition. Additionally or alternatively, the base station may transmit an explicit signal to the UE that may signal to the UE to perform a fallback procedure at a beginning or middle of a random access procedure.

METHODS OF WELL TRAJECTORY AND DRILLING OPTIMIZED CONTROL FOR FRACTURE-VUGGY CARBONATE FORMATION

The invention discloses a series of methods to design drilling trajectory and control drilling operations in a optimized way in carbonate formation. The trajectory design method comprises: utilizing earthquake data to obtain contours of the carbonate rock fractures; determining a safe distance from each carbonate rock fracture; determining a segmented drilling trajectory for each fracture or vuggy structures in carbonate formation; and sequentially connecting the segmented drilling trajectories of neighboring fracture and vuggy to obtain a smooth horizontal drilling trajectory. The invention optimizes the carbonate rock reservoir drilling trajectory, thus improving connection between a horizontal well and the fractures. This reduces development costs, increases exploration and development efficiency and, at the same time, eliminates leaks resulting from the drilling process, thereby allowing for smooth drilling to a target well depth.

PHOTOACTIVE COMPOSITION AND ELECTRONIC DEVICE MADE WITH THE COMPOSITION

There is provided a photoactive composition including: (a) a first host material comprising a phenanthroline derivative; (b) a second host material comprising an aromatic amine; and (c) an electroluminescent dopant material. The weight ratio of first host material to second host material is in the range of 99:1 to 50:50.

System message notification and sending method and apparatus

Disclosed are a system message notification and sending method and apparatus. The method comprises: a CU determines system message relevant information; and the CU sends the system message relevant information to a DU. The DU receives the system message relevant information sent by the CU; and the DU notifies a terminal of the information. The present application provides an access control and system message processing solution under a CU-DU architecture, and a CU can provide sufficient auxiliary information to a DU, and thus the DU can generate suitable system information according to same. The two coordinate to provide a service to a UE, and the system efficiency is improved and a good user experience is ensured.

COLD ENERGY RECOVERY-TYPE VARIABLE-CAPACITY AIR-SOURCE HEAT PUMP SYSTEM

Disclosed is a cold energy recovery-type variable-capacity air-source heat pump system, relating to combined heating and refrigerating systems running in an alternating or synchronous manner, wherein a first subsystem and a second subsystem share a double-channel variable-capacity heat exchanger; a heat exchanger main body comprises two manually independent refrigerant pipe pass channels, and a refrigerant in the two channels synchronously carries out heat exchange with hot medium water in a shell pass channel; the shell pass channel establishes a water-medium heat-supplying circulation by means of a hot water circulation pipeline and a hot water circulation pump; the first subsystem and the second subsystem are connected to the two refrigerant pipe pass channels via a control valve group.

MICROELECTRONIC ASSEMBLIES HAVING AN INTEGRATED CAPACITOR

Microelectronic assemblies, related devices, and methods are disclosed herein. In some embodiments, a microelectronic assembly may include a die having a first surface and an opposing second surface; a capacitor having a surface, wherein the surface of the capacitor is coupled to the first surface of the die; and a conductive pillar coupled to the first surface of the die. In some embodiments, a microelectronic assembly may include a capacitor in a first dielectric layer; a conductive pillar in the first dielectric layer; a first die having a surface in the first dielectric layer; and a second die having a surface in a second dielectric layer, wherein the second dielectric layer is on the first dielectric layer, and wherein the surface of the second die is coupled to the capacitor, to the surface of the first die, and to the conductive pillar.

USE OF GENIC MALE STERILITY GENE AND MUTATION THEREOF IN HYBRIDIZATION

The present invention belongs to the field of biotechnology, in particular to a hybrid breeding method for maize, which comprises sterile line reproduction and hybrid seed production, and more particularly to plant FL1 gene or alleles thereof, as well as mutant plants produced by the variation of the gene.

Method and Device for Sharing Control Rights of Appliances, Storage Medium, and Server

The present disclosure provides a method and device for sharing control rights of appliances, a storage medium, and a server. The method includes that: a sharing request is received from a first user for sharing a control right of at least one appliance with at least one second user; and in response to the sharing request, a sharing operation of sharing the control right of the at least one appliance with the at least one second user is performed, so that both the first user and the at least one second user share the control right of the at least one appliance.

Polymere mit heterocyclischen Seitengruppen

RÖNTGENSTRAHLENEMPFINDLICHE PHOTOLEITFÄHIGE ZUSAMMENSETZUNGEN FÜR RÖNTGENRADIOGRAPHIE

AZABICYCLI HETEROCYCLEN AS MODULATORS OF THE CANNABINOIDREZEPTORS

ELEKTROLUMINESZENTE IRIDIUM CONNECTIONS WITH FLUORIDATED PHENYLPYRIDINEN, PHENYLPYRIDINE AND PHENYLCHINOLINE AND SUCH CONNECTIONS CONTAINING DEVICES

SMALL-PARTICLE SEMICONDUCTORS IN RIGID MATRICES

Polymerization of olefins

PHOTOACTIVE LANTHANIDE COMPLEXES WITH PHOSPHINE OXIDES, PHOSPHINE OXIDE-SULFIDES, PYRIDINE N-OXIDES, AND PHOSPHINE OXIDE-PYRIDINE N-OXIDES, AND DEVICES MADE WITH SUCH COMPLEXES

ELECTRONIC DEVICES MADE WITH ELECTRON TRANSPORT AND/OR ANTI-QUENCHING LAYERS

Polyfluoroether based polymers

A composition which provides surface effects to substrates comprising a polymer containing at least one urea linkage prepared by (i) reacting (1 ) at least one organic diioscyanate, polyisocyanate, or mixture thereof, and (2) at least one fluorochemical compound of Formula (I): R ...

COMPOSITION CONTAINING A BLOCK COPOLYMER AND A METHOD OF LUBRICATING AN INTERNAL COMBUSTION ENGINE

The invention provides a lubricating composition containing an oil of lubricating viscosity and a block copolymer. The block copolymer may contain (a) a hydrophobic first block having C1_30 alkyl (meth)acrylic units, wherein at least 50 wt % of the C1 _30 alkyl (meth)acrylic units are C 12-15 alkyl (meth)acrylic units, and up to 50 wt % of the C1_30 alkyl (meth)acrylic units are C 16-20 alkyl (meth)acrylic units, with the proviso that alkyl groups of the C1 _30 alkyl (meth)acrylic units have an average total number of carbon atoms of at least 8; and (b) a second block having (meth)acrylic units further having a heteroatom-containing group providing a polar group. The invention further relates to a method of lubricating an internal combustion engine by lubricating the engine with the lubricating composition. The invention further relates to the use of the block copolymer as an emulsifier and/or pour point depressant.

PSMP ANTAGONISTS FOR USE IN TREATMENT OF FIBROTIC DISEASE OF THE LUNG, KIDNEY OR LIVER

Disclosed are antagonists of PC3-secreted microprotein (PSMP) and use of the antagonists for treatment of liver, lung, or kidney fibrosis, including various diseases or disorders associated with liver, lung, or kidney fibrosis such as, e.g., non-alcoholic fatty liver disease (NAFLD), alcoholic liver disease (ALD), primary sclerosing cholangitis (PSC), primary biliary cholangitis (PBC), drug-induced lung injury, acute kidney injury (AKI), chronic kidney disease (CKD), lupus nephritis, IgA nephropathy, and membranous glomerulonephritis. Also disclosed are PSMP antagonists and their use for treatment of graft-versus-host disease (GVHD) and systemic lupus erythematosus (SLE). Suitable PSMP antagonists for use in disease treatment include PSMP-binding proteins such as, for example, neutralizing anti-PSMP antibodies.

WELLSITE HARDFACING WITH DISTRIBUTED HARD PHASE AND METHOD OF USING SAME

A hardfacing (301) disposable on a surface of a component (306), such as a wellsite component, is disclosed. The hardfacing includes a surface portion and a bottom portion with a segregation line (428) defined therebetween. The surface portion and the bottom portion each include a matrix phase (434) including a matrix composition made of a metal alloy and a hard phase (436) distributed in the matrix phase. The hard phase may include an abrasion-resistant composition made of a hard material (e.g., vanadium carbide). The surface portion (426a) has a first concentration of the abrasion- resistant composition and the bottom portion (426b) has a second concentration of the abrasion-resistant composition with the first concentration being greater than the second concentration such that a wear resistant surface is defined on the surface of the component.

WELLSITE HARDFACING WITH DISTRIBUTED HARD PHASE AND METHOD OF USING SAME

A hardfacing (301) disposable on a surface of a component (306), such as a wellsite component, is disclosed. The hardfacing includes a surface portion and a bottom portion with a segregation line (428) defined therebetween. The surface portion and the bottom portion each include a matrix phase (434) including a matrix composition made of a metal alloy and a hard phase (436) distributed in the matrix phase. The hard phase may include an abrasion-resistant composition made of a hard material (e.g., vanadium carbide). The surface portion (426a) has a first concentration of the abrasion- resistant composition and the bottom portion (426b) has a second concentration of the abrasion-resistant composition with the first concentration being greater than the second concentration such that a wear resistant surface is defined on the surface of the component.

CYCLOHEXYL ACID TRIAZOLE AZINES AS LPA ANTAGONISTS

The present invention provides compounds of Formula (I): Formula (I) or a stereoisomer, tautomer, or pharmaceutically acceptable salt or solvate thereof, wherein all the variables are as defined herein. These compounds are selective LPA receptor inhibitors.

FLUOROGENIC AND CHROMOGENIC SUBSTRATE

The present invention provides near-infrared fluorogenic and/or chromogenic formulations, methods, systems and kits. Upon contacting an azine with an oxidant and a peroxidase, the azine is converted to an azine derivative which is both visibly colored and fluorescent. This invention also provides high sensitive methods to detect biological molecules, showing better sensitivity than chemiluminescence methods. Advantageously, the formulation and reaction is free of luminol or luminol derivatives.

SPIROCYCLIC COMPOUNDS AS FARNESOID X RECEPTOR MODULATORS

The present invention provides compounds of Formula (I) or stereoisomers, tautomers, or pharmaceutically acceptable salts or solvates thereof, wherein all the variables are as defined herein. These compounds modulate the activity of farnesoid X receptor (FXR), for example, as agonists. This invention also relates to pharmaceutical compositions comprising these compounds and methods of treating a disease, disorder, or condition associated with FXR dysregulation, such as pathological fibrosis, transplant rejection, cancer, osteoporosis, and inflammatory disorders, by using the compounds and pharmaceutical compositions.

MULTICYCLIC AMINO ACID DERIVATIVES AND METHODS OF THEIR USE

Compounds of formulae I and II are disclosed, as well as compositions comprising them and methods of their use to treat, prevent and manage serotonin-mediated diseases and disorders.

CROSSLINKED POLYMER

The present invention provides a lubricating composition comprising: (a) an oil of lubricating viscosity; and (b) a crosslinked polymer derived from monomers comprising: (i) 0.001 wt % to 7 wt % of a di- or higher functional crosslinking monomer; (ii) 30 wt % or higher of a hydrocarbyl-substituted (m eth)acrylic monomer, wherein each hydrocarbyl contains greater than 8 carbon atoms; and (iii) 0 wt % to 40 wt % of a hydrocarbyl-substituted (meth)acryl ic monomer, wherein each hydrocarbyl contains 8 or fewer carbon atoms. The i nvention further provides a method of preparing the crosslinked polymer and its use in a lubricating composition for lubricating an internal combustion engine.

FLUOROPOLYMER NON-STICK COATINGS WITH IMPROVED SLOUGHING AND BLISTERING RESISTANCE

A coating composition is provided comprising (a) an aqueous medium, (b) melt - fabricable perfluoropolymer dispersed in said aqueous medium and having a melting temperature of at least 290°C, (c) melt - fabricable perfluoropolymer dispersed in said aqueous medium and having a melting temperature of no greater than 270 °C, and (d) water miscible organic liquid having a boiling temperature of at least 280°C and optionally (e) filler, the combination of (c) and (d) providing sloughing resistance to said composition applied to a non-horizontal substrate and baked, component (d) being unnecessary when component (a) is not present in the coating composition, and when filler is present, (c) being present in an effective amount to increase the cohesive strength of the baked layer of the coating composition.

METHODS OF TREATING PSORIATIC ARTHRITIS (PSA) USING IL-17 ANTAGONISTS AND PSA RESPONSE OR NON- RESPONSE ALLELES

The disclosure is directed to novel predictive methods and personalized therapies for treating psoriatic arthritis (PsA). Specifically, this disclosure relates to methods of treating a patient having PsA by selectively administering an IL-17 antagonist, e.g., an IL-17 antibody, such as secukinumab, to the PsA patient on the basis of that patient being predisposed to have a favorable response to treatment with the IL-17 antagonist. Also disclosed herein are diagnostic methods useful in predicting the likelihood that a patient having PsA will respond to treatment with an IL-17 antagonist, e.g., an IL-17 antibody, such as secukinumab.

AN OPTICAL FIBER CONTROL SYSTEM FOR SAFETY EARLY-WARNING

An optical fiber control system for safety early-warning includes a phase fading control and/or a polarization fading control. A polarization modulator is serially connected between a laser and a first multiplex demultiplexer. The first multiplex demultiplexer is connected to a second multiplex demultiplexer by three strands of optical fibers. The first multiplex demultiplexer is connected to two photoelectric detectors, the outputs of which are connected to two A/Ds. Outputs of the two A/Ds are connected to a photoelectric signal processing circuit, one output of which is connected to a polarization controller. Outputs of polarization controller are connected to a polarization modulator and a phase modulator which is connected to the first strand optical fiber. The other output of the photoelectric signal processing circuit is connected to a phase controller, the output of which is connected to the phase modulator which is connected to the second strand optical fiber.

COILED COIL IMMUNOGLOBULIN FUSION PROTEINS AND COMPOSITIONS THEREOF

Disclosed herein are immunoglobulin fusion proteins comprising a first antibody region, a first therapeutic agent, and a first connecting peptide; wherein the first therapeutic agent is attached to the first antibody region by the connecting peptide; and wherein the connecting peptide does not comprise a region having beta strand secondary structure. The connecting peptide may comprise an extender peptide. The extender peptide may have an alpha helical secondary structure. The connecting peptide may comprise a linker peptide. The linker peptide may not comprise any secondary structure. Also disclosed herein are compositions comprising the immunoglobulin fusion proteins and methods for using the immunoglobulin fusion proteins for the treatment or prevention of a disease or condition in a subject.

III-V SEMICONDUCTORS IN RIGID MATRICES

TITLE CR-8649 III-V SEMICONDUCTORS IN RIGID MATRICES This invention provides III-V semiconductor/glass and III-V semiconductor/glass/polymer articles of manufacture which are useful for generating third order nonlinear optical effects.

Method and system for determining out-put and in-put of warehouse of object by using infrared sensor

The invention discloses a method and system for determining out-put and in-put of warehouse of object by using infrared sensor. The method comprises the following steps: step 1, arranging a plurality of infrared transmitters and infrared receivers respectively on both sides of a warehouse door, wherein the infrared emitters and infrared receivers are in one-to-one correspondence to form a plurality of infrared sensors, the first sensor is on the innermost of the door, and the no. n sensor is on the outermost of the door; step 2, acquiring a shielding signal when an object comes out or gets into the warehouse and shields the infrared sensors, so as to form a shielding sequence, and prestoring a first shielding sequence for normal out-put of the object and a second shielding sequence for normal in-put of the object in a processing device; step 3, analyzing the quantity of shielding signals of the first shielding sequence contained in the shielding sequence, and calculating an out-put signal ...

Novel loach protein antihypertensive peptide and preparation method thereof

The invention provides a loach protein antihypertensive peptide and a preparation method thereof, belonging to the technical field of biology. The antihypertensive short peptide separated and purified from an enzymolysis product of loach protein has high activity in inhibiting angiotensin converting enzyme (ACE). The preparation method provided by the invention comprises the following steps of: carrying out enzymolysis on the loach protein to prepare an enzymolysis liquid; separating and purifying the antihypertensive peptide from the enzymolysis liquid; and sequencing the antihypertensive peptide. The invention combines a modern enzyme engineering technique and a peptide purifying and identifying technique, deep development and utilization on the loach protein are utilized, and a novel-sequence short peptide Leu-Glue-Tyr with high ACE inhibiting activity is found; and the novel loach protein antihypertensive peptide provided by the invention has high ACE inhibiting activity and has an ...

Method for selecting and grouping users in multi-antenna system, and communication device

The invention relates to the technical field of communication, and provides a method for selecting and grouping users in a multi-antenna system. The method comprises the following steps of: receiving access link channel state information by a control node, wherein the access link channel state information is transmitted by at least two users; determining scheduling priorities of at least two users according to the access link channel state information, and selecting the user with the highest scheduling priority as a reference user in a user group; determining a spatial character value between the reference user and the user of the at least two users except for the reference user; determining a grouping function value of the user of the at least two users except for the reference user according to the spatial character value and the scheduling priority of the user of the at least two users except for the reference user; and determining the group of the user according to the grouping function ...

Surface layer rendering method and device of geographic information application system

The invention provides surface layer rendering method and device for a geographic information application system. The method comprises the following steps: selecting a surface object of the surface layer as a sample, and setting a filling density; establishing uniformly distributed filling points in each surface object according to the filling density; saving the fill points as a point layer; setting a metasymbol to indicate point objects so as to replace the fill points and complete the surface layer rendering. The invention adopts the metasymbol which is suitable to various filling densities, so as to fill the surface layer in the geographic information application layer and replace a surface fill symbol which is rendered in a tiling method in the prior art, and can avoid making large amount of surface fill symbols, thereby greatly improving the work efficiency of the geographic information application system.

Cyanide contaminated soil restoring method

The invention discloses a cyanide contaminated soil restoring method. The method is used for processing heavily-contaminated soil with cyanide as the specific pollutant, and meanwhile the contaminated soil contains copper and other heavy metal. In the method, the heavy metal cyano complex, thiocyanate and other reducing substances in the soil are broken through the oxidizability of ozone and hydrogen peroxide. The pH value of the soil can be restored through a pH value restoring agent, finally restoration is conducted through the hydrogen peroxide, and a reaction system tends to be stable while the pollutant is processed; through the restoration of the method, a good restoration effect is achieved for copper and other heavy metal. The soil reaches the B-level standard in Standard of Soil Quality Assessment for Exhibition Sites after being restored and can be used as a class-II soil resource. The method is good in restoration effect of the cyanide heavily-contaminated soil, adopts environment-friendly ...

Method and relay equipment for implementing cell switch

The embodiment of the invention discloses a method and relay equipment for implementing cell switch. The method comprises the following steps of: setting a wireless interface for communication between RNs on each relay equipment (RN); judging whether to initiate the switch according to a channel quality measurement report reported by user equipment (UE) through a source RN, if so, judging whethera target RN and the source RN belong to the same eNB through the source RN, and if so, switching the UE to a cell administered by the target RN through the wireless interface. The equipment comprisesa wireless interface, a switch judgment module and a switch module, wherein the wireless interface is connected with the switch module; the switch judgment module receives the channel quality measurement report reported by the UE, judges whether to initiate the switch, and if so, sends switch instructions to the switch module; and the switch module switches the UE to the cell administered by the target ...

Humanized antibody for resisting avian influenza H5N1 hemagglutinin antigen, and preparation method and application thereof

The invention discloses a humanized antibody for resisting avian influenza H5N1 hemagglutinin (HA) antigen. A heavy chain variable region of the humanized antibody has an amino acid sequence shown in SEQ ID No.1; a light chain variable region of the humanized antibody has an amino acid sequence shown in SEQ ID No.2. In addition, the invention also discloses a preparation method and application of the humanized antibody. The humanized antibody is extensive and widespread in coagulation inhibition activity for avian influenza H5N1 virus, high in affinity and neutralization activity for various subtypes of the HA antigen of the avian influenza H5N1, and capable of recognizing a special conserved region of one H5HA; the humanized antibody is high in neutralization activity and capable of reducing immunogenicity; a recognized epitope is highly conserved in the H5 type influenza virus; the humanized antibody is extensive in application prospect in prevention and treatment and vaccine design of ...

Method for preparing porous titanate adsorbent by using pig manure

The invention relates to a method for preparing a porous titanate adsorbent by using pig manure. The process steps comprise: taking fresh pig manure, carrying out mashing homogenizing to obtain a homogenized pig manure slurry, slowly adding titanium tetrachloride to the homogenized pig manure slurry in a dropwise manner under a continuous stirring condition, uniformly stirring to obtain a titanium-containing pig manure gel, adding an alkaline earth metal to the titanium-containing pig manure gel, stirring for 30 min, adjusting the pH value to 2.5-4 with ammonia water, continuously stirring, carrying out heating evaporation to remove water, drying at a temperature of 105 DEG C to prepare a titanium-alkaline earth metal-pig manure dry gel, calcining the titanium-alkaline earth metal-pig manure dry gel for 4-6 h at a temperature of 650-1000 DEG C in an air atmosphere, and naturally cooling to a room temperature in the furnace to obtain the finished product. According to the present invention ...

Laser Apparatuses With Large-Number Multi-Reflection Pump Systems

A large number of passes of pump light through an active mirror in a solid state disk laser is realized using a pair of coupled imaging systems, where the optical axes of imaging systems are not coincident. Two imaging systems are optically coupled, so that an image of the first imaging system is an object of the second imaging system, and vice versa. An active mirror is disposed at the object or image plane, or at the focal plane of any one of the coupled imaging systems, where the position of the reflected pump beam during the multi-reflection between the first and second imaging systems is substantially unchanged. 1. A multi-reflection pump system comprising:a first imaging system having a first optical axis,a second imaging system having a second optical axis, said second optical axis not being coincident with said first optical axis, said first imaging system being optically coupled with said second imaging system so that an image of said first imaging system forms an object of said second imaging system and an image of said second imaging system forms an object of said first imaging system, at least one of said first and second imaging systems including an active mirror, anda source generating a pump light beam, the pump light beam entering said pump system and leaving said pump system after multiple reflections between said first imaging system and said second imaging system, said pump light beam being focused so that it is an object of said first imaging system, said pump light beam striking said active mirror multiple times during said multiple reflections between said first imaging system and said second imaging system.2. A system according to wherein said first optical axis and said second optical axis form an angle between them claim 1 , wherein said object of said first imaging system being said image of said second imaging system and said object of said second imaging system being said image of said first imaging system are substantially unchanged ...

DEVICE HOUSING AND METHOD FOR MAKING THE SAME

A device housing is provided. The device housing includes a substrate, a silicon dioxide film formed on the substrate, and a zinc oxide film formed on the silicon dioxide film. The silicon dioxide film has micrometer sized structures. The zinc oxide film has nanometer sized structures. A method for making the device housing is also described there. 1. A device housing , comprising:a substrate;a silicon dioxide film having micrometer sized structures formed on the substrate; anda zinc oxide film having nanometer sized structures formed on the silicon dioxide film.2. The device housing as claimed in claim 1 , wherein the silicon dioxide film has a micro dimensional surface roughness.3. The device housing as claimed in claim 1 , wherein the zinc oxide film defines with zinc oxide nano-stick arrays on its surface.4. The device housing as claimed in claim 1 , wherein the silicon dioxide film and the zinc oxide film have a total thickness of less than 1 μm.5. The device housing as claimed in claim 1 , wherein the silicon dioxide film and the zinc oxide film have a total thickness of about 0.1-0.5 μm.6. The device housing as claimed in claim 1 , wherein the silicon dioxide film and the zinc oxide film are transparent.7. The device housing as claimed in claim 1 , wherein the substrate is made of metal or non-metal material.8. The device housing as claimed in claim 7 , wherein the metal is selected from a group consisting of stainless steel claim 7 , aluminum claim 7 , aluminum alloy claim 7 , copper claim 7 , copper alloy claim 7 , and zinc; the non-metal is plastic claim 7 , ceramic claim 7 , glass claim 7 , or polymer.9. A method for making a device housing claim 7 , comprising:providing a substrate;forming a silicon dioxide film on the substrate by a sol-gel process, the silicon dioxide film having micrometer sized structures; andforming a zinc oxide film on the silicon dioxide film by vacuum sputtering, the zinc oxide film having nanometer sized structures.10. The ...

SYSTEM AND METHOD FOR SERIAL PROCESSING OF MULTIPLE NUCLEIC ACID ASSAYS

The present invention relates generally to systems and methods for the rapid serial processing of multiple nucleic acid assays. More particularly, the present invention provides for the real time processing of nucleic acid during polymerase chain reaction (PCR) and thermal melt applications. According to an aspect of the invention, a system for the rapid serial processing of multiple nucleic acid assays is provided. In one embodiment, the system includes, but is not limited to: a microfluidic cartridge having microfluidic (flow-through) channels, a fluorescence imaging system, a temperature measurement and control system; a pressure measurement and control system for applying variable pneumatic pressures to the microfluidic cartridge; a storage device for holding multiple reagents (e.g., a well-plate); a liquid handling system comprising at least one robotic pipettor for aspirating, mixing, and dispensing reagent mixtures to the microfluidic cartridge; systems for data storage, processing, and output; and a system controller to coordinate the various devices and functions. 1. A system for serial processing of nucleic acid assays , comprising:a microfluidic cartridge comprising an interface chip having at least one inlet port and microfluidic channel and a reaction chip having at least one microfluidic channel in fluid communication with an associated microfluidic channel of the interface chip; (a) draw a first fluid into the microfluidic channel of the interface chip via the inlet port of the interface chip;', '(b) create a first fluid segment in the microfluidic channel of the reaction chip by drawing the first fluid from the associated microfluidic channel of the interface chip into the microfluidic channel of the reaction chip;', '(c) draw a second fluid into the microfluidic channel of the interface chip via the inlet port of the interface chip while maintaining the position of the first fluid segment in the reaction chip; and', '(d) create a second fluid ...

ELECTRONIC DEVICE INCLUDING PHENANTHROLINE DERIVATIVE

There is provided an organic electronic device having an anode, a hole injection layer, a photoactive layer, an electron transport layer, and a cathode. At least one of the photoactive layer and the electron transport layer includes a compound having Formula I 119.-. (canceled) 1. Field of the DisclosureThis disclosure relates in general to organic electronic devices including at least one layer having a phenanthroline derivative.2. Description of the Related ArtIn organic photoactive electronic devices, such as organic light emitting diodes (“OLED”), that make up OLED displays, the organic active layer is sandwiched between two electrical contact layers in an OLED display. In an OLED, the organic photoactive layer emits light through the light-transmitting electrical contact layer upon application of a voltage across the electrical contact layers.It is well known to use organic electroluminescent compounds as the active component in light-emitting diodes. Simple organic molecules, conjugated polymers, and organometallic complexes have been used.Devices that use photoactive materials frequently include one or more charge transport layers, which are positioned between a photoactive (e.g., light-emitting) layer and a contact layer (hole-injecting contact layer). A device can contain two or more contact layers. A hole transport layer can be positioned between the photoactive layer and the hole-injecting contact layer. The hole-injecting contact layer may also be called the anode. An electron transport layer can be positioned between the photoactive layer and the electron-injecting contact layer. The electron-injecting contact layer may also be called the cathode. Charge transport materials can also be used as hosts in combination with the photoactive materials.There is a continuing need for new materials for electronic devices.There is provided an organic electronic device comprising an anode, a hole injection layer, a photoactive layer, an electron transport layer, ...

FLUOROPOLYMER COMPOSITIONS AND TREATED SUBSTRATES

A polymer having at least one urea linkage prepared by: (i) reacting (a) at least one diisocyanate, polyisocyanate, or mixture thereof, having isocyanate groups, and (b) at least one fluorinated compound selected from the formula (I): 1. (canceled)2. (canceled)3. (canceled)4. (canceled)5. (canceled)6. (canceled)7. (canceled)8. (canceled)9. (canceled)10. (canceled)11. (canceled)13. The method of wherein the polymer is contacted with the substrate as an aqueous dispersion or solution.14. The method of wherein the polymer is contacted with the substrate by means of exhaustion claim 12 , spray claim 12 , foam claim 12 , flex-nip claim 12 , nip claim 12 , pad claim 12 , kiss-roll claim 12 , beck claim 12 , skein claim 12 , winch claim 12 , liquid injection claim 12 , overflow flood claim 12 , brush claim 12 , roll claim 12 , spray or immersion.15. The method of wherein for cleanability the polymer is contacted with the substrate as an additive in a coating base.16. The method of wherein the polymer is contacted with the substrate in the presence of an agent providing at least one surface effect selected from the group consisting of no iron claim 12 , easy to iron claim 12 , shrinkage control claim 12 , wrinkle free claim 12 , permanent press claim 12 , moisture control claim 12 , softness claim 12 , strength claim 12 , anti-slip claim 12 , anti-static claim 12 , anti-snag claim 12 , anti-pill claim 12 , stain repellency claim 12 , stain release claim 12 , soil repellency claim 12 , soil release claim 12 , water repellency claim 12 , oil repellency claim 12 , stain resist claim 12 , odor control claim 12 , antimicrobial claim 12 , and sun protection.17. (canceled)18. (canceled)19. (canceled)20. (canceled)21. (canceled)22. (canceled)24. The method of wherein claim 23 , within said fluorinated compound of formula (I) claim 23 , p and q are each 1 claim 23 , r is 0 claim 23 , X is —O— claim 23 , and Rhas 6 carbon atoms.25. (canceled) The present invention relates to the use ...

ACOUSTIC-ASSISTED ITERATIVE WAVE FORM OPTIMIZATION FOR DEEP TISSUE FOCUSING

A method, apparatus, and article of manufacture for irradiating one or more targets within a sample with electromagnetic (EM) radiation. One or more targets within the sample are controllably defined with an acoustic field. The sample is irradiated with input EM radiation having an input wavefront. An amount of frequency shifted EM radiation is detected, wherein at least some of the input EM radiation that passes through the acoustic field at the targets is shifted in frequency to form the frequency shifted EM radiation. The input wavefront is modified, using feedback comprising the amount of the frequency shifted EM radiation that is detected, into a modified wavefront. The sample is irradiated using the input EM radiation comprising the modified wavefront, and the process is repeated as desired. 1. A method for irradiating a target within a sample , comprising:(a) controllably defining a target within a sample with an acoustic field;(b) irradiating the sample with input Electromagnetic (EM) radiation having an input wavefront;(c) detecting an amount of frequency shifted EM radiation, wherein at least some of the input EM radiation that passes through the acoustic field at the target is shifted in frequency by the acoustic field to form the frequency shifted EM radiation;(d) modifying the input wavefront, using feedback comprising the amount of the frequency shifted EM radiation that is detected, into a modified wavefront; and(e) repeating step (b) using the modified wavefront as the input wavefront.2. The method of claim 1 , further comprising repeating steps (a)-(e) until a threshold intensity or desired focus of the input EM radiation at the target is achieved claim 1 , wherein the modifying comprises selecting the modified wavefront that maintains claim 1 , increases claim 1 , or maximizes the amount of the frequency shifted EM radiation as compared to the amount of the frequency shifted EM radiation obtained using the input wavefront.3. The method of claim 1 , ...

TOUCH PANEL AND TOUCH DISPLAY DEVICE USING THE SAME

A touch panel comprising a substrate, a touch element, a first grounding electrode, an insulation layer and a second grounding electrode is disclosed. The touch element is disposed on a first surface of the substrate. The first grounding electrode is disposed on the first surface to surround the touch element. The insulation layer is disposed on the first surface to cover the touch element and the first grounding electrode. The second grounding electrode is disposed on the first insulation layer or on a second surface of the substrate opposite to the first surface. Therefore, the ESD can be conducted to the grounding end G of the circuit component through the enclosed first grounding electrode, and the signal interference between the touch panel and display can be shielded by the second grounding electrode to enhance anti-ESD and anti-noise abilities of the touch panel. 1. A touch panel , comprising:at least one first substrate;at least one touch element, disposed on a first surface of the first substrate;at least one first grounding electrode, disposed on the first surface to surround the touch element;a first insulation layer, disposed on the first surface to cover the touch element and the first grounding electrode; anda second grounding electrode, disposed on the first insulation layer or on a second surface of the first substrate opposite to the first surface.2. The touch panel of claim 1 , wherein the first grounding electrode is disposed at the peripheral of the first substrate to expose the outer edge of the first grounding electrode.3. The touch panel of claim 1 , wherein the touch element comprises a plurality of first sensing electrodes claim 1 , a plurality of second sensing electrodes claim 1 , a plurality of first wires claim 1 , a plurality of second wires and a second insulation layer wherein the first sensing electrodes connected with the first wires and the second sensing electrodes connected with the second wires are disposed intersectingly claim ...

HOUSING AND METHOD FOR MAKING THE SAME

A housing for an electronic device includes a metal substrate and a luminous layer formed on the metal substrate, the luminous layer mainly comprises ZnO mixed with In. The disclosure also described a method to make the housing. 1. A housing of electronic device , comprising:a metal substrate; anda luminous layer formed on the metal substrate, the luminous layer substantially comprising ZnO mixed with a little In.2. The housing of electronic device as claimed in claim 1 , wherein the luminous layer further includes at least one rare-earth element.3. The housing of electronic device as claimed in claim 1 , wherein a thickness of the luminous layer is less than about 500 nanometer(nm).4. The housing of electronic device as claimed in claim 1 , wherein the metal substrate is one of stainless steel claim 1 , copper claim 1 , titanium claim 1 , titanium alloy claim 1 , aluminum claim 1 , or aluminum alloy.5. A method for making a housing of electronic device claim 1 , comprising:providing a metal substrate; andforming a luminous layer on the surface of the metal substrate, the luminous layer substantially comprising ZnO mixed with a little In.6. The method for making a housing of electronic device as claimed in claim 5 , wherein further comprising cleaning the metal substrate by organic solution to clean grease before forming the luminous layer.7. The method for making a housing of electronic device as claimed in claim 5 , wherein further comprising plasma cleaning to remove any oxides before forming the luminous layer.8. The method for making a housing of electronic device as claimed in claim 5 , wherein during plasma cleaning claim 5 , placing the substrate into a chamber of a coating machine claim 5 , floating argon(Ar) into the chamber claim 5 , exerting a voltage on the substrate claim 5 , the Ar particles striking the surface of the substrate to remove any oxides.9. The method for making a housing of electronic device as claimed in claim 8 , wherein during forming ...

METHOD AND DEVICE FOR PROCESSING TYPE OF LOCAL NETWORK OVER BASE STATION

The present application discloses a method and an equipment for processing the local network type of a base station (BS). The method comprises: when a BS has determined its local network type, it indicates to a user equipment (UE) said local network type; and when the UE receives the indication carrying said local network type of the BS, it can determine, according to said indication, the local network type of the BS. The present application solves the problem of a user being unable to acquire the type of network connected to a BS and accordingly being unable to determine the corresponding connection means, and enriches user experience. 1. A method for processing a type of a local network over a base station , comprising:determining, by the base station, the type of the local network over the base station; andindicating, by the base station, the type of the local network to a User Equipment, UE.217-. (canceled)18. The method of claim 1 , wherein the base station comprises a Home evolved NodeB claim 1 , HeNB; and wherein the HeNB indicates the type of the local network to the UE in one or a combination of the following approaches:the HeNB indicates the type of the local network to the UE in broadcasted system information;the HeNB indicates the type of the local network to the UE in high layer signalling; andthe HeNB carries information on the type of the local network in broadcasted system information and instructs the UE to acquire the type of the local network from the system information.19. (canceled)2099. The method of claim 18 , wherein the HeNB indicates in the broadcasted system information the type of the local network to the UE by carrying the information on the type of the local network in a System Information Block Type claim 18 , SIB claim 18 , of the system information and indicating in the information the type of the local network to the UE; andthe method further comprises:determining, by the HeNB, whether there is a change to the type of the connected ...

COMPOSITIONS AND METHODS RELATING TO REDUCED MUCOADHESION

The present invention generally relates to reducing the mucoadhesive properties of a particle. In some embodiments, the particle is coated with and/or associated with a (poly(ethylene glycol))-(poly(propylene oxide))-(poly(ethylene glycol)) triblock copolymer. Methods for preparing inventive particles using a poly(ethylene glycol)-vitamin E conjugate as a surfactant are also provided. In some embodiments, methods are provided comprising administering to a subject a composition of particles of the present invention. Such particles with reduced mucoadhesive properties are useful in delivering agents to mucosal tissues such as oral, ophthalmic, gastrointestinal, nasal, respiratory, and genital mucosal tissues. 1. A method of forming a (poly(ethylene glycol))-(poly(propylene oxide))-(poly(ethylene glycol))-coated particle , the method comprising the steps of:preparing a particle using poly(ethylene glycol)-vitamin E conjugate, wherein the molecular weight of the poly(ethylene glycol) of the poly(ethylene glycol)-vitamin E is greater than about 2 kDa; andcoating the particle with a (poly(ethylene glycol))-(poly(propylene oxide))-(poly(ethylene glycol)) triblock copolymer, wherein the (poly(ethylene glycol))-(poly(propylene oxide))-(poly(ethylene glycol)) triblock copolymer associates with the coated particle to form a (poly(ethylene glycol))-(poly(propylene oxide))-(poly(ethylene glycol))-coated particle, wherein the molecular weight of the (poly(propylene oxide)) block of the triblock copolymer is greater than about 1.8 kDa.2. A method of reducing mucoadhesion of a particle , the method comprising the steps of:associating a (poly(ethylene glycol))-(poly(propylene oxide))-(poly(ethylene glycol)) triblock copolymer with the surface of the particle, wherein the molecular weight of the (poly(propylene oxide)) block of the triblock copolymer is greater than about 1.8 kDa, andwherein said particle diffuses through human cervicovaginal mucus at a diffusivity that is less than ...

MULTI-BAND ANTENNA

A multi-band antenna includes a feed-in section, a loop conductor, a first conductor arm, a second conductor arm, and a third conductor arm. The feed-in section includes a feed-in point for feeding of signals. The loop conductor extends from the feed-in section and has a grounding point disposed adjacent to the feed-in point. The first conductor arm is configured to resonate in a first frequency band and extends from the feed-in section. The second conductor arm is configured to resonate in a second frequency band and extends from the feed-in section. The third conductor arm is configured to resonate in a third frequency band and extends from the feed-in section. At least one of the loop conductor, the first conductor arm, the second conductor arm, and the third conductor arm is bent so as to be disposed in different planes. 1. A multi-band antenna comprising:a feed-in section including a feed-in point for feeding of signals;a loop conductor extending from said feed-in section and having a grounding point disposed adjacent to said feed-in point;a first conductor arm configured to resonate in a first frequency band and extending from said feed-in section;a second conductor arm configured to resonate in a second frequency band and extending from said feed-in section; anda third conductor arm configured to resonate in a third frequency band and extending from said feed-in section;wherein at least one of said loop conductor, said first conductor arm, said second conductor arm, and said third conductor arm is bent so as to be disposed in different planes.2. The multi-band antenna as claimed in claim 1 , wherein said first conductor arm has a substantially U-shaped profile claim 1 , and includes a first radiator section connected to said feed-in section claim 1 , a second radiator section connected to one end of said first radiator section opposite to said feed-in section claim 1 , and a third radiator section connected to said second radiator section claim 1 , said first ...

TRYPTOPHAN HYDROXYLASE INHIBITORS

Compounds of formulae I and II are disclosed, as well as compositions comprising them and methods of their use to treat, prevent and manage serotonin-mediated diseases and disorders: 1203-. (canceled)205. The compound of claim 204 , wherein A is optionally substituted aryl.206. The compound of claim 205 , wherein A is optionally substituted phenyl.207. The compound of claim 204 , wherein A is optionally substituted heterocycle.208. The compound of claim 204 , wherein X is —C(R)═ claim 204 , ═C(R)— claim 204 , —C(RR)— claim 204 , —C(R)═C(R)— claim 204 , or —C≡C—.209. The compound of claim 208 , wherein each Ris independently hydrogen or optionally substituted alkyl.210. The compound of claim 204 , wherein X is —O— claim 204 , —C(RR)O— claim 204 , or —OC(RR)—.211. The compound of claim 210 , wherein Ris hydrogen.212. The compound of claim 210 , wherein Ris independently hydrogen or optionally substituted alkyl.213. The compound of claim 204 , wherein E is optionally substituted aryl.214. The compound of claim 213 , wherein E is optionally substituted phenyl.215. The compound of claim 204 , wherein Ris hydrogen or optionally substituted alkyl.216. The compound of claim 204 , wherein Ris hydrogen or optionally substituted alkyl.217. The compound of claim 204 , wherein n is 1.218. A pharmaceutical formulation comprising the compound of and a pharmaceutically acceptable excipient.219. A method of treating irritable bowel syndrome claim 204 , which comprises administering to a patient in need thereof a therapeutically effective amount of a compound of .220. A method of treating carcinoid syndrome claim 204 , which comprises administering to a patient in need thereof a therapeutically effective amount of a compound of .221. A method of treating Crohn's disease claim 204 , which comprises administering to a patient in need thereof a therapeutically effective amount of a compound of . This is a continuation of U.S. application Ser. No. 12/750,278, filed Mar. 30, 2010, which ...

COATED ARTICLE AND METHOD OF MAKING THE SAME

A coated article includes a bonding layer, a chromium oxynitride layer a boron nitride layer formed on a substrate in that order. The boron nitride layer is made of hexagonal structure boron nitride. 1. A coated article , comprising:a substrate;a bonding layer formed on the substrate;a chromium oxynitride layer formed on the bonding layer; anda boron nitride layer formed on the chromium oxynitride layer, the boron nitride layer made of hexagonal structure boron nitride.2. The coated article as claimed in claim 1 , wherein the substrate is made of die steel.3. The coated article as claimed in claim 1 , wherein the bonding layer is made of chromium.4. The coated article as claimed in claim 1 , wherein the bonding layer is formed by magnetron sputtering and has a thickness in a range of about 50 nm to about 150 nm.5. The coated article as claimed in claim 1 , wherein the chromium oxynitride layer is formed by magnetron sputtering and has a thickness in a range of about 200 nm to about 700 nm.6. The coated article as claimed in claim 1 , wherein the boron nitride layer is formed by vacuum evaporation claim 1 , and has a thickness in a range of about 200 nm to about 600 nm.7. A method of making a coated article claim 1 , comprising steps of:providing a substrate made of die steel;forming a bonding layer on the substrate;forming a chromium oxynitride layer on the bonding layer; andforming a boron nitride layer on the chromium oxynitride layer, the boron nitride layer made of hexagonal structure boron nitride.8. The method as claimed in claim 7 , wherein the bonding layer is made of chromium.9. The method as claimed in claim 8 , wherein the bonding layer is formed by magnetron sputtering.10. The method as claimed in claim 9 , wherein during the step of forming the bonding layer claim 9 , at least one chromium target is applied claim 9 , argon gas is applied as a working gas at a flow rate of about 100 sccm to about 300 sccm claim 9 , a bias voltage in a range of about − ...

PACKAGING SUBSTRATE AND METHOD OF FABRICATING THE SAME

A packaging substrate is proposed, which includes: a circuit layer formed on a substrate and having conductive pads, an insulating protective layer formed on the substrate for covering the circuit layer and having openings for correspondingly exposing the conductive pads; copper bumps each having a connection portion formed in a corresponding one of the openings and electrically connected to a corresponding one of the conductive pads, and a protruding portion integrally connected to the connection portion and extending to a portion of the insulating protective layer surrounding the corresponding one of the openings, allowing the protruding portion to be greater in diameter than the connection portion, and a surface treatment layer having an electroplated nickel material formed on top surfaces of the protruding portions of the copper bumps, and an electroplated gold material formed on the electroplated nickel material. The surface treatment layer is not formed on side surfaces of the protruding portions, such that the thickness of the surface treatment layer is irrelevant to the diameter of the protruding portion. 1. A packaging substrate , comprising:a substrate body;a circuit layer formed on the substrate body and having a plurality of conductive pads;an insulating protective layer formed on the substrate body for covering the circuit layer and having a plurality of openings for correspondingly exposing the conductive pads; a connection portion formed in a corresponding one of the openings and electrically connected to a corresponding one of the conductive pads; and', 'a protruding portion integrally connected to the connection portion and extending onto a portion of the insulating protective layer surrounding the corresponding one of the openings, wherein the protruding portion is greater in diameter than the connection portion; and, 'a plurality of copper bumps, each of which including an electroplated nickel material formed on the protruding portion of the ...

COMPOSITION AND METHOD FOR IN-SYSTEM PRIMING MICROFLUIDIC DEVICES

The present invention relates to compositions and methods for in-system priming of microfluidic devices. Aspects of the present invention relate to compositions and methods for in-system priming of microfluidic devices utilizing a priming solution comprising adding and/or increasing concentrations of surfactant in a buffer solution. 1. A priming solution comprising a 1×PCR buffer modified to contain an increased concentration of surfactant.2. The priming solution of claim 1 , wherein the concentration of surfactant is from a factor of about 5 to a factor of about 150 of the critical micelle concentration (CMC) of the surfactant.3. The priming solution of claim 1 , wherein the concentration of surfactant is from a factor of about 5 to a factor of about 45 of the critical micelle concentration (CMC) of the surfactant.4. The priming solution of claim 1 , wherein the surfactant is selected from the group consisting of polysorbate surfactants claim 1 , octylphenol ethoxylate surfactants claim 1 , ethoxylated aliphatic alcohol surfactants claim 1 , polyoxyethylene surfactants claim 1 , carboxylic ester surfactants claim 1 , polyethylene glycol ester surfactants claim 1 , anhydrosorbitol ester and its ethoxylated derivatives surfactants claim 1 , fatty acid glycol ester surfactants claim 1 , carboxylic amide surfactants claim 1 , monoalkanolamine condensate surfactants claim 1 , polyoxyethylene fatty acid amide surfactants and combinations thereof.5. The priming solution of claim 1 , wherein the surfactant is a polysorbate surfactant.6. The priming solution of claim 5 , wherein the surfactant is Tween® 20.7. The priming solution of claim 6 , wherein the concentration of Tween® 20 is in the range from about 0.05% to about 1.0%.8. The priming solution of claim 6 , wherein the concentration of Tween® 20 is in the range from about 0.05% to about 0.3%.9. The priming solution of claim 1 , wherein the surfactant is an octylphenol ethoxylate surfactant.10. The priming solution of ...

CIRCUIT BOARD SURFACE STRUCTURE AND FABRICATION METHOD THEREOF

A circuit board surface structure and a fabrication method thereof are proposed. The circuit board surface structure includes: a circuit board having a plurality of electrically connecting pads formed on at least one surface thereof; a first and a second insulating protective layers formed on the surface of the circuit board in sequence; first and a second openings respectively formed in the first and second insulating protective layers to expose the electrically connecting pads on the surface of the circuit board, wherein the first and second openings have narrow top and wide bottom and the diameter of the first openings is bigger than that of the second openings; and conductive elements formed in the first and second openings on surfaces of the electrically connecting pads. The present structure facilitates to strengthen the bonding between the conductive elements and the corresponding electrically connecting pads. 1. A fabrication method of a circuit board surface structure , comprising:providing a circuit board having at least one surface formed with a plurality of electrically connecting pads;forming on the surface of the circuit board a first insulating protective layer and a second insulating protective layer in sequence;forming first openings and second openings penetrating the first and second insulating protective layers respectively so as to expose the electrically connecting pads on the surface of the circuit board, wherein each of the first and second openings is tapered upward, and the first openings have a greater diameter than the second openings; andforming conductive elements on surfaces of the electrically connecting pads in the first and second openings.2. The method of claim 1 , wherein the first and second insulating protective layers have different composition ratios.3. The method of claim 2 , wherein the composition ratio of photo-polymerization material in the first insulating protective layer is smaller than the composition ratio of photo- ...

ELECTRONIC DEVICES HAVING LONG LIFETIME

An organic light-emitting diode is provided having an anode, a cathode, and an organic active layer therebetween. The organic active layer includes a deuterated compound and the device has a calculated half-life at 1000 nits of at least 5000 hours. 1. An organic light-emitting diode comprising an anode , a cathode , and an organic active layer therebetween , wherein the organic active layer comprises a deuterated compound and the device has a calculated half-life at 1000 nits of at least 5000 hours.2. The organic light-emitting diode of claim 1 , wherein the organic active layer comprises a deuterated conductive polymer and a fluorinated acid polymer.3. The organic light-emitting diode of claim 1 , wherein the organic active layer comprises a deuterated hole transport compound having at least two diarylamino moieties per molecular formula unit.4. The organic light-emitting diode of claim 1 , wherein the organic active layer comprises a material selected from the group consisting of deuterated polymeric triarylamines claim 1 , deuterated polycarbazoles claim 1 , deuterated polyfluorenes claim 1 , deuterated polymeric triarylamines having conjugated moieties which are connected in a non-planar configuration claim 1 , deuterated copolymers of fluorene and triarylamine claim 1 , and combinations thereof.5. The organic light-emitting diode of claim 1 , wherein the organic active layer comprises an electroluminescent compound selected from the group consisting of deuterated chrysenes claim 1 , deuterated pyrenes claim 1 , deuterated perylenes claim 1 , deuterated rubrenes claim 1 , deuterated periflanthenes claim 1 , deuterated fluoranthenes claim 1 , deuterated stilbenes claim 1 , deuterated coumarins claim 1 , deuterated anthracenes claim 1 , deuterated thiadiazoles claim 1 , deuterated spirobifluorenes claim 1 , derivatives thereof claim 1 , and mixtures thereof.7. The organic light-emitting diode of claim 1 , wherein the organic active layer comprises an ...

COATED ARTICLE AND METHOD OF MAKING THE SAME

A coated article includes a magnesium layer, a magnesium oxynitride layer a titanium nitride layer formed on a substrate in that order. The substrate is made of magnesium alloy. 1. A coated article , comprising:a substrate made of magnesium alloy;a magnesium layer formed on the substrate;a magnesium oxynitride layer formed on the magnesium layer; anda titanium nitride layer formed on the magnesium oxynitride layer.21515. The coated article as claimed in claim 1 , wherein the oxygen of the magnesium oxynitride layer has an atomic percentage in a range from 25% to 40% and the nitrogen of the magnesium oxynitride layer has an atomic percentage in a range from about 20% to about 35%.3. The coated article as claimed in claim 1 , wherein the magnesium layer is formed by magnetron sputtering and has a thickness in a range of about 20 nm to about 50 nm.4. The coated article as claimed in claim 1 , wherein the magnesium oxynitride layer is formed by magnetron sputtering and has a thickness in a range of about 200 nm to about 300 nm.5. The coated article as claimed in claim 1 , wherein the titanium nitride layer is formed by magnetron sputtering claim 1 , and has a thickness in a range of about 100 nm to about 200 nm.6. A method of making a coated article claim 1 , comprising steps of:providing a substrate made of magnesium alloy;forming a magnesium layer on the substrate by magnetron sputtering;forming a magnesium oxynitride layer on the magnesium layer by magnetron sputtering; andforming a titanium nitride layer on the magnesium oxynitride layer by magnetron sputtering.7. The method as claimed in claim 6 , wherein during the step of forming the magnesium layer claim 6 , at least one magnesium target is applied claim 6 , a power of the magnesium target is from about 3 kw to 10 kw claim 6 , argon gas is applied as a working gas having a flow rate of about 100 sccm to about 300 sccm claim 6 , a bias voltage in a range of about −100V to about −300V is applied to the substrate ...

SEMICONDUCTOR DEVICE CONTACT STRUCTURES AND METHODS FOR MAKING THE SAME

A semiconductor contact structure and method provide contact structures that extend through a dielectric material and provide contact to multiple different subjacent materials including a silicide material and a non-silicide material such as doped silicon. The contact structures includes a lower composite layer formed using a multi-step ionized metal plasma (IMP) deposition operation. A lower IMP film is formed at a high AC bias power followed by the formation of an upper IMP film at a lower AC bias power. The composite layer may be formed of titanium. A further layer is formed as a liner over the composite layer and the liner layer may advantageously be formed using CVD and may be TiN. A conductive plug material such as tungsten or copper fills the contact openings. 1. A method for forming a contact structure in a semiconductor device , comprising:providing a semiconductor device substructure with a dielectric layer having a plurality of contact openings extending therethrough, each said contact opening terminating at a respective bottom surface, at least one said bottom surface being a silicide surface and at least one said bottom surface being a further surface;forming a composite base layer on said respective bottom surfaces using a multi-step IMP (ionized metal plasma) deposition process, said composite base layer including a lower layer of a first material formed using a high AC bias power and an upper layer of said first material formed using a low AC bias power, said high AC bias power greater than said low AC bias power;forming a layer of a second material on said composite base layer using chemical vapor deposition (CVD); anddepositing a conductive plug material in said plurality of contact openings and contacting said layer of second material.2. The method as in claim 1 , wherein said lower layer is formed to include a first resistivity and said upper layer is formed to include a second resistivity that is higher than said first resistivity claim 1 , and ...

SEMICONDUCTOR DEVICE

A semiconductor device is disclosed. The device includes a substrate; a first metal layer overlying the substrate; a dielectric layer overlying the first metal layer; and a second metal layer overlying the dielectric layer, wherein the first metal layer comprises: a first body-centered cubic lattice metal layer; a first underlayer, underlying the first body-centered cubic lattice metal layer, wherein the first underlayer is metal of body-centered cubic lattice and includes titanium (Ti), tungsten (W), molybdenum (Mo) or niobium (Nb); and a first interface of body-centered cubic lattice between the first body-centered cubic lattice metal layer and the first underlayer. 1. A semiconductor device , comprising:a substrate;a first metal layer overlying the substrate;a dielectric layer overlying the first metal layer; and a first body-centered cubic lattice metal layer;', 'a first underlayer, underlying the first body-centered cubic lattice metal layer, wherein the first underlayer is metal of body-centered cubic lattice and comprises titanium (Ti), tungsten (W), molybdenum (Mo) or niobium (Nb); and', 'a first interface of body-centered cubic lattice between the first body-centered cubic lattice metal layer and the first underlayer., 'a second metal layer overlying the dielectric layer, wherein the first metal layer comprises2. The device as claimed in claim 1 , wherein the second metal layer comprises:a second body-centered cubic lattice metal layer;a second underlayer, underlying the second body-centered cubic lattice metal layer; anda second interface of body-centered cubic lattice between the second body-centered cubic lattice metal layer and the second underlayer.3. The device as claimed in claim 1 , wherein the first and second metal layers are respectively selected from a group consisting of niobium claim 1 , tantalum claim 1 , thallium claim 1 , and a combination thereof.4. The device as claimed in claim 2 , whereinthe first and second underlayers are titanium (Ti ...

Coated article and method of making the same

A coated article includes a bonding layer, an iridium layer, a chromium oxynitride layer and a chromium nitride layer formed on a substrate in that order. The substrate is made of die steel.

PYRIDONE GPR119 G PROTEIN-COUPLED RECEPTOR AGONISTS

Novel compounds are provided which are GPR119 G protein-coupled receptor modulators. GPR119 G protein-coupled receptor modulators are useful in treating, preventing, or slowing the progression of diseases requiring GPR119 G protein-coupled receptor modulator therapy. These novel compounds have the structure Formula I or Formula IA. 2. A compound according to selected from the group consisting of compounds of Formula I and IA wherein:{'sub': 20', '21, "ring A is optionally substituted with one or more R's shown as Rand R;"}G is CH or N;{'sub': 2', '3', '9', '9', '2, 'Y is CH, N(R), C(═O), O, OCRR, S, S(═O) or S(O);'}{'sub': '1', 'nis 0-2;'}{'sub': '2', 'nis 0-2;'}{'sub': '3', 'nis 1-2;'}{'sub': 1', '1a', '1b', '1c', '1d', '1e, 'Ris phenyl, pyridinyl, pyrazinyl or pyrimindinyl, each of which may be optionally substituted with one or more members selected from R, R, R, Rand R;'}{'sub': 1a', '1b', '1c', '1d', '1e', '2', '2', '10', '3', '11', '11', '3', '3', '2', '9', '9', '12', '12', '2', '9', '9', '9', '2', '3', '9', '2', '9', '2', '9', '9', '2', '9', '9', '9', '9', '2', '3', '11', '9', '9', '10', '10', '9', '9', '14', '9', '9', '14', '14', '14', '11', '2', '11', '9', '8', '9', '2', '8', '6', '7, "R, R, R, Rand Rare each independently selected from the group consisting of hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, aryl, heterocyclyl, halo, —NH, —CN, —NO, —C(═O)OH, —C(═O)OR, —OCF, —OR, —OH, —SH, —SR, —S(O)H, —P(O)H, —C(═O)NRR, —NRR, —S(O)NRR, —NRS(O)CF, —C(═O)NRS(O)R, —S(O)NRC(═O)OR, —S(O)NRC(═O)NRR, —C(═O)NRS(O)CF, —C(═O)R, —NRC(═O)H, —NRC(═O)R, —OC(═O)R, —OC(═O)NRR, —C(═NR)NRR, —NHC(═NR)NRR, —S(═O)R, —S(O)R, —NRC(═O)ORand —NRS(O)R, wherein: (a) the alkenyl, alkynyl, cycloalkyl, aryl and heterocyclyl may each be optionally substituted with one or more R's; and (b) the alkyl may optionally be substituted by one or more of R's;"}{'sub': 2', '2', '5', '3', '5', '5', '5', '6, "Ris cycloalkyl, aryl, heteroaryl, heterocyclyl, —S(O)R, —C(═O)NRR, —C(═O)Ror —C(═O)OR, ...

PORTABLE ELECTRICAL DEVICE AND ITS MANUFACTURING METHOD

A portable electrical device includes a chassis, a plurality of conductive bodies, a wireless RF module and a cable. The chassis includes a casing layer and a radiator layer stacked with each other. The conductive bodies are embedded inside the casing layer, in which one end of each conductive body exposes outwards one surface of the plastic casing layer, and the other end of each conductive body exposes outwards the other surface of the casing layer and electrically conducts the radiator layer. The cable is electrically conducted with the conductive bodies and the wireless RF module. 1. A portable electrical device , comprising: a case layer provided with an inner surface and an outer surface opposite with each other; and', 'a radiator layer stacked on the outer surface of the case layer;, 'a chassis, comprisinga first conductive body and a second conductive body respectively embedded inside the case layer, wherein each of the conductive bodies has at least one first end and a second end opposite with each other, and the at least one first end thereof is exposed outwards the inner surface of the case layer, and the second end thereof is exposed outwards the outer surface of the case layer and electrically conducted with the radiator layer;a wireless RF module; anda cable electrically interconnected the first conductive body, the second conductive body and the wireless RF module.2. The portable electrical device according to claim 1 , wherein the cable is disposed on the inner surface of the case layer claim 1 , and the cable comprises:a signal portion electrically conducted with the first conductive body; anda ground portion electrically conducted with the second conductive body.3. The portable electrical device according to claim 2 , wherein the second conductive body comprises:a first conducting portion and a second conducting portion respectively disposed on two of the at least one first end of the second conductive body, wherein the first conducting portion is ...

MULIT-BIT CELL

A method for forming a device is disclosed. The method includes providing a substrate prepared with a primary gate and forming a charge storage layer on the substrate over the primary gate. A secondary gate electrode layer is formed on the substrate over the charge storage layer. The charge storage and secondary gate electrode layers are patterned to form first and second secondary gates on first and second sides of the primary gate. 1. A method for forming a device comprising:providing a substrate prepared with a primary gate;forming a charge storage layer on the substrate over the primary gate;forming a secondary gate electrode layer on the substrate over the charge storage layer; andpatterning the charge storage and secondary gate electrode layers to form first and second secondary gates on first and second sides of the primary gate.2. The method of wherein the charge storage layer comprises a dielectric charge storage layer.3. The method of wherein the charge storage layer comprises nano-crystals.4. The method of wherein the primary gate comprises a primary gate electrode over a primary gate dielectric layer.5. The method of wherein the first and second secondary gates are disposed adjacent to and overlap the first and second sides of the primary gate.6. The method of wherein the device comprises a memory cell.7. The method of wherein the primary gate comprises a select gate of the memory cell.8. The method of wherein the secondary gates comprise control gates of the memory cell.9. A device comprises:a substrate with a primary gate on the substrate; andfirst and second secondary gates on first and second sides of the primary gate, wherein the secondary gates comprise a charge storage layer and a secondary gate electrode over the charge storage layer.10. The device of wherein the charge storage layer comprises a dielectric charge storage layer.11. The device of wherein the charge storage layer comprises nano-crystals.12. The device of wherein the primary gate ...

MICROSATELLITE MARKER COMBINATION AND METHOD FOR IDENTIFYING LANYU PIG BREED

The present invention provides a microsatellite marker combination for identifying Lanyu pig breed, and the identification method thereof. The identification method comprises the following steps: (a) providing a genomic DNA sample obtained from a pig; (b) identifying the polymorphism of microsatellite markers of said genomic DNA sample; and (c) analyzing the results obtained from step (b) to determine the phylogenetic relationship between said pig and Lanyu pig. 1. A method for identifying Lanyu pig breed , comprising the following steps:(a) providing a genomic DNA sample obtained from a pig;(b) identifying the polymorphism of microsatellite markers of said genomic DNA sample, wherein said microsatellite markers comprising SW024, SW72, SW122, SW857, SW911, SW951, IGF1, S0002, S0005, S0068, S0155, S0215, S0218, S0225, S0226, S0227, S0228, S0355 and S0386;(c) analyzing the results obtained from step (b) to determine the phylogenetic relationship between said pig and Lanyu pig.2. The method according to claim 1 , wherein the polymorphism of said microsatellite markers is identified by polymerase chain reaction.3. The method according to claim 1 , wherein the phylogenetic relationship between said pig and Lanyu pig is determined by constructing a phylogenetic tree.4. The method according to claim 1 , wherein the polymorphism of said microsatellite markers comprises one or more private alleles selected from:the repeat fragment of SW024 having a length of 118 bp;the repeat fragment of SW911 having a length of 163 bp;the repeat fragment of SW951 having a length of 136 bp;the repeat fragment of S0002 having a length of 174 bp;the repeat fragment of S0068 having a length of 244 bp;the repeat fragment of S0155 having a length of 166 bp;the repeat fragment of S0218 having a length of 188 bp;the repeat fragment of S0225 having a length of 174 bp;the repeat fragment of S0226 having a length of 176 bp;the repeat fragment of S0227 having a length of 238 bp;the repeat fragment of ...

LED DRIVING CIRCUIT

An LED driving circuit includes a first and a second LED modules, a first and a second switching converters, an extreme voltage detecting and selecting circuit, a current balance circuit and a controller. The first switching converter transforms electric power of an input power supply into a first output voltage for lighting the first LED module. The second switching converter transforms electric power of the input power supply into a second output voltage for lighting the second LED module. The current balance circuit balances the currents flowing through the first and the second LED modules. The extreme voltage detecting and selecting circuit detects the first and the second LED modules and selects to output one of detecting results. The controller controls the transforming of the first switching converter and the second switching converter to light the first and the second LED modules in response to the outputted detecting result. 1. A light emitting diode (LED) driving circuit , comprising:a first LED module;a second LED module;a first switching converter, having a first input terminal coupled to an input power supply and a first output terminal coupled to the first LED module, and adapted to transform electric power of the input power supply into a first output voltage for lighting the first LED module;a second switching converter, having a second input terminal coupled to the input power supply and a second output terminal coupled to the second LED module, and adapted to transform the electric power of the input power supply into a second output voltage for lighting the second LED module;a current balance circuit, coupled to the first LED module and the second LED module, for balancing currents flowing through the first LED module and the second LED module;an extreme voltage detecting and selecting circuit, coupled to the first LED module and the second LED module, for detecting the first LED module and the second LED module and selecting to output one of ...

METHOD OF IDENTIFYING A CANDIDATE COMPOUND WHICH MAY INHIBIT a9-nAchR OVEREXPRESSION OR ESTROGEN RECEPTOR-DEPENDENT TRANSCRIPTION IN NICOTINE-DERIVED-COMPOUND-INDUCED BREAST CANCER CELLS

The invention relates to methods of identifying a candidate compound which may inhibit estrogen receptor-dependent transcription or α9-nAChR overexpression and proliferation of nicotine-derived-compound-induced breast cancer cells by using an activating protein 1 (AP1) polypeptide. The invention found that α9-nAChR has an activating protein 1 (AP1)-binding site, that the α9-nAChR promoter is located at the AP1-binding site, and that ERs specifically bind to the α9-nAChR promoter at the AP1-binding site, indicating that ER-induced α9-nAChR up-regulation plays a central role in the response to endogenous (E2) or exogenous (nicotine) stimulation. 1. A method of identifying a candidate compound which may inhibit overexpression of α9-nAChR or estrogen receptor-dependent transcription in nicotine-derived-compound-induced breast cancer cells , comprising contacting the compound with the AP1 polypeptide or VDR polypeptide and determining whether the compound binds to the polypeptide , wherein binding of the compound to the polypeptide indicates that the compound may inhibit overexpression of α9-nAChR or estrogen receptor-dependent transcription in nicotine-derived-compound-induced breast cancer cells.2. The method of claim 1 , wherein the AP1 polypeptide is encoded by a polynucleotide comprising a sequence of nnTGAC(or G)nnnnn claim 1 , and wherein the VDR polypeptide is encoded by a polynucleotide comprising a sequence of nnnnnnnnGAGG(or T)nnn.3. The method of claim 1 , wherein the AP1 polypeptide is encoded by a polynucleotide comprising a sequence of ccTGACtgaga claim 1 , and wherein the VDR polypeptide is encoded by a polynucleotide comprising a sequence of aggggaggGAGGgca.4. A method of identifying a candidate compound which may inhibit overexpression of α9-nAChR or estrogen receptor-dependent transcription in nicotine-derived-compound-induced breast cancer cells claim 1 , comprising contacting the AP1 polypeptide or VDR polypeptide and an estrogen receptor polypeptide ...

PROCESS FOR SURFACE TREATING IRON-BASED ALLOY AND ARTICLE

A process for surface treating iron-based alloy includes providing a substrate made of iron-based alloy. A stainless steel layer is then formed on the substrate by sputtering. A silicon-oxygen-nitrogen layer is formed on the stainless steel layer by sputtering. A boron-nitrogen layer is next formed on the silicon-oxygen-nitrogen layer by sputtering. 1. A process for surface treating iron-based alloy , the process comprising the following steps of:providing a substrate made of iron-based alloy;forming a stainless steel layer on the substrate by sputtering;forming a silicon-oxygen-nitrogen layer on the stainless steel layer by sputtering; andforming a boron-nitrogen layer on the silicon-oxygen-nitrogen layer by sputtering.2. The process as claimed in claim 1 , wherein sputtering of the stainless steel layer uses argon at a flow rate of about 100 sccm-300 sccm as a puttering gas; uses a stainless steel target and applies about 8 kW-12 kW of power to the stainless steel target; applies a bias voltage of about −100 V to about −300 V to the substrate; sputtering of the stainless steel layer is conducted at a temperature of about 20° C.-200° C. and takes about 5 min-20 min.3. The process as claimed in claim 1 , wherein sputtering of the silicon-oxygen-nitrogen layer uses argon at a flow rate of about 100 sccm-300 sccm as a puttering gas; uses nitrogen and oxygen each at a flow rate of about 20 sccm-300 sccm as reaction gases claim 1 , uses a silicon target and applies about 8 kW-12 kW of power to the silicon target; applies a bias voltage of about −100 V to about −300 V to the substrate;sputtering of the silicon-oxygen-nitrogen layer is conducted at a temperature of about 20° C.-200° C. and takes about 10 min-40 min.4. The process as claimed in claim 1 , wherein sputtering of the boron-nitrogen layer uses argon at a flow rate of about 100 sccm-300 sccm as a puttering gas; uses nitrogen at a flow rate of about 20 sccm-200 sccm as a reaction gas claim 1 , uses a boron target ...

Process for surface treating iron-based alloy and article

A process for surface treating iron-based alloy includes providing a substrate made of iron-based alloy. A chromium layer is then formed on the substrate by vacuum sputtering. A silicon oxide layer, an alumina layer, and a boron nitride layer are formed in that order by vacuum evaporation.

Process for surface treating iron-based alloy and article

A process for surface treating iron-based alloy includes providing a substrate made of iron-based alloy. A chromium-oxygen-nitrogen layer is then formed on the substrate by sputtering. An iridium layer is formed on the chromium-oxygen-nitrogen layer by sputtering. A boron-nitrogen layer is next formed on the iridium layer by sputtering.

AUTOMATIC GAIN CONTROL IN A WIRELESS COMMUNICATION NETWORK

Techniques for performing automatic gain control (AGC) at a terminal in a wireless communication network are described. In an aspect, the terminal may use different receiver gain settings to receive different types of signals in different time intervals. The terminal may determine a receiver gain setting for each signal type and may use the receiver gain setting to receive signals of that signal type. In another aspect, the terminal may determine a receiver gain setting for a future time interval based on received power levels for peer terminals expected to transmit in that time interval. The terminal may measure received power levels of signals received from a plurality of terminals. The terminal may determine a set of terminals expected to transmit in the future time interval and may determine the receiver gain setting for the future time interval based on the measured received power levels. 1. A method for wireless communication , comprising:measuring received power levels for a set of terminals in at least one prior time interval;determining a predicted received power level for the set of terminals in a future time interval based on the measured received power levels for the set of terminals;determining a receiver gain setting for the future time interval based on the predicted received power level; andusing the receiver gain setting to receive signals from the set of terminals in the future time interval.2. The method of claim 1 , further comprising:receiving signals from a plurality of terminals in at least one frame, each frame comprising multiple time intervals, each terminal transmitting in different time intervals in different frames, the different time intervals being selected based on a hopping function; anddetermining the set of terminals from among the plurality of terminals based on the hopping function and information on current time, the set of terminals being expected to be received in the future time interval.3. The method of claim 1 , further ...

VIA/CONTACT AND DAMASCENE STRUCTURES

A semiconductor structure is provided and includes a dielectric layer disposed over a substrate. A first non-conductive barrier layer is formed over the dielectric layer. At least one opening is formed through the first non-conductive barrier layer and within the dielectric layer. A second non-conductive barrier layer is formed over the first non-conductive barrier layer and within the opening. At least a portion of the second non-conductive barrier layer is removed, thereby at least partially exposing a top surface of the first non-conductive barrier layer and a bottom surface of the opening, with the second non-conductive barrier layer remaining on sidewalls of the opening. A seed layer and conductive layer is disposed in the opening. 1. A semiconductor structure , comprising:a dielectric layer formed over a substrate;a plurality of openings formed within the dielectric layer;a first non-conductive barrier layer formed over the dielectric layer, wherein the first non-conductive barrier layer extends from an edge of a first one of the openings to an edge of a second one of the openings adjacent thereto;a second non-conductive barrier layer formed on sidewalls of the openings; anda conductive material formed within the openings.2. The semiconductor structure of claim 1 , wherein the first non-conductive barrier layer and the second non-conductive barrier layer have a substantially same thickness.3. The semiconductor structure of claim 1 , wherein at least one of the first non-conductive barrier layer and the second non-conductive barrier layer is a silicon-based material layer including at least one of nitrogen claim 1 , oxygen and carbon.4. The semiconductor structure of claim 1 , further comprising a seed layer formed on the second non-conductive barrier layer and over bottom surfaces of the openings.5. The semiconductor structure of claim 1 , wherein the dielectric layer is a low-k dielectric layer and the openings extend downwardly from an upper surface of the ...

Method, System and Device for Controlling Handover of User Terminal Device

Embodiments of the invention provide a method and system for controlling handover of a user terminal device. 1. A method for controlling handover of a user terminal device , comprising:receiving, by a Home Evolved NodeB Gateway (HeNB GW), a handover request of a User Equipment (UE), on which handover needs to be performed, sent from a source eNB, converting the handover request into a handover request which satisfies an interface form between the HeNB GW and a target eNB, and sending the converted handover request to the target eNB;receiving, by the HeNB GW, a handover request acknowledgement message sent from the target eNB if the target eNB permits the UE to access; andreceiving, by the HeNB GW, the handover request acknowledgement message sent from the target eNB, converting the handover request acknowledgement message into a handover request acknowledgement message which satisfies an interface form between the source eNB and the HeNB GW, and sending the converted handover request acknowledgement message to the source eNB.2. The handover method of claim 1 , wherein when the source eNB is a Macro-eNB and the target eNB is the HeNB claim 1 ,receiving, by the HeNB GW, the handover request of the User Equipment (UE), on which the handover needs to be performed, sent from the source eNB, converting the handover request into the handover request which satisfies the interface form between the HeNB GW and the target eNB, sending the converted handover request to the target eNB comprises:receiving, by the HeNB GW, an X2 AP handover request message of the UE sent from the Macro-eNB, constructing an S1 AP handover request message according to the X2 AP handover request message, and sending the S1 AP handover request message to the HeNB; whereinreceiving, by the HeNB GW, the handover request acknowledgement message sent from the target eNB if the target eNB permits the UE to access comprises:receiving, by the HeNB GW, an S1 AP handover request ack message sent from the ...

MULTI-BIT ERROR CORRECTION METHOD AND APPARATUS BASED ON A BCH CODE AND MEMORY SYSTEM

Exemplary embodiments for providing multi-bit error correction based on a BCH code are provided. In one such embodiment, the following operations are repeatedly performed, including shifting each bit of the BCH code rightward by 1 bit while filling the bit vacated due to the rightward shifting in the BCH code with 0, calculating syndrome values corresponding to the shifting of the BCH code, and determining a first error number in the BCH code under the shifting based on the syndrome values corresponding to the shifting of the BCH code. In the case where the first error number is not equal to 0, modified syndrome values are calculated corresponding to the shifting of the BCH code. The modified syndrome values are those corresponding to the case that the current rightmost bit of the BCH code under the shifting is changed to the inverse value. Additional operations are performed as described herein. 1. A processor apparatus for performing multi-bit error correction based on a BCH code , comprising:a syndrome value generation module adapted for shifting each bit of the BCH code on which error correction is to be performed rightward by 1 bit while filling a bit vacated due to the rightward shifting in the BCH code with 0, and calculating syndrome values corresponding to the shifting of the BCH code;a modified syndrome value generation module in communication with the syndrome value generation module, wherein the modified syndrome value generation module is adapted for, corresponding to each rightward one bit shifting of the BCH code on which error correction is to be performed, calculating modified syndrome values corresponding to the shifting of the BCH code, wherein the modified syndrome values are those corresponding to a case that the current rightmost bit of the BCH code under the shifting is changed to an inverse value;an error number determination module in communication with the modified syndrome value generation module, wherein the error number determination ...

COATED ARTICLE AND METHOD FOR MAKING SAME

A coated article is provided. A coated article includes a substrate having a color layer and a ceramic layer formed thereon, and in that order. The color layer substantially comprises a material elected from the group consisting of aluminum, aluminum alloy, zinc, and zinc alloy. The ceramic layer substantially consists of substance M, elemental O, and elemental N, wherein M is elemental Al or elemental Zn. 1. A coated article , comprising:a substrate;a color layer formed on the substrate, the color layer substantially comprising a material selected from the group consisting of aluminum, aluminum alloy, zinc, and zinc alloy; anda ceramic layer formed on the color layer, the ceramic layer substantially comprising a substance M, elemental O, and elemental N, wherein M is elemental Al or elemental Zn.2. The coated article as claimed in claim 1 , wherein the atomic ratio of the substance M claim 1 , elemental O claim 1 , and elemental N is about (0.9-1.1):(0.9-1.1):(0.9-1.1).3. The coated article as claimed in claim 2 , wherein the atomic ratio of the substance M claim 2 , elemental O claim 2 , and elemental N is about 1:1:1.4. The coated article as claimed in claim 1 , wherein the ceramic layer is transparent and colorless.5. The coated article as claimed in claim 1 , wherein the aluminum alloy or zinc alloy claim 1 , has a mass percentage of about 85%-90% of aluminum or zinc.6. The coated article as claimed in claim 1 , wherein the color layer has an L* value between about 88 to about 93 in the CIE L*a*b* color space.7. The coated article as claimed in claim 1 , wherein the color layer has a thickness of about 0.7 μm-1.3 μm.8. The coated article as claimed in claim 1 , wherein the layer formed by the ceramic layer in combination with the color layer has an L* value between about 85 to about 90 claim 1 , an a* value between about −0.5 to about 0.5 claim 1 , and an b* value between about −2.0 to about 3.0 in the CIE L*a*b* color space.9. The coated article as claimed in ...

CHARGE TRANSPORT COMPOSITIONS AND ELECTRONIC DEVICES MADE WITH SUCH COMPOSITIONS

The present invention relates to charge transport compositions. The invention further relates to electronic devices in which there is at least one active layer comprising such charge transport compositions. 2. The device of claim 1 , wherein the second layer comprises a quinoxaline derivative having Formula III claim 1 , and further wherein:m is an integer from 2 through 10; andn is an integer from 1 through 12.35.-. (canceled)6. The device of claim 1 , wherein Ris selected from alkylacetate groups.7. The device of claim 1 , wherein Ris selected from alkyl groups having from 1 to 12 carbon atoms.8. The device of claim 1 , wherein Ris selected from phenyl groups claim 1 , substituted phenyl groups claim 1 , pyridyl groups claim 1 , and substituted pyridyl groups.9. The device of claim 1 , wherein Rtogether form a biarylene group.10. The device of claim 9 , wherein the biarylene group is selected from biphenylene claim 9 , substituted biphenylene claim 9 , bipyridylene claim 9 , and substituted bipyridylene.11. The device of claim 1 , wherein Ris selected from aryl claim 1 , heteroaryl claim 1 , alkyl claim 1 , and heteroalkyl.12. The device of claim 1 , wherein Ris selected from phenyl and substituted phenyl.13. The device of claim 1 , wherein Ris selected from alkyl and heteroalkyl having from 1 to 12 carbon atoms.14. The device of wherein Q is selected from an aromatic group claim 1 , and a heteroaromatic group.15. The device of wherein Q is selected from alkylene groups claim 1 , hetereoalkylene groups claim 1 , alkenylene groups claim 1 , heteroalkenylene groups claim 1 , alkynylene groups claim 1 , and heteroalkynylene groups.16. The device of wherein Q is selected from single-ring aromatic groups claim 1 , multiple-ring aromatic groups claim 1 , fused-ring aromatic groups claim 1 , single-ring heteroaromatic groups claim 1 , multiple-ring aromatic groups claim 1 , fused-ring aromatic groups claim 1 , arylamines claim 1 , silanes and siloxanes.18. An electronic ...

METHODS AND APPARATUS FOR PROVIDING FLEXIBILITY IN PEER DISCOVERY RANGE AND FREQUENCY OF UPDATES

A method, a computer program product, and an apparatus for wireless communication are provided. The apparatus transmits a first peer discovery signal with a first periodicity/temporal frequency in a first set of peer discovery resources. The apparatus determines an energy on an allocated peer discovery resource of a second set of peer discovery resources. The apparatus refrains from transmitting a second peer discovery signal in the second set of peer discovery resources when the energy is greater than a threshold. The apparatus transmits the second peer discovery signal in the second set of peer discovery resources with a second periodicity/temporal frequency less than the first periodicity/temporal frequency when the energy is less than the threshold. The apparatus may utilize the first set of peer discovery resources every period and the second set of peer discovery resources once every N periods in which once every N periods is the second periodicity. 1. A method of wireless communication , comprising:transmitting a first peer discovery signal with a first periodicity in a first set of peer discovery resources;determining an energy on an allocated peer discovery resource of a second set of peer discovery resources;refraining from transmitting a second peer discovery signal in the second set of peer discovery resources when the energy is greater than a threshold; andtransmitting the second peer discovery signal in the second set of peer discovery resources with a second periodicity less than the first periodicity when the energy is less than the threshold.2. The method of claim 1 , wherein the second set of peer discovery resources are utilized once every N periods claim 1 , said once every N periods being the second periodicity.3. The method of claim 2 , wherein a number of peer discovery resources in the second set of peer discovery resources multiplied by N is greater than or equal to a number of peer discovery resources in the first set of peer discovery ...

COEXISTENCE OF PRIORITY BROADCAST AND UNICAST IN PEER-TO-PEER NETWORKS

A method, a computer program product, and an apparatus are provided. In one configuration, the apparatus transmits a first broadcast signal including information indicating an intention to use a unicast resource for a broadcast. In addition, the apparatus transmits a second broadcast signal in the unicast resource. In another configuration, the apparatus, which is a first wireless device, receives a first broadcast signal from a second wireless device including information indicating an intention to use a unicast resource for a broadcast. In addition, the apparatus receives a first scheduling signal from the second wireless device in a scheduling resource. The first scheduling signal is for indicating a second intention to use the unicast resource for transmitting a second broadcast signal. Furthermore, the apparatus refrains from transmitting a second scheduling signal in the scheduling resource in response to the first scheduling signal. 1. A method of wireless communication , comprising:transmitting a first broadcast signal comprising information indicating an intention to use a unicast resource for a broadcast; andtransmitting a second broadcast signal in the unicast resource.2. The method of claim 1 , further comprising determining to utilize the unicast resource for transmitting the second broadcast signal due to a need to transmit additional broadcast information.3. The method of claim 1 , wherein the first broadcast signal further comprises a broadcast message.4. The method of claim 1 , wherein said information indicating the intention to use the unicast resource for the broadcast comprises information indicating the unicast resource that will be used for the broadcast.5. The method of claim 4 , wherein the unicast resource comprises a plurality of unicast resources.6. The method of claim 1 , further comprising communicating a second intention to use the unicast resource in a scheduling resource of a plurality of scheduling resources.7. The method of claim 6 ...

CRYSTALS OF HUMAN TOPOISOMERASE II-DNA BINARY COMPLEX, METHODS FOR PREPARING THE SAME AND USES THEREOF

Disclosed herein are a crystal of a human TOPII (hTOPII)-DNA binary complex, the method for preparing the same and the use thereof. The hTOPII-DNA binary complex includes an hTOPII portion that contains an hTOPII core domain (hTOPII), and a synthetic double-stranded DNA in complex with the hTOPII portion. The synthetic double-stranded DNA has a first DNA strand comprising nucleotide positions 3 to 20 of the sequence of 5′-NNNCCGAGCNNNNGCTCGGNNN-3′ (SEQ ID NO: 1), wherein N is any one of adenine, thymine, cytosine, or guanine, and a second DNA strand complementary to the first DNA strand. 1. A synthetic double-stranded DNA for forming a human TOPII (hTOPII)-DNA binary complex comprising:a first DNA strand corresponding to nucleotide positions 3 to 20 of the sequence of 5′-NNNCCGAGCNNNNGCTCGGNNN-3′ (SEQ ID NO: 1), wherein N is any one of adenine, thymine, cytosine or guanine; anda second DNA strand that is complementary to the first DNA strand.2. The synthetic double-stranded DNA of claim 1 , wherein the first DNA strand comprises a 5′-C↓NNNNG-3′ cleavage site claim 1 , and the arrow indicates the cleavage position where the strand DNA is cut by hTOPII.3. The synthetic double-stranded DNA of claim 1 , wherein the first DNA strand has a sequence from 5′ to 3′ claim 1 , GCCGAGCTGCAGCTCGGC (SEQ ID NO: 2).4. The synthetic double-stranded DNA of claim 3 , wherein the first DNA strand comprises a 5′-C↓TGCAG-3′ cleavage site of the SEQ ID NO:2 claim 3 , and the arrow indicates the cleavage position where the strand DNA is cut by hTOPII.5. The synthetic double-stranded DNA of claim 1 , wherein the first DNA strand has a sequence from 5′ to 3′ claim 1 , AGCCGAGCTGCAGCTCGGCT (SEQ ID NO: 3).6. The synthetic double-stranded DNA of claim 5 , wherein the first DNA strand comprises a 5′-C↓TGCAG-3′ cleavage site of the SEQ ID NO:3 claim 5 , and the arrow indicates the cleavage position where the strand DNA is cut by hTOPII.7. The synthetic double-stranded DNA of claim 1 , wherein the ...

Nickel Alloy Target Including a Secondary Metal

A target includes nickel and a secondary metal. The secondary metal has a volume percentage between about 1 percent and about 10 percent. The secondary metal has a density between about 5,000 kg/mand about 15,000 kg/m. 1. A target comprising:{'sup': 3', '3, 'nickel and a secondary metal, wherein the secondary metal has a volume percentage between about 1 percent and about 10 percent, and wherein the secondary metal has a density between about 5,000 kg/mand about 15,000 kg/m.'}2. The target of claim 1 , wherein the secondary metal is selected from the group consisting essentially of zinc claim 1 , molybdenum claim 1 , ruthenium claim 1 , and combinations thereof.3. The target of claim 2 , wherein the secondary metal comprises zinc.4. The target of claim 2 , wherein the secondary metal comprises molybdenum.5. The target of claim 2 , wherein the secondary metal comprises ruthenium.6. The target of claim 1 , where the nickel in the target has a volume percentage greater than about 90 percent.7. The target of being configured to be used in a physical vapor deposition (PVD) tool claim 1 , wherein the PVD tool comprises:a chamber capable of being vacuumed, wherein the target is capable of being installed in the chamber; anda pedestal configured to hold a semiconductor wafer thereon.8. A device comprising:a substrate; a gate dielectric over the substrate;', 'a gate electrode over the gate dielectric;', 'a source/drain region adjacent the gate dielectric; and', {'sup': 3', '3, 'a source/drain silicide over and contacting the source/drain region, wherein the source/drain silicide comprises silicon, nickel, and a secondary metal, and wherein a ratio of a volume percentage of the secondary metal to a volume percentage of the silicon in the source/drain silicide is between about 0.005 and about 0.1, and wherein the secondary metal has a density between about 5,000 kg/mand about 15,000 kg/m.'}], 'a metal-oxide-semiconductor (MOS) device comprising9. The device of further ...

LIQUID CRYSTAL DISPLAY

A liquid crystal display including a backlight unit and a liquid crystal display panel is provided. The backlight unit includes an exciting light source and quantum dot remote phosphor. Spectrum of the backlight unit has relative maximum brightness peaks BL, BL and BL between 445 nm to 455 nm, between 528 nm to 538 nm, and between 618 nm to 628 nm, respectively. The liquid crystal display panel is disposed above the backlight unit and has a red color filter, a green color filter, a blue color filter and a yellow color filter, wherein areas of the red color filter, the green color filter, the blue color filter and the yellow color filter are A, A, A, A, respectively. The areas A, A, A, Asatisfy the following relationship: 0.75 Подробнее

Apparatus for Wafer Grinding

A grinding wheel comprises an outer base with a first attached grain pad; and an inner frame with a second attached grain pad; and a spindle axis shared by the outer base and the inner frame, wherein at least one of the outer base and the inner frame can move independently along the shared spindle axis; and wherein the outer base, the inner frame, and the shared spindle axis all have a same center. A grinding system comprises an above said grinding wheel, and a wheel head attached to the shared spindle axis, capable of moving vertically, in addition to a motor driving the grinding wheel to spin; and a chuck table for fixing a wafer on top of the chuck table; wherein the grinding wheel overlaps a portion of the chuck table, each capable of spinning to the opposite direction of another. 1. A grinding wheel comprising:an outer base with a first attached grain pad;an inner frame encompassed within the outer base, with a second attached grain pad which has a different grain size from the first attached grain pad; anda spindle axis shared by the outer base and the inner frame, wherein at least one of the outer base and the inner frame can move independently along the shared spindle axis;wherein the outer base, the inner frame, and the shared spindle axis all have a same center of rotation.2. The grinding wheel of claim 1 , wherein both the outer base and the inner frame can move independently along the shared spindle axis.3. The grinding wheel of claim 1 , wherein the outer base is cup-shaped.4. The grinding wheel of claim 1 , wherein the inner frame is cup-shaped.5. The grinding wheel of claim 1 , wherein the first attached grain pad has a grain size of from #1000 to #4000 and the second attached grain pad grain pad has a grain size of from #3 to #240.6. The grinding wheel of further comprising:a second inner frame encompassed within the outer base and within the inner frame, and having a third attached grain pad which has a different grain size from the first and the ...

COATED ARTICLE AND METHOD FOR MAKING SAME

A coated article includes a substrate, a first layer deposited on the substrate, a second layer deposited on the first layer and a third layer deposited on the second layer. The first layer substantially consists of one material selected from the group consisting of Al layer, Al alloy layer, Zn layer or Zn alloy layer. The first layer is white. The second layer substantially includes metal M′, O and N, wherein M′ is Al or Zn. The third layer is an aluminum oxide layer or a silicon oxide layer. The third layer has an anti-fingerprint property. 1. A coated article , comprising:a substrate;a first layer deposited on the substrate, the first layer substantially consisting of one material selected from the group consisting of aluminum, aluminum alloy, zinc, and zinc alloy;a second layer deposited on the first layer, the second layer substantially including metal M′, O and N, wherein M′ is Al or Zn; anda third layer deposited on the second layer, the third layer being an aluminum oxide layer or a silicon oxide layer.2. The coated article as claimed in claim 1 , wherein when the first layer substantially consists of aluminum alloy claim 1 , the mass percentage of Al is about 80-90%.3. The coated article as claimed in claim 1 , wherein when the first layer substantially consists of zinc alloy layer claim 1 , the mass percentage of Zn is about 80-90%.4. The coated article as claimed in claim 1 , wherein the first layer has an L* value between about 85 to about 91 claim 1 , an a* value between about −0.5 to about 0.5 claim 1 , and a b* value between about −0.5 to about 0.5 in the CIE L*a*b* color space.5. The coated article as claimed in claim 1 , wherein in the second layer claim 1 , the atomic ratio of M claim 1 , O claim 1 , and N is about (0.9-1.1):(0.5-1):(0.5-1).6. The coated article as claimed in claim 1 , wherein in the second layer claim 1 , the atomic ratio of M claim 1 , O claim 1 , and N is 1:1:1.7. The coated article as claimed in claim 1 , wherein the third ...

SEMICONDUCTOR DEVICES UTILIZING PARTIALLY DOPED STRESSOR FILM PORTIONS AND METHODS FOR FORMING THE SAME

A semiconductor structure and method for forming the same provide a high mobility stressor material suitable for use as source/drain regions or other active devices. The structure is formed in a substrate opening and is doped with an impurity such as boron in upper portions but is void of the impurity in regions that contact the surfaces of the opening. The structure is therefore resistant to out-diffusion of the dopant impurity during high temperature operations and may be formed through selective deposition using reduced pressure chemical vapor deposition or reduced pressure epitaxial deposition. 1. A transistor structure comprising:a gate structure at least partially disposed over a gate dielectric disposed on a channel formed in a semiconductor substrate; andopposed source/drain regions, each formed in an opening in said semiconductor substrate adjacent said gate structure and including a lower portion of SiGe free of a first dopant impurity and an upper portion of SiGe including said first dopant impurity therein.2. The transistor structure as in claim 1 , wherein said upper portion of SiGe comprises an intermediate portion of SiGe including a lower first dopant impurity concentration and a top portion of SiGe including a higher first dopant impurity concentration.3. The transistor structure as in claim 2 , wherein said lower portion of SiGe extends along a bottom of said opening and further extends laterally upward along sidewalls of said openings.4. The transistor structure as in claim 1 , wherein said first dopant impurity comprises boron.5. The transistor structure as in claim 4 , wherein said upper portion of SiGe comprises an intermediate portion of SiGe including a lower boron concentration and a top portion of SiGe including a higher boron concentration.6. The transistor structure as in claim 5 , wherein said lower portion of SiGe includes a thickness of about 50-150 angstroms claim 5 , said transistor structure is a PMOS transistor structure and said ...

Die-to-Die Gap Control for Semiconductor Structure and Method

An embodiment is a structure comprising a substrate, a first die, and a second die. The substrate has a first surface and a second surface opposite the first surface. The substrate has a through substrate via extending from the first surface towards the second surface. The first die is attached to the substrate, and the first die is coupled to the first surface of the substrate. The second die is attached to the substrate, and the second die is coupled to the first surface of the substrate. A first distance is between a first edge of the first die and a first edge of the second die, and the first distance is in a direction parallel to the first surface of the substrate. The first distance is equal to or less than 200 micrometers. 1. A structure comprising:a substrate having a first surface and a second surface opposite the first surface, the substrate having a through substrate via extending from the first surface towards the second surface;a first die attached to the substrate, the first die being coupled to the first surface of the substrate; anda second die attached to the substrate, the second die being coupled to the first surface of the substrate, a first distance being between a first edge of the first die and a first edge of the second die, the first distance being in a direction parallel to the first surface of the substrate, the first distance being equal to or less than 200 micrometers.2. The structure of further comprising a third die attached to the substrate claim 1 , the third die being coupled to the first surface of the substrate claim 1 , a second distance being between a second edge of the second die and a first edge of the third die claim 1 , the second distance being in a direction parallel to the first surface of the substrate claim 1 , a sum of the first distance and the second distance being equal to or less than 250 micrometers.3. The structure of claim 2 , wherein each of the first distance and the second distance is equal to or less than ...

BICYCLIC HETEROARLY ANALOGUES AS GPR119 MODULATORS

Novel compounds of structure Formula I: or an enantiomer, diastereomer, tautomer, prodrug or salt thereof, wherein A, D, Di, E, J, L, n, Q, Rand Rare defined herein, are provided which are GPR119 G protein-coupled receptor modulators. GPR119 G protein-coupled receptor modulators are useful in treating, preventing, or slowing the progression of diseases requiring GPR119 G protein-coupled receptor modulator therapy. Thus, the disclosure also concerns compositions comprising these novel compounds and methods of treating diseases or conditions related to the activity of the GPR119 G protein-coupled receptor by using any of these novel compounds or a composition comprising any of such novel compounds. 12. A pharmaceutical composition comprised of a therapeutically effective amount of a compound claim 1 , enantiomer claim 1 , diastereomer claim 1 , tautomer or salt thereof claim 1 , of claim 1 , and a pharmaceutically acceptable carrier.13. The pharmaceutical composition of claim 12 , further comprising a therapeutically effective amount of one or more other therapeutically active agents.14. A method of modulating the activity of the GPR119 G protein-coupled receptor comprising administering to a mammalian patient in need thereof a therapeutically effective amount of at least one compound claim 1 , enantiomer claim 1 , diastereomer claim 1 , tautomer or salt thereof claim 1 , of claim 1 , and optionally an additional therapeutic agent.15. A method for preventing claim 1 , inhibiting claim 1 , or treating the progression or onset of diseases or disorders associated with the activity of the GPR119 G protein-coupled receptor comprising administering to a mammalian patient in need of prevention claim 1 , inhibition claim 1 , or treatment a therapeutically effective amount of at least one compound claim 1 , enantiomer claim 1 , diastereomer claim 1 , tautomer or salt thereof claim 1 , of claim 1 , and optionally an additional therapeutic agent wherein:(a) the diseases or ...

METAL GATE STACK HAVING TIALN BLOCKING/WETTING LAYER

A metal gate stack having a TiAlN blocking/wetting layer, and methods of manufacturing the same, are disclosed. In an example, an integrated circuit device includes a semiconductor substrate and a gate stack disposed over the semiconductor substrate. The gate stack includes a gate dielectric layer disposed over the semiconductor substrate; a work function layer disposed over the gate dielectric layer; a multi-function wetting/blocking layer disposed over the work function layer, wherein the multi-function wetting/blocking layer is a titanium aluminum nitride layer; and a conductive layer disposed over the multi-function wetting/blocking layer. 1. An integrated circuit device comprising:a semiconductor substrate; and a gate dielectric layer disposed over the semiconductor substrate,', 'a work function layer disposed over the gate dielectric layer,', 'a multi-function wetting/blocking layer disposed over the work function layer, wherein the multi-function wetting/blocking layer is a titanium aluminum nitride layer, and', 'a conductive layer disposed over the multi-function wetting/blocking layer., 'a gate stack disposed over the semiconductor substrate, wherein the gate stack includes2. The integrated circuit device of wherein the gate dielectric layer includes a high-k dielectric layer.3. The integrated circuit device of wherein the gate dielectric layer includes an interfacial dielectric layer disposed between the high-k dielectric layer and the semiconductor substrate.4. The integrated circuit device of wherein the titanium aluminum nitride layer has a nitrogen atomic concentration that prevents metal impurities from penetrating the gate dielectric layer.5. The integrated circuit device of wherein the nitrogen atomic concentration is about 10% to about 50%.6. The integrated circuit device of wherein the conductive layer is an aluminum layer.7. The integrated circuit device of wherein the titanium aluminum nitride layer has a ratio of titanium claim 6 , aluminum ...

SEMICONDUCTOR MANUFACTURING APPARATUS AND METHOD OF MANUFACTURING SEMICONDUCTOR DEVICE

A semiconductor manufacturing apparatus includes at least one inner retaining ring, and an outer retaining ring. The at least one inner retaining ring applies a first pressure to the polishing pad, and retains a substrate on the polishing pad. The outer retaining ring applies a second pressure to the polishing pad, and retains the at least one inner retaining ring on the polishing pad. Control of the first pressure is independent with respect to control of the second pressure. 1. A semiconductor manufacturing apparatus , comprising:at least one inner retaining ring for applying a first pressure to a polishing pad, the at least one inner retaining ring having an innermost circumferential surface for retaining a substrate on the polishing pad; andan outer retaining ring for applying a second pressure to the polishing pad, and arranged to retain the at least one inner retaining ring on the polishing pad,wherein control of the first pressure is independent with respect to control of the second pressure.2. The semiconductor manufacturing apparatus of claim 1 , wherein the at least one inner retaining ring includes:a first inner retaining ring for retaining the substrate; anda second inner retaining ring interposed between the first inner retaining ring and the outer retaining ring.3. The semiconductor manufacturing apparatus of claim 2 , whereinthe first inner retaining ring has a bottom surface for applying an independently controlled inside first pressure to the polishing pad, andthe second inner retaining ring has a bottom surface for applying an independently controlled outside first pressure to the polishing pad.4. The semiconductor manufacturing apparatus of claim 1 , further comprising a membrane for applying a third pressure to the substrate against the polishing pad claim 1 , control of the third pressure being independent with respect to control of the first pressure and control of the second pressure.5. A semiconductor manufacturing apparatus claim 1 , ...

Method of Fabricating Indium-111 Radioactive Isotope

The present invention provides a method for fabricating an indium(In)-111 radioactive isotope. A target of cadmium(Cd)-112 is processed through steps of dissolving with heat, absorbing, washing, desorbing and drying for obtaining the In-111 radioactive isotope. Thus, chemical separation is coordinated with the target for fabricating the In-111 radioactive isotope with high efficiency and low cost for production procedure. 1. A method of fabricating an indium(In)-111 radioactive isotope , comprising steps of:(a) obtaining a heating plate in a bromic acid solution with a target having a surface of cadmium(Cd)-112 obtained on said heating plate and adding pressure on said target to be dissolved with heat coordinated with said heating plate to obtain a solution of In-111 and Cd-112;(b) extracting said solution of In-111 and Cd-112 to be put into a tube to process ion exchange to adsorb In-111 in said tube and drain a solution of Cd-112;(c) adding a bromic acid solution into said tube to wash out In-111 with a waste liquid drained;(d) adding a bromic acid solution into said tube to desorb In-111 with said bromic acid solution drained together to obtain an In-111 semi-product liquid; and(e) drying said In-111 semi-product liquid to obtain a product of In-111 radioactive isotope.2. The method according to claim 1 ,wherein, in step (a), said bromic acid solution, said heating plate and said target are obtained in a container and a pressing unit is used to add pressure to said target.3. The method according to claim 1 ,wherein, in step (a), said bromic acid solution has a mole concentration of 8N.4. The method according to claim 1 ,wherein said tube is a resin column.5. The method according to claim 1 ,wherein, in step (b), said solution of Cd-112 drained after processing ion exchange is held in a recycling tank.6. The method according to claim 1 ,wherein, in step (c), said bromic acid solution added into said tube has a mole concentration of 8N.7. The method according to ...

AUDIO PROCESSING SYSTEM AND ADJUSTING METHOD FOR AUDIO SIGNAL BUFFER

An audio processing system is provided. The audio processing system has a sound receiving device configured to receive sounds and output an audio signal; a controller, electrically connected to the sound receiving unit, configured to write the audio signal to an audio signal buffer with a first frequency; and an audio processing unit, electrically connected to the controller, configured to read the audio signal from the audio signal buffer with a second frequency to perform audio processing, wherein the controller further dynamically adjusts the second frequency, so that the second frequency approaches the first frequency according to a convergence curve. 1. An audio processing system , comprisinga sound receiving device configured to receive sounds and output an audio signal;a controller, electrically connected to the sound receiving unit, and configured to write the audio signal to an audio signal buffer with a first frequency; andan audio processing unit, electrically connected to the controller, and configured to read the audio signal from the audio signal buffer with a second frequency to perform an audio processing,wherein the controller further dynamically adjusts the second frequency, so that the second frequency approaches the first frequency according to a convergence curve.2. The audio processing system as claimed in claim 1 , wherein the controller is coupled to the sound receiving device through a first transmission interface claim 1 , and the audio processing unit is coupled to the controller through a second transmission interface.3. The audio processing system as claimed in claim 2 , wherein the first transmission interface is a USB interface claim 2 , and the second transmission interface is an I2S interface.4. The audio processing system as claimed in claim 1 , wherein the controller further sets a data overrun threshold and a data underrun threshold according to a storage space of the audio signal stored in the audio signal buffer.5. The audio ...

HYBRID HYDROGEL SCAFFOLD COMPOSITIONS AND METHODS OF USE

The present invention includes new hybrid hydrogel scaffolds comprised of a polyoxyethylene-polyoxypropylene (block) copolymer (a “poloxamer”) and a self-assembling peptide, which maintain the mechanical and bioactive properties of its individual constituents (as compared to when the individual constituents are scaffolds or hydrogels by themselves). The hydrogels of the invention can include a combination of materials from different origins or with different properties that provides a hybrid material that meets the multiple needs of a scaffold for tissue engineering. 1. A hybrid hydrogel scaffold , the scaffold comprising:(a) a self-assembling peptide; and(b) a poloxamer;wherein the peptide and poloxamer are present in an amount sufficient for the scaffold to provide a microenvironment that: (i) substantially prevents the aggregation of cells, (ii) promotes cell proliferation at a rate that is improved or substantially similar to a hydrogel scaffold made from the self-assembling peptide alone, and (iii) has viscoelastic properties that are improved or substantially similar to a hydrogel scaffold made from the poloxamer alone.2. The scaffold of claim 1 , wherein the self-assembling peptide is between about 8 to about 24 amino acids in length.3. The scaffold of claim 1 , wherein the self-assembling peptide is between about 8 to about 12 amino acids in length.4. The scaffold of claim 1 , wherein the self-assembling peptide is about 8 amino acids in length.5. The scaffold of claim 4 , wherein the self-assembling peptide is selected from the group consisting of: KFEFKFEF(SEQ ID NO:1); FEFKFEFK (SEQ ID NO:2); RADARADA (SEQ ID NO:3); RARADADA (SEQ ID NO:4); AEAKAEAK (SEQ ID NO:5); RAEARAEA (SEQ ID NO:6); KADAKADA (SEQ ID NO:7); AEAEAHAH (SEQ ID NO:8); LELELKLK (SEQ ID NO:9); AEAEAKAK (SEQ ID NO:10); and HEHEHKHK (SEQ ID NO:11).6. The scaffold of claim 1 , wherein the poloxamer is a block copolymer comprising polyoxypropylene (poly(propylene oxide)) (“PPO”) flanked by two ...

Semiconductor Device and Method of Formation

A system and method for forming a semiconductor device is provided. An embodiment comprises forming a silicide region on a substrate along with a transition region between the silicide region and the substrate. The thickness of the silicide precursor material layer along with the annealing conditions are controlled such that there is a larger ratio of one atomic species within the transition region than another atomic species, thereby increasing the hole mobility within the transition region. 1. A method of forming a semiconductor device , the method comprising:forming a metal layer on a substrate, the metal layer having a thickness between about 10 Å and 500 Å, the substrate comprising a first atomic species and second atomic species, the first atomic species being silicon; andannealing the metal layer and the substrate at a temperature between about 150° C. to 350° C., the annealing the metal layer and the substrate forming a silicide region and a transition region, the transition region being located between the silicide region and a remaining portion of the substrate.2. The method of claim 1 , wherein the annealing the metal layer and the substrate further forms a first region within the transition having a larger ratio of the second atomic species than the first atomic species.3. The method of claim 1 , wherein the second atomic species is germanium.4. The method of claim 1 , wherein the forming the metal layer comprises forming a layer of nickel.5. The method of claim 1 , wherein annealing the metal layer and the substrate forms the transition region to a thickness of between about 2 nm and about 50 nm in thickness.6. The method of claim 1 , further comprising:removing unreacted metal layer after the forming the silicide region and the transition region; andannealing the silicide region.7. The method of claim 1 , wherein the second atomic species is germanium and the forming the metal layer comprises forming a layer of nickel.8. A method of manufacturing a ...

ELECTROSTATIC DISCHARGE PROTECTION CIRCUIT

An electrostatic discharge protection circuit is used in an integrated circuit with a first sub-circuit working with a first working voltage source and a second sub-circuit working with a second working voltage source lower than the first working voltage source. The electrostatic discharge protection circuit includes a first metal-oxide-semiconductor transistor of a first conductive type, having a drain thereof electrically connected to a pad of the integrated circuit, and gate, source and bulk thereof electrically connected to a bulk voltage; and a guard ring of the first conductive type, surrounding the first metal-oxide-semiconductor transistor of the first conductive type and coupled to the second working voltage source. 1. An electrostatic discharge protection circuit for use in an integrated circuit , the integrated circuit including a first sub-circuit and a second sub-circuit , wherein the first sub-circuit is coupled to a first working voltage , the second sub-circuit is coupled to a second working voltage , and the second working voltage is lower than the first working voltage , the electrostatic discharge protection circuit comprising:a first metal-oxide-semiconductor transistor of a first conductive type, having a first drain thereof electrically connected to a pad of the integrated circuit, and a first gate, a first source and a first bulk thereof electrically connected to a bulk voltage;a guard ring of the first conductive type, surrounding the first metal-oxide-semiconductor transistor of the first conductive type and coupled to the second working voltage source; anda second metal-oxide-semiconductor transistor of the first conductive type, having a second drain thereof electrically connected to the first working voltage, and a second gate and a second source thereof electrically connected to the pad.2. (canceled)3. The electrostatic discharge protection circuit according to claim 2 , wherein each of the first and second metal-oxide-semiconductor ...

PYRIDONE AND PYRIDAZONE ANALOGUES AS GPR119 MODULATORS

Novel compounds of structure Formula I: 5. The compound claim 1 , enantiomer claim 1 , diastereomer claim 1 , or a pharmaceutically acceptable salt thereof claim 1 , of claim 1 , wherein:Z is CH;{'sup': 1', '6, "Ris aryl, arylalkyl or heteroaryl, any of which may be optionally substituted with one or more R's;"}{'sup': 2', '5', '5', '6, "Ris cycloalkyl, aryl, heteroaryl, heterocyclyl, —C(═O)Ror —C(═O)OR, wherein the cycloalkyl, aryl, heteroaryl and heterocyclyl may each be optionally substituted with one or more R's;"}{'sup': 5', '6, "Ris alkyl, aryl, cycloalkyl, heteroaryl or heterocyclyl, each of which may be optionally substituted with one or more R's;"}{'sup': 6', '10', '10', '10', '9', '9', '9', '9', '9', '9', '9', '9', '9', '9', '9', '9', '9', '9', '9', '10', '9', '9', '10', '10', '14', '9', '9', '14', '14', '14', '10', '10', '9a, 'sub': 2', '2', '3', '2', '3', '3', '2', '2', '2', '3', '2', '2', '2', '2', '3', '2, 'R, at each occurrence, is independently selected from alkyl, aryl, cycloalkyl, cycloalkylalkyl, heteroaryl, heteroarylalkyl, heterocyclyl, heterocyclylalkyl, halo, —NH, —CN, —NO, —C(═O)OH, —C(═O)OR, —OCF, —OCHF, —OR, —OH, —SH, —SR, —S(O)H, —P(O)H, —C(═O)NRR, —NRR, —S(O)NRR, —NRS(O)CF, —C(═O)NRS(O)R, —S(O)NRC(═O)OR, —S(O)NRC(═O)NRR, —C(═O)NRS(O)CF, —C(═O)R, —NRC(═O)H, —NRC(═O)R, —OC(═O)R, —C(═NR)NRR, —NHC(═NR)NRR, —S(═O)R, —S(O)Rand ═O, wherein the alkyl, aryl, cycloalkyl, cycloalkylalkyl, heteroaryl, heteroarylalkyl, heterocyclyl and heterocyclylalkyl may each be optionally substituted with 0-5 R;'}{'sup': 8a', '14', '14', '14', '14', '14', '14', '14', '14', '14', '14', '14', '14', '14', '14', '14', '14', '14', '14', '14', '14', '14', '14', '14', '14', '14', '14', '14', '14', '14', '14', '14', '14', '14', '14', '14, 'sub': 2', '2', '3', '2', '3', '3', '2', '2', '2', '3', '2', '2', '2', '2', '3', '2', '2, 'R, at each occurrence, is independently selected from alkyl, haloalkyl, aryl, arylalkyl, cycloalkyl, cycloalkylalkyl, heteroaryl, heteroarylalkyl, ...

Metal Shielding Layer in Backside Illumination Image Sensor Chips and Methods for Forming the Same

A device includes a semiconductor substrate having a front side and a backside. A photo-sensitive device is disposed at a surface of the semiconductor substrate, wherein the photo-sensitive device is configured to receive a light signal from the backside of the semiconductor substrate, and convert the light signal to an electrical signal. An amorphous-like adhesion layer is disposed on the backside of the semiconductor substrate. The amorphous-like adhesion layer includes a compound of nitrogen and a metal. A metal shielding layer is disposed on the backside of the semiconductor substrate and contacting the amorphous-like adhesion layer. 1. A device comprising:a semiconductor substrate having a front side and a backside;a first photo-sensitive device at a surface of the semiconductor substrate, wherein the first photo-sensitive device is configured to receive a light signal from the backside of the semiconductor substrate and convert the light signal to an electrical signal;an amorphous-like adhesion layer on the backside of the semiconductor substrate, wherein the amorphous-like adhesion layer comprises a compound of nitrogen and a metal; anda metal shielding layer on the backside of the semiconductor substrate and contacting the amorphous-like adhesion layer.2. The device of further comprising a second photo-sensitive device claim 1 , wherein the metal shielding layer and the amorphous-like adhesion layer are over and aligned to the first photo-sensitive device claim 1 , and wherein the metal shielding layer and the amorphous-like adhesion layer do not extend to over the second photo-sensitive device.3. The device of claim 1 , wherein the amorphous-like adhesion layer comprises a material selected from the group consisting essentially of tantalum nitride claim 1 , titanium nitride claim 1 , and combinations thereof.4. The device of claim 1 , wherein the metal shielding layer comprises aluminum copper.5. The device of claim 1 , wherein the first photo-sensitive ...

COMMISSIONING OF A BUILDING SERVICE SYSTEM

The invention relates to adjusting at least one of installed building service sensors () of a building service system. A sensor coverage area of at least one sensor () is adjusted based on information on a position of the installed sensor () relative to at least one other sensor (). For example, to determine the position of the sensor () relative to said at least one other sensor (), each sensor () establishes a wireless communication between said sensor () and at least one other sensor () via a wireless communication means () of the sensor (). For example, information on the positions of the installed sensors () is used to assign to each sensor () at least one of installed building service supply devices () of the system. 1. Method of adjusting at least one sensor of installed building service sensors of a building service system , the method comprising the step of:automatically adjusting a sensor coverage area of said at least one sensor, the adjusting of the sensor coverage area of each of said at least one sensor being based on information on a position of the installed sensor relative to at least one other sensor of the installed building service sensors.2. Method as claimed in claim 1 , wherein the system further comprises at least one installed building service supply device claim 1 , the method further comprising the step of:using information on the position of said at least one sensor to assign to each of said at least one sensor at least one of the at least one installed building service supply device.3. Method as claimed in claim 2 , wherein the at least one installed building service supply device is selected from the group consisting of one or more of luminaires claim 2 , heating units claim 2 , ventilation units and air conditioning units.4. Method as claimed in claim 1 , wherein in the step of automatically adjusting a sensor coverage area of said at least one sensor claim 1 , the sensor coverage area of each sensor of said at least one sensor is ...

BSI Image Sensor Chips and Methods for Forming the Same

A device includes semiconductor substrate having a front side and a backside. A polysilicon layer is disposed on the backside of the semiconductor substrate. The polysilicon layer includes a portion doped with a p-type impurity. A dielectric layer is disposed on the backside of the semiconductor substrate, wherein the polysilicon layer is between the semiconductor substrate and the polysilicon layer. 1. A device comprising:a semiconductor substrate comprising a front side and a backside;a polysilicon layer on the backside of the semiconductor substrate, wherein the polysilicon layer comprises a portion doped with a p-type impurity; anda dielectric layer on the backside of the semiconductor substrate, wherein the polysilicon layer is between the semiconductor substrate and the polysilicon layer.2. The device of further comprising a first image sensor disposed on the front side of the semiconductor substrate.3. The device of further comprising:a second image sensor disposed on the front side of the semiconductor substrate; anda metal shielding layer over and aligned to the first image sensor, wherein the second image sensor is not aligned to the metal shielding layer, and wherein the polysilicon layer is between the metal shielding layer and the semiconductor substrate, and is aligned to the first image sensor and the second image sensor.4. The device of further comprising an oxide layer between and contacting a back surface of the semiconductor substrate and the polysilicon layer claim 1 , wherein the oxide layer comprises an oxide of the material of the semiconductor substrate.5. The device of claim 1 , wherein the polysilicon layer is in physical contact with the semiconductor substrate.6. The device of claim 1 , where the polysilicon layer comprises:a bottom layer;a middle layer; andan upper layer, wherein the middle layer is between the bottom layer and the upper layer, wherein the middle layer has a first concentration of the p-type impurity, and wherein second ...

Die Structure and Method of Fabrication Thereof

A die having a ledge along a sidewall, and a method of forming the die, is provided. A method of packaging the die is also provided. A substrate, such as a processed wafer, is diced by forming a first notch having a first width, and then forming a second notch within the first notch such that the second notch has a second width less than the first width. The second notch extends through the substrate, thereby dicing the substrate. The difference in widths between the first width and the second width results in a ledge along the sidewalls of the dice. The dice may be placed on a substrate, e.g., an interposer, and underfill placed between the dice and the substrate. The ledge prevents or reduces the distance the underfill is drawn up between adjacent dice. A molding compound may be formed over the substrate. 1. A method comprising:providing a substrate;forming a first notch between a first region and a second region, the first notch having a first width;forming a second notch within the first notch, the second notch having a second width less than the first width, thereby forming a ledge, the second notch extending through the substrate, thereby dicing the substrate into separate dice;placing one or more of the dice onto a second substrate such that the ledge is opposite the second substrate; andplacing an underfill between the one or more of the dice and the second substrate, an upper surface of the underfill being at the ledge.2. The method of claim 1 , further comprising placing the substrate on a carrier tape prior to forming the second notch.3. The method of claim 2 , wherein the substrate is attached to the carrier tape via conductive bumps.4. (canceled)5. The method of claim 1 , wherein the second substrate comprises an interposer.6. The method of claim 1 , further comprising forming a molding compound over the underfill between adjacent dice.7. The method of claim 6 , further comprising thinning the molding compound.8. The method of claim 1 , wherein the ...

LITHIUM-ION SECONDARY BATTERY AND THE CATHODE MATERIAL THEREOF

The present invention relates to the field of lithium-ion battery, and particularly to high-capacity cathode material, and high-energy density lithium-ion secondary battery prepared using the same. The cathode material comprises cathode active material, a binder and a conductive agent, in which the cathode active material is a compound material of lithium cobalt oxide-based active material A and nickel-based active material B pretreated before being mixed, and the mass ratio B/A of the lithium cobalt oxide-based active material A and nickel-based active material B is between 0.82 and 9. The present invention can produce a battery having both larger capacity and higher energy density, and address the problem of gas generation in the battery at high temperature. 1. A cathode material for lithium-ion secondary battery , comprising cathode active material , a binder , and a conductive agent , wherein the cathode active material is a compound material of{'sub': x', 'y', '(1-y)', '2, 'lithium cobalt oxide-based active material A, having a formula of LiCoMaO, where 0.45≦x≦1.2, 0.8≦y≦1, Ma is one or more of Al, Mn, Fe, Mg, Si, Ti, Zn, Mo, V, Sr, Sn, Sb, W, Ta, Nb, Ge and Ba; and'}{'sub': x1', 'a', 'b', '(1-a-b)', '2, 'nickel-based active material B, having a formula of LiNiCoMbO, wherein 0.45≦x1≦1.2, 0.7≦a≦0.9, 0.08≦b≦0.3, 0.78≦a+b≦1, Mb is one ore more of Al, Mn, Mg, Fe, Ti, Zn, Mo, V, Sr, Sn, Sb, W, Ta, Nb, Ge and Ba,'}characterized in that the nickel-based active material B is pretreated before being mixed with the lithium cobalt oxide-based active material A, and the mass ratio B/A of the lithium cobalt oxide-based active material A and the nickel-based active material B is between 0.82 and 9.2. The cathode material for lithium-ion secondary battery according to claim 1 , wherein the nickel-based active material B is pretreated by being surface coating with an oxide layer of M on its surface claim 1 , M being any of Mg claim 1 , Al claim 1 , Zr claim 1 , Zn claim 1 , Ti ...

Method and System for Adjusting Spacing Between Characters

A method for adjusting spacing between characters comprises determining a character pair from a font kit. The character pair comprises two characters and has a spacing value. The method further comprises acquiring glyph outline data of the character pair, plotting the glyph outline data of the character pair, displaying the character pair on an interface, adjusting the spacing value from a first spacing value to a second spacing value, and changing, while adjusting the spacing value, a spacing between the two characters displayed on the interface along with a change of the spacing value. 1. A method for adjusting spacing between characters , comprising:determining a character pair from a font kit, the character pair comprising two characters and having a spacing value;acquiring glyph outline data of the character pair;plotting the glyph outline data of the character pair, and displaying the character pair on an interface;adjusting the spacing value from a first spacing value to a second spacing value; andchanging, while adjusting the spacing value, a spacing between the two characters displayed on the interface.2. The method according to claim 1 , wherein adjusting the spacing value from the first spacing value to the second spacing value includes:determining whether the second spacing value satisfies preset criteria,if yes, saving the second spacing value; and adjusting the spacing value until an N-th spacing value that satisfies the preset criteria is obtained, and', 'saving the N-th spacing value, N being an integer larger than 2., 'if no,'}3. The method according to claim 2 , wherein adjusting the spacing value until the N-th spacing value that satisfies the preset criteria is obtained includes:adjusting the spacing value by a positive number or a negative number;adjusting positions of the two characters in the character pair according to the adjusted spacing value;plotting the glyph outline data of the character pair by drawing according to the adjusted spacing ...

SENSING PRODUCT AND METHOD OF MAKING

This description relates to a sensing product formed using a substrate with a plurality of epi-layers. At least a first epi-layer has a different composition than the composition of a second epi-layer. The sensing product optionally includes at least one radiation sensing element in the second epi-layer and optionally an interconnect structure over the second epi-layer. The sensing product is formed by removing the substrate and all epi-layers other than the second epi-layer. A light incident surface of the second epi-layer has a total thickness variation of less than about 0.15 μm. 1. An apparatus comprising:a substrate;a first epi-layer over the substrate; anda second epi-layer over the substrate, wherein the second epi-layer has a different composition than the composition of the first epi-layer.2. The apparatus of claim 1 , further comprising:at least one radiation sensing element in the second epi-layer; andan interconnect layer over the second epi-layer and configured to electrically connect to the at least one radiation sensing element.3. The apparatus of claim 1 , wherein the second epi-layer has a total thickness variation less than about 0.15 μm.4. The apparatus of claim 3 , further comprising at least one intervening epi-layer between the first epi-layer and the substrate.5. The apparatus of claim 1 , further comprising at least one intervening epi-layer between the first epi-layer and the substrate.6. The apparatus of claim 1 , wherein the first epi-layer and the second epi-layer independently have a thickness less than 5.0 μm.7. The apparatus of claim 1 , wherein the second epi-layer has a thickness ranging from about 1.0 μm to about 2.2 μm.8. The apparatus of claim 1 , wherein the first epi-layer comprises positive doped silicon claim 1 , and the second epi-layer comprises negative doped silicon.9. A method of making a semiconductor device comprising: a substrate,', 'a first epi-layer over the substrate, and', 'a second epi-layer over the substrate, ...

METHODS AND APPARATUS FOR FACILITATING CHANNEL ACCESS IN A COMMUNICATION SYSTEM

A transmission initiation interval timing structure is used in combination with a lower layer timing structure, e.g., physical layer timing structure. A device selects a subset of packet transmission initiation intervals and then limits initiation of packet transmission to those intervals thereby reducing the potential for collisions. Packet transmission may occur outside the initiation interval in which the transmission is initiated. In some embodiments, packet transmission length is intentionally limited to sizes which can be transmitted in a fraction of the amount of time the physical layer allows a single device to continuously transmit, e.g., in an amount of time which is equal to or less than the duration of a packet transmission initiation interval. This increases the probability that multiple devices will be able to successfully transmit small packets at short intervals on a regular basis even when carrier sensing techniques are used. 1. A method of operating a communications device to transmit packets , the method comprising:storing information defining a plurality of transmission initiation intervals, said transmission initiation intervals corresponding to a recurring broadcast interval including multiple packet transmission opportunities;monitoring for use of transmission resources during at least a portion of said recurring broadcast interval;selecting a subset of transmission initiation intervals corresponding to a portion of said recurring broadcast interval as a function of signals detected on said transmission resources during said monitoring; andrestricting initiation of packet transmission to transmission initiation intervals associated with said communications device, initiation of packet transmission triggering an attempt to transmit a packet, said attempt to transmit including a channel sensing operation.2. The method of claim 1 , wherein said recurring broadcast interval is a recurring time period in a timing structure used to control wireless ...

IMAGE SENSOR AND METHOD OF MANUFACTURING

An image sensor includes a substrate having opposite first and second sides, a multilayer structure on the first side of the substrate, and a photo-sensitive element on the second side of the substrate. The photo-sensitive element is configured to receive light that is incident upon the first side and transmitted through the multilayer structure and the substrate. The multilayer structure includes first and second light transmitting layers. The first light transmitting layer is sandwiched between the substrate and the second light transmitting layer. The first light transmitting layer has a refractive index that is from 60% to 90% of a refractive index of the substrate. The second light transmitting layer has a refractive index that is lower than the refractive index of the first light transmitting layer and is from 40% to 70% of the refractive index of the substrate. 1. An image sensor , comprising:a substrate having opposite first and second sides;a multilayer structure on the first side of the substrate; anda photo-sensitive element on the second side of the substrate, the photo-sensitive element configured to receive light that is incident upon the first side and transmitted through the multilayer structure and the substrate;whereinthe multilayer structure comprises first and second light transmitting layers,the first light transmitting layer is sandwiched between the substrate and the second light transmitting layer,the first light transmitting layer has a refractive index that is from 60% to 90% of a refractive index of the substrate, andthe second light transmitting layer has a refractive index that is lower than the refractive index of the first light transmitting layer and is from 40% to 70% of the refractive index of the substrate.2. The image sensor of claim 1 , wherein the refractive index of the second light transmitting layer is from 1.9 to 2.4.3. The image sensor of claim 2 , whereinthe refractive index of the first light transmitting layer is from 2. ...

Hepatitis C Virus Inhibitors

The present disclosure is generally directed to antiviral compounds, and more specifically directed to combinations of compounds which can inhibit the function of the NS5A protein encoded by Hepatitis C virus (HCV), compositions comprising such combinations, and methods for inhibiting the function of the NS5A protein. 1. A combination comprising an NS5A-targeting compound and an NS5A synergist , which , when administered , provides synergistic anti-HCV activity against variants that contain mutation(s) conferring resistance to the NS5A-targeting compound alone.2. The combination of which comprises two or more pharmaceutically acceptable carriers.3. The combination of wherein the NS5A-targeting compound and the NS5A synergist are combined in the same pharmaceutically acceptable carrier.19. A composition comprising a combination of claim 1 , or a pharmaceutically acceptable salt thereof claim 1 , and a pharmaceutically acceptable carrier.20. The composition of further comprising one or two additional compounds having anti-HCV activity.21. The composition of wherein at least one of the additional compounds is an interferon or a ribavirin.22. The composition of wherein the interferon is selected from interferon alpha 2B claim 21 , pegylated interferon alpha claim 21 , pegylated interferon lambda claim 21 , consensus interferon claim 21 , interferon alpha 2A claim 21 , and lymphoblastoid interferon tau.23. The composition of wherein at least one of the additional compounds is effective to inhibit the function of a target selected from HCV protease claim 20 , HCV polymerase claim 20 , HCV helicase claim 20 , HCV NS4B protein claim 20 , HCV entry claim 20 , HCV assembly claim 20 , HCV egress claim 20 , HCV NS5A protein claim 20 , and IMPDH for the treatment of an HCV infection.24. A method of treating an HCV infection in a patient claim 1 , comprising administering to the patient a therapeutically effective amount of a combination of claim 1 , or a pharmaceutically ...

Sawing Underfill in Packaging Processes

A method includes bonding a first and a second package component on a top surface of a third package component, and dispensing a polymer. The polymer includes a first portion in a space between the first and the third package components, a second portion in a space between the second and the third package components, and a third portion in a gap between the first and the second package components. A curing step is then performed on the polymer. After the curing step, the third portion of the polymer is sawed to form a trench between the first and the second package components. 1. A method comprising:bonding a first and a second package component on a top surface of a third package component; a first portion in a space between the first and the third package components;', 'a second portion in a space between the second and the third package components; and', 'a third portion in a gap between the first and the second package components;, 'dispensing a first polymer, wherein the first polymer comprisesperforming a curing on the first polymer; andafter the curing, sawing the third portion of the first polymer to form a trench between the first and the second package components, wherein at a time the step of sawing is performed.2. The method of claim 1 , wherein the curing is a partial curing claim 1 , and wherein the method further comprises claim 1 , after the step of sawing the third portion of the first polymer claim 1 , performing a thermal step to fully cure the first polymer.3. The method of claim 1 , wherein after the step of curing claim 1 , the first polymer is fully cured.4. The method of further comprising claim 1 , after the step of sawing claim 1 , molding the first claim 1 , the second claim 1 , and the third package components with a second polymer claim 1 , wherein the second polymer is filled into the trench.5. The method of further comprising claim 4 , after the step of molding with the second polymer claim 4 , performing a die-saw on the third package ...

DISAGGREGATION APPARATUS FOR IDENTIFYING AN APPLIANCE IN AN ELECTRICAL NETWORK

The invention relates to a disaggregation apparatus for identifying an appliance in an electrical network () comprising multiple appliances (). A voltage meter () measures a first change in a mains voltage (V) delivered to the appliances of the electrical network, while an operational state of an appliance is modified, and a second change in the mains voltage, while a switchable load is switched. An appliance determination unit () determines the appliance, of which the operational state has been changed, based on the measured first change in the mains voltage, the measured second change in the mains voltage and the resistance of the switchable load. Thus, an appliance can be determined without detecting switching flickers in very short time durations, i.e. high sampling rates and continuous monitoring are not necessarily required. This reduces the technical efforts of the disaggregation apparatus for performing the disaggregation function. 1. A disaggregation apparatus for identifying an appliance in an electrical network , which comprises multiple appliances and which is powered by a power source , the disaggregation apparatus comprising;a voltage meter for measuring a first change in a mains voltage (V) delivered to the appliances of the electrical network, while an operational state of an appliance is modified,a controller for switching a switchable load, wherein the voltage meter is adapted to measure a second change in the mains voltage (V) delivered to the appliances of the electrical network, while the switchable load is switched,an appliance determination unit for determining a characteristic of the appliance, of which the operational state has been changed, based on the measured first change in the mains voltage (V), the measured second change in the mains voltage (V) and the resistance (R) of the switchable load and for determine the appliance by comparing the determined characteristic with characteristics stored in a memory,{'b': 0', '0, 'wherein the ...

Methods and Apparatus for an Improved Reflectivity Optical Grid for Image Sensors

An improved reflectivity optical grid for image sensors. In an embodiment, a backside illuminated CIS device includes a semiconductor substrate having a pixel array area comprising a plurality of photosensors formed on a front side surface of the semiconductor substrate, each of the photosensors forming a pixel in the pixel array area; an optical grid material disposed over a backside surface of the semiconductor substrate, the optical grid material patterned to form an optical grid that bounds each of the pixels in the pixel array area and extending above the semiconductor substrate, the optical grid having sidewalls and a top portion; and a highly reflective coating formed over the optical grid, comprising a pure metal coating of a metal that is at least 99% pure, and a high-k dielectric coating over the pure metal coating that has a refractive index of greater than about 2.0. Methods are also disclosed. 1. A method , comprising:forming a layer of material over a pixel array area over the backside of a semiconductor substrate;patterning the layer of material using a photolithographic process to form an optical grid, the optical grid lying over the pixel array area and bounding a pixel sensor in each section of the pixel array area;depositing a pure metal coating over the optical grid, the pure metal coating comprising a metal that is at least 99% pure;depositing a dielectric layer having a refractive index of greater than about 2.0 over the pure metal coating;patterning the pure metal coating and the dielectric layer to form a reflective coating over a top and over sidewalls of each portion of the optical grid; anddepositing a passivation layer over the optical grid, the passivation layer having a refractive index of less than about 2.0.2. The method of claim 1 , wherein the pure metal is one selected from the group consisting essentially of copper and aluminum.3. The method of claim 1 , wherein forming a layer of material comprises depositing a conductor.4. The ...

Apparatus and Method for Reducing Dark Current in Image Sensors

A method for reducing dark current in image sensors comprises providing a backside illuminated image sensor wafer, depositing a first passivation layer on a backside of the backside illuminated image sensor wafer, depositing a plasma enhanced passivation layer on the first passivation layer and depositing a second passivation layer on the plasma enhanced passivation layer. 1. A method comprising:providing a backside illuminated image sensor wafer;depositing a first passivation layer on a backside of the backside illuminated image sensor wafer;depositing a first plasma enhanced passivation layer on the first passivation layer;depositing a second plasma enhanced passivation layer on the first plasma enhanced passivation layer; anddepositing a second passivation layer on the second plasma enhanced passivation layer.2. The method of claim 1 , further comprising:growing an epitaxial layer in the backside illuminated image sensor wafer, wherein a photodiode is embedded in the epitaxial layer;forming an isolation region in the epitaxial layer, wherein the isolation region encloses the photodiode;forming a dielectric layer over a front side of the backside illuminated image sensor wafer; andforming a metal interconnect layer over the dielectric layer.3. The method of claim 2 , wherein the photodiode comprises:an n-type photo diode region; anda p-type photo diode region.4. The method of claim 1 , wherein the first passivation layer is formed of silicon dioxide.5. The method of claim 1 , wherein:the first plasma enhanced passivation layer comprises silicon nitride; andthe second plasma enhanced passivation layer comprises silicon nitride.6. The method of claim 1 , further comprising:forming a p+ layer on the second passivation layer; andapplying a laser annealing process to the p+ layer.7. The method of claim 1 , wherein:a thickness of the first plasma enhanced passivation layer is in a range from about 1000 Å to about 10000 Å; anda thickness of the second plasma enhanced ...

CATALYST CARRIER FOR OLEFIN POLYMERIZATION, SOLID CATALYST COMPONENT AND CATALYST

The invention relates to a dialkoxyl magnesium carrier, which is a product produced by a reflux reaction of magnesium, an alcohol and mixed halogenated agents under an inert atmosphere. The mixed halogenated agents are iodine and magnesium chloride, and the weight ratio between iodine and magnesium chloride is 0.05:1-1:0.01. The dialkoxyl magnesium carrier is spheroid with uniform particle size distribution, excellent particle morphology and high bulk density. A solid catalyst component and a catalyst based on this carrier for olefin polymerization are also provided, and olefin polymers having a wide molecular weight distribution, good stereoregularity, excellent particle morphology and a low content of fine powders can be obtained. 129-. (canceled)32. The solid catalyst component according to claim 30 , wherein said electron donor compounds comprise at least one of C-Calkyl esters of saturated aliphatic carboxylic acids claim 30 , C-Calkyl esters of aromatic carboxylic acids claim 30 , C-Caliphatic ethers claim 30 , C-Ccycloethers claim 30 , and C-Csaturated aliphatic ketones.33. The solid catalyst component according to claim 30 , wherein the weight ratio of said iodine to magnesium is 0.05:1 to 1:0.01 claim 30 ,preferably, the weight ratio of iodine to magnesium is 0.1:1 to 1:0.02.34. The solid catalyst component according to claim 30 , wherein said mixed alcohols comprise ethanol and at least one selected from C-Calcohols claim 30 ,{'sub': 6', '8, 'preferably said mixed alcohols comprise ethanol and at least one selected from C-Calcohols,'}more preferably, said mixed alcohols is ethanol and 2-ethyl hexanol, and in said carrier, the content of ethoxy magnesium is equal to or higher than 80 wt %, and the content of 2-ethyl hexyloxy magnesium is 0.01 to 20 wt %.35. The solid catalyst component according to claim 30 , wherein said mixed alcohols comprise ethanol and at least one selected from C-Clower alcohols claim 30 , said lower alcohol containing no ethanol ...

MOBILE DEVICE AND MANUFACTURING METHOD THEREOF

A mobile device includes a substrate, a ground element, and a radiation branch. The ground element includes a ground branch, wherein an edge of the ground element has a notch extending into the interior of the ground element so as to form a slot region, and the ground branch partially surrounds the slot region. The radiation branch is substantially inside the slot region, and is coupled to the ground branch of the ground element. The ground branch and the radiation branch form an antenna structure. 1. A mobile device , comprising:a substrate;a ground element, comprising a ground branch, wherein an edge of the ground element has a notch extending into an interior of the ground element to form a slot region, and the ground branch partially surrounds the slot region; anda radiating branch, disposed inside the slot region, and coupled to the ground branch of the ground element,wherein the ground branch and the radiating branch form an antenna structure.2. The mobile device as claimed in claim 1 , wherein the ground element is a conductive housing of the mobile device claim 1 , and the substrate and the radiating branch are disposed in the conductive housing.3. The mobile device as claimed in claim 1 , wherein a length of the slot region is greater than a length of the notch.4. The mobile device as claimed in claim 1 , wherein a length of the notch is smaller than 2 mm.5. The mobile device as claimed in claim 1 , wherein the slot region substantially has a rectangular shape.6. The mobile device as claimed in claim 1 , wherein a length of the radiating branch is greater than a length of the ground branch.7. The mobile device as claimed in claim 1 , wherein the radiating branch substantially has a C-shape.8. The mobile device as claimed in claim 1 , wherein the ground branch of the ground element substantially has an L-shape.9. The mobile device as claimed in claim 1 , further comprising:a power button, close to the ground branch;an FPCB (Flexible Printed Circuit Board); ...

WAFER THINNING APPARATUS HAVING FEEDBACK CONTROL AND METHOD OF USING

A wafer thinning apparatus includes a first metrology tool configured to measure an initial thickness of the wafer. The wafer thinning apparatus further includes a controller connected to the first metrology tool, and configured to determine a polishing time based on the initial thickness, a predetermined thickness and a material removal rate. The wafer thinning apparatus further includes a polishing tool connected to the controller configured to polish the wafer for a period of time equal to the polishing time. The wafer thinning apparatus includes a second metrology tool connected to the controller and the polishing tool, and configured to measure a polished thickness. The controller is configured to update the material removal rate based on the polished thickness, the predetermined thickness and the polishing time. 1. An apparatus for thinning a wafer comprising:a first metrology tool configured to measure an initial thickness of the wafer;a controller connected to the first metrology tool and configured to calculate a polishing time based on a material removal rate, a predetermined thickness stored in a memory and the initial thickness of the wafer;a polishing tool connected to the controller and configured to polish the wafer for a first duration equal to the polishing time; anda second metrology tool connected to the controller and configured to measure a polished thickness,wherein the controller is configured for receiving the initial thickness from the first metrology tool and the polished thickness from the second metrology tool and to update the material removal rate based on the predetermined thickness, the polishing time and the polished thickness.2. The apparatus of claim 1 , wherein the controller is configured to connect to at least two polishing tools claim 1 , andthe controller is configured to independently update a material removal rate for each of the at least two polishing tools.3. The apparatus of claim 1 , wherein the polishing tool is a ...

MODULAR GRINDING APPARATUSES AND METHODS FOR WAFER THINNING

Methods of thinning a plurality of semiconductor wafers and apparatuses for carrying out the same are disclosed. A grinding module within a set of grinding modules receives and grinds a semiconductor wafer. A polishing module receives the semiconductor wafer from the grinding module and polishes the wafer. The polishing module is configured to polish the semiconductor wafer in less time than the grinding module is configured to grind the corresponding wafer. 1. A method of thinning a set of semiconductor wafers , the method comprising:grinding a semiconductor wafer with a coarse grinding tool at a grinding module amongst a set of grinding modules;grinding the semiconductor wafer with a fine grinding tool at the grinding module;moving the semiconductor wafer to a polishing module, wherein the polishing module receives semiconductor wafers from more than one grinding module in the set of grinding modules; andpolishing the semiconductor wafer at the polishing module, wherein the polishing module processes the semiconductor wafer in less time than the grinding module.2. The method of further comprising:grinding at least one or more additional semiconductor wafers with a coarse grinding tool at a corresponding additional grinding modules amongst the set of grinding modules;grinding the at least one or more additional semiconductor wafers with a fine grinding tool at the corresponding additional grinding module;moving the at least one or more additional semiconductor wafers to the polishing module; andpolishing the at least one or more additional semiconductor wafers at the polishing module.3. The method of further comprising cleaning the semiconductor wafers subsequent to the polishing.4. The method of further comprising returning the semiconductor wafer to a front opening universal pod (FOUP).5. The method of claim 2 , wherein a total time for polishing the semiconductor wafers is less than a total time for grinding the corresponding semiconductor wafers.6. The method ...

STRUCTURE, SYNTHESIS, AND APPLICATIONS FOR POLY (PHENYLENE) ETHYNYLENES (PPEs)

The present disclosure provides novel poly(phenylene ethynylene) (PPE) compounds, methods for synthesizing these compounds, and materials and substances incorporating these compounds. The various PPEs show antibacterial, antiviral and antifungal activity. 2. The poly-(phenylene ethynylene) of wherein A and B=CCH claim 1 , C is not present claim 1 , X claim 1 , Y claim 1 , and Z=H and Z=O(CH)(CHN)CH.3. The poly(phenylene ethynylene) of wherein A and B=CCH claim 1 , C is not present claim 1 , X claim 1 , Y claim 1 , and Z=H and Z=O(CH)SO.4. The poly(phenylene ethynylene) of wherein A and B=CCH claim 1 , C is not present claim 1 , X and Y=H claim 1 , Z=O(CH)N(CH) claim 1 , and Z=(OCHCH)OCH.5. The poly(phenylene ethynylene) of wherein k=6.6. The poly(phenylene ethynylene) of wherein A and B=CCH claim 1 , C is not present claim 1 , X and Y=H claim 1 , Z=O(CH)N(CH) and Z=(OCHCH)OCH.7. The poly(phenylene ethynylene) of wherein A=CCHS claim 1 , B=CCH claim 1 , C is not present claim 1 , X and Y=H claim 1 , Z=O(CH)N(CH) and Z=H.8. The poly(phenylene ethynylene) of wherein A and B=CCH claim 1 , C=CH claim 1 , X=[CCH]COOCHCH claim 1 , Y=COOCHCH claim 1 , Z=O(CH)N(CH) and Z=H.9. The poly(phenylene ethynylene) of wherein A and B=CCH claim 1 , C=CH claim 1 , X=[CCH]COOCHCH claim 1 , Y=COOCHCH claim 1 , Z=O(CH)(CHN)CH and Z=H.10. The poly(phenylene ethynylene) of wherein A=CCHS claim 1 , B=CCH claim 1 , C=CH claim 1 , X=[CCH]COOCHCH claim 1 , Y=COOCHCH claim 1 , Z=O(CH)N(CH) and Z=H.11. The poly(phenylene ethynylene) of wherein k=3.12. The poly(phenylene ethynylene) of wherein the poly(phenylene ethynylene) exhibits biocidal activity.13. The poly(phenylene ethynylene) of wherein the poly(phenylene ethynylene) exhibits antiviral activity.14. The poly(phenylene ethynylene) of wherein the poly(phenylene ethynylene) exhibits antifungal activity.15. The poly(phenylene ethynylene) of functionally attached to a material or substance so that the poly(phenylene ethynylene) can interfere ...

ISOINDOLINE DERIVATIVES, PHARMACEUTICAL COMPOSITIONS CONTAINING THEM, AND THEIR USE IN THERAPY

The present invention relates to isoindoline derivatives of the formula (I) 2. Compound as claimed in claim 1 , wherein R is R—W-A-Q-Y-A-X—.3. Compound as claimed in claim 1 , wherein —Y-A-X— comprises at least 2 claim 1 , 3 or 4 atoms in the main chain.4. Compound as claimed in claim 1 , wherein Ris C-C-alkyl claim 1 , C-C-cycloalkyl-C-C-alkyl claim 1 , C-C-cycloalkyl claim 1 , or optionally substituted C-C-heterocyclyl.5. Compound as claimed in claim 1 , wherein Ais a bond.6. Compound as claimed in claim 1 , wherein W is a bond and Y is a bond claim 1 , or wherein W is a bond and Y is —NR—.7. (canceled)8. Compound as claimed in claim 1 , wherein Xis —O— and Ais C-C-alkylene claim 1 , or Xis C-C-alkylene and Ais a bond.9. Compound as claimed in claim 1 , wherein R—W-A-Q-Y-A-X— is R—S(O)—NR-A-X— or R—S(O)—X—.11. Compound as claimed in claim 1 , wherein Ris hydrogen or halogen.12. (canceled)13. Compound as claimed in claim 1 , wherein Ris hydrogen or C-C-alkyl claim 1 , or two radicals Rtogether with the carbon atom to which they are attached form a carbonyl group.14. Compound as claimed in claim 1 , wherein Ris hydrogen claim 1 , C-C-alkyl claim 1 , C-C-cycloalkyl-C-C-alkyl claim 1 , halogenated C-C-alkyl claim 1 , C-C-cycloalkyl claim 1 , (halogenated C-C-alkyl)carbonyl claim 1 , or C-C-heterocyclyl.15. Compound as claimed in claim 1 , wherein Xis CRRand Xis a bond.16. (canceled)17. Compound as claimed in claim 1 , wherein Ris hydrogen or C-C-alkyl and Ris hydrogen or C-C-alkyl claim 1 , or wherein R claim 1 , Rtogether are optionally substituted C-C-alkylene.18. (canceled)19. (canceled)21. (canceled)22. (canceled)23. Compound as claimed in claim 1 , wherein{'sup': 1', '1', '2', '1, 'R is R—W-A-Q-Y-A-X—;'}{'sup': '1', 'sub': 1', '6', '3', '12', '1', '4', '3', '12', '3', '12, 'Ris C-C-alkyl, C-C-cycloalkyl-C-C-alkyl, C-C-cycloalkyl, or optionally substituted C-C-heterocyclyl;'}W is a bond;{'sup': '1', 'Ais a bond;'}{'sub': '2', 'Q is —S(O)—;'}{'sup': '9', 'Y is —NR— ...

OPERATIONAL STATE DETERMINATION APPARATUS

The invention relates to an operational state determination apparatus () for determining whether a variation in a determined electrical parameter of an electrical network () is caused by a variation in an operational state of an electrical consumer of the electrical network. The electrical network comprises multiple electrical consumers () and a voltage source (), wherein a variation classification unit () determines whether a variation in the determined electrical parameter of the electrical network is caused by a variation in the operational state of an electrical consumer of the network depending on a decision variable which depends on a variation in a measured voltage and a variation in a measured current of the electrical network. This determination can be performed, without directly using the variation in the determined electrical parameter of the electrical network and is therefore less influenced by random voltage fluctuations in the electrical network. 1. An operational state determination apparatus for determining whether a variation in a determined electrical parameter of an electrical network is caused by a variation in an operational state of an electrical consumer of the electrical network , wherein the electrical network comprises multiple electrical consumers and a voltage source , wherein the operational state determination apparatus comprises:a voltage meter for measuring a voltage in the electrical network,a current meter for measuring a current in the electrical network,a decision variable determination unit for determining a decision variable depending on a variation in the measured voltage and a variation in the measured current, wherein the decision variable is indicative of whether a variation in the determined electrical parameter of the electrical network is caused by a variation in the operational state of an electrical consumer,a variation classification unit for determining whether a variation in the determined electrical parameter of ...

METHODS FOR THE ANALYSIS OF HIGH RESOLUTION MELT CURVE DATA

The present application provides for various embodiments of methods for the analysis of high resolution melt (HRM) curve data; where statistical assay variations in melt curve data may result from system noise in an analysis system. Such system noise may arise from various sources, such as the thermal non-uniformity of a thermocycler block in a thermal cycler apparatus, a detection system, etc. Additionally, various methods for the analysis of HRM curve data may provide an identification of a sample without the need for a user inputted information. 1. A method for analyzing melt curve data , the method comprising:providing melt curve data for at least one test sample deposited in a plurality of support regions of a sample support device in thermal cycler system, wherein the melt curve data is an experimental set of melt curve data; andselecting a weighting function, wherein the weighing function selected is used for the construction of a dendrogram of the corrected experimental set of melt curve data;constructing a dendrogram of the corrected experimental set of melt curve data, wherein the dendrogram creates a set of at least one cluster from the corrected experimental set of melt curve data; anddetermining a cut level of the dendrogram, wherein the cut level determines a final number of clusters from the set of at least one cluster.2. The method of claim 1 , wherein the at least one test sample is a plurality of test samples.3. The method of claim 2 , wherein the weighting function utilizes all data points in each of a corrected experimental set of melt curve data for each test sample.4. The method of claim 2 , further comprising:providing melt curve data for a calibration sample deposited in a plurality of support regions of a sample support device in a thermal cycler system, wherein the melt curve data is a calibration set of melt curve data; andcorrecting the experimental set of melt curve data using the calibration set of melt curve data.5. The method of claim ...

WAFER EDGE TRIM BLADE WITH SLOTS

A wafer edge trim blade includes a round blade body and at least one slot formed inward from an outside edge of the round blade body. The at least one slot is configured to remove debris generated during wafer edge trimming using the wafer edge trim blade. 1. A wafer edge trim blade , comprising:a round blade body; andat least one slot formed inward from an outside edge of the round blade body;wherein the at least one slot is configured to remove debris generated during wafer edge trimming using the wafer edge trim blade.2. The wafer edge trim blade of claim 1 , wherein an edge of the at least one slot has a rectangular shape.3. The wafer edge trim blade of claim 1 , wherein the at least one slot is distributed at equal distance around the outside edge of the round blade body.4. The wafer edge trim blade of claim 1 , wherein the at least one slot has a round ending.5. The wafer edge trim blade of claim 4 , wherein the round ending has a length ranging from 0.5 times to 1.5 times of a slot width of the at least one slot.6. The wafer edge trim blade of claim 1 , wherein a number of the at least one slot ranges from 4 to 32.7. The wafer edge trim blade of claim 1 , wherein the at least one slot has a slot width ranging from 0.5 mm to 3 mm.8. The wafer edge trim blade of claim 1 , wherein the at least one slot has a slot depth ranging from 1 mm to 3 mm.9. The wafer edge trim blade of claim 1 , wherein the wafer edge trim blade has a thickness ranging from 1.5 mm to 2.5 mm.10. The wafer edge trim blade of claim 1 , wherein the wafer edge trim blade comprises diamond grit.11. The wafer edge trim blade of claim 10 , wherein the diamond grit have a size ranging from 2 μm to 16 μm.12. The wafer edge trim blade of claim 1 , wherein the wafer edge trim blade has an outer diameter ranging from 47 mm to 53 mm.13. The wafer edge trim blade of claim 1 , wherein the wafer edge trim blade has an inner diameter ranging from 39 to 41 mm.14. A method of trimming an edge of a wafer ...

Method and Apparatus for Backside Illumination Sensor

Methods and apparatus for a backside illuminated (BSI) image sensor device are disclosed. A BSI sensor device is formed on a substrate comprising a photosensitive diode. The substrate may be thinned at the backside, then a B doped Epi-Si(Ge) layer may be formed on the backside surface of the substrate. Additional layers may be formed on the B doped Epi-Si(Ge) layer, such as a metal shield layer, a dielectric layer, a micro-lens, and a color filter. 1. A backside illuminated (BSI) sensor device , comprising:a substrate with a front side surface and a backside surface;a photosensitive diode within the substrate; anda B doped Epi-Si(Ge) layer on the backside surface of the substrate.2. The BSI sensor device of claim 1 , wherein the B doped Epi-Si(Ge) layer is of thickness in a range about 100 to 700 Å.3. The BSI sensor device of claim 1 , further comprising an isolation area within the substrate.4. The BSI sensor device of claim 1 , wherein the photosensitive diode is a pinned layer photodiode comprising a p-n-p junction.5. The BSI sensor device of claim 1 , further comprising a metal shield layer on the B doped Epi-Si(Ge) layer.6. The BSI sensor device of claim 1 , further comprising a dielectric layer on the B doped Epi-Si(Ge) layer.7. The BSI sensor device of claim 1 , further comprising a micro-lens on the B doped Epi-Si(Ge) layer.8. The BSI sensor device of claim 1 , further comprising a color filter on the B doped Epi-Si(Ge) layer.9. The BSI sensor device of claim 1 , further comprising a transistor on the front side surface of the substrate.10. The BSI sensor device of claim 1 , further comprising a passivation layer on the front side surface of the substrate.11. The BSI sensor device of claim 1 , further comprising an inter-layer dielectric (ILD) layer on the front side surface of the substrate.1219.-. (canceled)20. A backside illuminated (BSI) sensor device claim 1 , comprising:a pixel array in a substrate, wherein the substrate comprises a plurality of ...

DEVICE FOR MIXING AND DELIVERING FLUIDS FOR TISSUE REPAIR

A device for mixing and delivering a mixture of fluids to a target site includes a tube for containing the mixture. A compressible auger for mixing the fluids is movably disposed within the tube, one end of the auger being free at the distal end of the tube. A plunger is also movable within the tube in communication with the other end of the auger. When the plunger is moved axially within the tube the auger also moves axially and the auger is compressed to dispense the fluid. The mixing and delivery device can be used with an apparatus for the arthroscopic delivery of a tissue repair material to a repair site. The apparatus includes a first sheath and a second sheath removably attached to the first sheath for delivering the tissue repair material to the repair site. 125-. (canceled)26. A device for mixing and delivering a mixture of fluids to a target site , the device comprising:a tube for containing the mixture, the tube having a proximal and a distal end;a compressible auger for mixing the fluids movably disposed within the tube, one end of the auger being free at the distal end of the tube; anda plunger movable within the tube, a first end of the plunger being in communication with the other end of the auger and a second end of the plunger extending from the proximal end of the tube, wherein when the plunger is moved axially within the tube the auger also moves axially and the auger is compressed.27. The device of claim 26 , wherein the tube has a discharge opening at the distal end through which the mixture is delivered when the plunger is actuated.28. The device of claim 27 , wherein the auger includes an internal discharge passage along its length.29. The device of claim 28 , wherein an outer diameter of the internal discharge passage is less than an inner diameter of the discharge opening.30. The device of claim 26 , wherein the auger is rotatably and axially movable within the tube.31. The device of claim 26 , further comprising a quantity of collagen ...

Methods and Apparatus for Resistive Random Access Memory (RRAM)

Methods and apparatuses for a resistive random access memory (RRAM) device are disclosed. The RRAM device comprises a bottom electrode, a resistive switching layer disposed on the bottom electrode, and a top electrode disposed on the resistive switching layer. The resistive switching layer is made of a composite of a metal, Si, and O. There may be an additional tunnel barrier layer between the top electrode and the bottom electrode. The top electrode and the bottom electrode may comprise multiple sub-layers. 1. A method for fabricating a resistive random access memory (RRAM) , comprising:forming a bottom electrode on a substrate;forming a resistive switching layer on the bottom electrode; andforming a top electrode on the resistive switching layer;wherein the resistive switching layer is made of a composite of a metal, Si, and O.2. The method of claim 1 , wherein forming the resistive switching layer comprises a method selected from a group consisting essentially of oxidation of metal silicide claim 1 , co-deposition of metal and silicon in oxygen ambiance claim 1 , co-deposition of metal oxide and silicon claim 1 , or co-deposition of metal oxide and silicon oxide.3. The method of claim 1 , wherein the metal in the resistive switching layer comprises a material selected from a group consisting essentially of W claim 1 , Ta claim 1 , Ti claim 1 , Ni claim 1 , Co claim 1 , Hf claim 1 , Ru claim 1 , Zr claim 1 , Zn claim 1 , Fe claim 1 , Sn claim 1 , Al claim 1 , Cu claim 1 , Ag claim 1 , Mo claim 1 , Cr claim 1 , or combinations thereof.4. The method of claim 1 , wherein the bottom electrode comprises a material claim 1 , selected from a group consisting essentially of TaN claim 1 , TiN claim 1 , TiAlN claim 1 , TiW claim 1 , Pt claim 1 , W claim 1 , Ru claim 1 , and combinations thereof.5. The method of claim 1 , wherein a thickness of the bottom electrode is between a range about 5-500 nm.6. The method of claim 1 , wherein a thickness of the resistive switching ...

COMPOSITIONS AND METHODS RELATING TO REDUCED MUCOADHESION

The present invention generally relates to reducing the mucoadhesive properties of a particle. In some embodiments, the particle is coated with and/or associated with a (poly(ethylene glycol))-(poly(propylene oxide))-(poly(ethylene glycol)) triblock copolymer. Methods for preparing inventive particles using a poly(ethylene glycol)-vitamin E conjugate as a surfactant are also provided. In some embodiments, methods are provided comprising administering to a subject a composition of particles of the present invention. Such particles with reduced mucoadhesive properties are useful in delivering agents to mucosal tissues such as oral, ophthalmic, gastrointestinal, nasal, respiratory, and genital mucosal tissues. 179-. (canceled)80. A pharmaceutical composition for treating an eye disease or disorder in a patient in need thereof , comprising: [{'sup': '2', 'a biocompatible core and a surface-altering moiety disposed on the core that reduces mucoadhesion of the particle, wherein the surface-altering moiety comprises a (poly(ethylene glycol))-(poly(propylene oxide))-(poly(ethylene glycol)) triblock copolymer, wherein the molecular weight of the (poly(propylene oxide)) block of the triblock copolymer is greater than about 1.8 kDa, and wherein the surface-altering moiety is present on the core at a density of greater than 0.01 surface-altering moieties per nm; and'}, 'a therapeutically effective amount of a bioactive agent., 'a plurality of particles, wherein each of the particles comprises81. A method for treating an eye disease or disorder in a patient in need thereof , comprising:administering to an eye of the patient, a pharmaceutical composition comprising: [{'sup': '2', 'a biocompatible core and a surface-altering moiety disposed on the core that reduces mucoadhesion of the particle, wherein the surface-altering moiety comprises a (poly(ethylene glycol))-(poly(propylene oxide))-(poly(ethylene glycol)) triblock copolymer, wherein the molecular weight of the (poly( ...

ORGANIC ELECTRONIC DEVICE WITH COMPOSITE ELECTRODE

There is provided a composite electrode including either a single layer or a bilayer. The single layer electrode includes an alloy of a first metal having an electrical conductivity greater than 10Scmand a real refractive index less than 2.1 in the range of 380 to 780 nm. The bilayer electrode includes: 111. A composite electrode comprising one of (a) a single layer A and (b) a bilayer , wherein the single layer A comprises an alloy of a first metal having an electrical conductivity greater than 10Scmand a real refractive index less than 2.1 in the range of 380 to 780 nm; and the bilayer comprises:{'b': '1', '(a) layer M having a first thickness and comprising the first metal; and'}{'b': '2', 'sup': 5', '−1, '(b) layer M having a second thickness and consisting of a second metal or an alloy of the second metal, where the second metal has an electrical conductivity less than 10Scm;'}{'b': 1', '2, 'wherein layer M is in physical contact with layer M and the first thickness is greater than the second thickness.'}2. The composite electrode of claim 1 , wherein the first metal is copper claim 1 , silver claim 1 , or gold.31. The composite electrode of claim 1 , wherein A comprises silver/gold claim 1 , silver/gold/copper claim 1 , gold/nickel claim 1 , gold/palladium claim 1 , silver/germanium claim 1 , silver/copper claim 1 , silver/palladium claim 1 , silver/nickel claim 1 , or silver/titanium.412. The composite electrode of claim 1 , wherein layer M has a thickness of 5-50 nm and layer M has a thickness of 0.1-5 nm.52. The composite electrode of claim 1 , wherein the metal of layer M comprises chromium claim 1 , nickel claim 1 , palladium claim 1 , titanium or germanium.62. The composite electrode of claim 1 , further comprising a second layer M having a thickness which is less than the first thickness.73. The composite electrode of claim 1 , further comprising a layer M comprising indium-tin-oxide claim 1 , indium-zinc-oxide claim 1 , aluminum-tin-oxide claim 1 , ...

COMPOSITIONS FOR ELECTRONIC APPLICATIONS

This invention relates to a composition including (a) a dopant, (b) a first host having at least one unit of Formula I, and (c) a second host compound. Formula I has the structure 2. The composition of claim 1 , wherein the first host compound is at least 10% deuterated.3. The composition of claim 1 , wherein Ris a hydrocarbon aryl claim 1 , an N claim 1 ,O claim 1 ,S-heterocycle claim 1 , or a deuterated analog thereof.5. The composition of claim 1 , wherein Ris phenyl claim 1 , substituted phenyl claim 1 , naphthyl claim 1 , substituted naphthyl claim 1 , or a deuterated analog thereof.6. The composition of claim 1 , wherein Ris H or D.9. The composition of claim 7 , wherein Ris phenyl claim 7 , phenyl having a vinyl or allyl substituent claim 7 , biphenyl claim 7 , biphenyl having a vinyl or allyl substituent claim 7 , terphenyl claim 7 , terphenyl having a vinyl or allyl substituent claim 7 , or a deuterated analog thereof.11. The composition of claim 1 , wherein the second host is a triazine claim 1 , an indolocarbazole having an N-heterocycle substituent claim 1 , or a deuterated analog thereof.13. The device of claim 12 , wherein the dopant is a luminescent organometallic complex.14. The device of claim 13 , wherein the organometallic complex is a cyclometalated complex of iridium or platinum.15. The device of claim 12 , wherein the second host is a triazine claim 12 , an indolocarbazole having an N-heterocycle substituent claim 12 , or a deuterated analog thereof.18. The device of claim 12 , wherein the photoactive layer consists essentially of (a) a dopant capable of electroluminescence having an emission maximum between 380 and 750 nm and (b) a host compound having at least one unit of Formula I claim 12 , and (c) a second host compound. This application claims priority under 35 U.S.C. §119(e) from U.S. Provisional Application No. 61/424,955 filed on Dec. 20, 2010, which is incorporated by reference herein in its entirety.1. Field of the DisclosureThis ...

Method Of Making A Golf Ball

The disclosure provides a method of making a golf ball with a reduced gate defect. The method may include using a mold that has a mold cavity with a mold chamber with a surface and a parting edge disposed along the perimeter of mold chamber. At least one gate may be disposed on the parting edge to provide a path for a cover material to be injected into the mold chamber. The gate may include a flat middle surface connected by a first side surface and a second side surface disposed opposite the first side surface. A round having a radius of curvature ranging from about 0.2 mm to about 0.5 mm may be disposed along a middle gate edge of middle surface and/or a side gate edge of one of the first side surface and the second side surface. 1. A method of making a golf ball , comprising:providing a golf ball mold including a first mold cavity and a second mold cavity configured to mate with the first mold cavity, the first mold cavity having a first mold chamber and a first parting edge disposed along the perimeter of first mold chamber, wherein first gate is disposed on the first parting edge, the first gate providing a path for a cover material to be injected into the first mold chamber and having a first edge forming a first round between the first edge and the first mold chamber, forming a golf ball core;placing the golf ball core between the first mold cavity and the second mold cavity;mating the first mold cavity and the second mold cavity together; andinjecting a golf ball cover material into the first mold cavity and the second mold cavity.2. The method of making a golf ball according to claim 1 , wherein the step of injecting a golf ball cover material into the first mold cavity and the second mold cavity includes injecting the golf ball cover material through the gates of the first mold cavity.3. The method of making a golf ball according to claim 1 , wherein the first round includes a radius of curvature ranging from about 0.2 mm to about 0.5 mm.4. The method of ...

METHOD, SYSTEM, AND APPARATUS FOR DETECTING OPTICAL POWER OF PASSIVE OPTICAL NETWORK

The present invention disclose an apparatus for detecting an optical power of a passive optical network, where the apparatus includes: a detecting module is configured to measure an RSSI of a received optical signal; and a controller is configured to output the RSSI function trigger signal to the detecting module, selectively receive, an RSSI measurement result output by an RSSI detection branch, and calculate optical power information of the optical signal according to the RSSI measurement result. 1. An apparatus for detecting an optical power of a passive optical network , comprising:a receiving module, configured to receive an optical signal sent by an optical network unit;a detecting module, configured to measure an Received Signal Strength Indication (RSSI) of the received optical signal in response to a received RSSI function trigger signal, wherein the detecting module comprises a current mirror RSSI detection branch and a logarithmic amplifier RSSI detection branch, and the current mirror RSSI detection branch and the logarithmic amplifier RSSI detection branch are coupled to the receiving module; anda controller, coupled to the detecting module and configured to output the RSSI function trigger signal to the detecting module, selectively receive, according to a selection control signal provided by a selection control signal generating module, an RSSI measurement result output by an RSSI detection branch corresponding to optical strength of the optical signal sent by the optical network unit, and calculate optical power information of the optical signal according to the RSSI measurement result.2. The apparatus for detecting an optical power of a passive optical network according to claim 1 , wherein the selection control signal generating module is coupled to the controller and is configured to generate the selection control signal according to the optical strength of the optical signal claim 1 , and output the selection control signal to the controller ...

Semiconductor Device and Method of Formation

A system and method for forming a semiconductor device is provided. An embodiment comprises forming a silicide region on a substrate along with a transition region between the silicide region and the substrate. The thickness of the silicide precursor material layer along with the annealing conditions are controlled such that there is a larger ratio of one atomic species within the transition region than another atomic species, thereby increasing the hole mobility within the transition region. 1. A semiconductor device comprising:a transition region between a substrate and a silicide;a first atomic species located within the transition region and the substrate, wherein the first atomic species comprises silicon; anda second atomic species located within the transition region and the substrate, wherein the second atomic species is different from the first atomic species and has a ratio within the transition region greater than or equal to the first atomic species and wherein the second atomic species has a ratio within the substrate that is less than the first atomic species.2. The semiconductor device of claim 1 , wherein the second atomic species is germanium.3. The semiconductor device of claim 1 , wherein the transition region further comprises a third atomic species different from the first atomic species and the second atomic species.4. The semiconductor device of claim 3 , wherein the third atomic species comprises nickel.5. The semiconductor device of claim 1 , wherein the transition region has a thickness between about 2 nm and about 50 nm in thickness.6. The semiconductor device of claim 1 , wherein the second atomic species is germanium and the silicide comprises nickel.7. The semiconductor device of claim 1 , wherein the substrate further comprises a source/drain region for a transistor.8. A semiconductor device comprising:a substrate comprising a plurality of first atoms and a plurality of second atoms, wherein the plurality of first atoms has a greater ...

Image Sensor Manufacturing Methods

Semiconductor devices and back side illumination (BSI) sensor manufacturing methods are disclosed. In one embodiment, a method of manufacturing a semiconductor device includes providing a workpiece and forming an integrated circuit on a front side of the workpiece. A grid of a conductive material is formed on a back side of the workpiece using a damascene process. 1. A method of manufacturing a semiconductor device , the method comprising:providing a workpiece, the workpiece having a front side and a back side opposite the front side;forming an integrated circuit on the front side of the workpiece; andforming a grid comprising a conductive material on the back side of the workpiece using a damascene process.2. The method according to claim 1 , wherein forming the grid comprises forming a metal grid.3. The method according to claim 2 , wherein forming the metal grid comprises forming a material selected from the group consisting essentially of W claim 2 , Al claim 2 , Cu claim 2 , and combinations thereof.4. The method according to claim 1 , wherein forming the grid comprises forming a plurality of members of the conductive material that extend lengthwise in an x direction and a y direction in a bottom view of the workpiece.5. The method according to claim 4 , wherein the plurality of members of the conductive material comprise a thickness in the bottom view of about 130 nm to 300 nm.6. The method according to claim 4 , wherein the plurality of members of the conductive material comprise a thickness in a cross-sectional view of about 3 claim 4 ,000 Angstroms or less.7. The method according to claim 1 , wherein forming the grid comprises forming an insulating material over the back side of the workpiece claim 1 , patterning the insulating material with a plurality of patterns claim 1 , and filling the plurality of patterns with a conductive material.8. The method according to claim 7 , wherein the insulating material comprises a first insulating material claim 7 , ...

Oxidation-Free Copper Metallization Process Using In-situ Baking

A method of forming an integrated circuit structure includes providing a substrate; forming a metal feature over the substrate; forming a dielectric layer over the metal feature; and forming an opening in the dielectric layer. At least a portion of the metal feature is exposed through the opening. An oxide layer is accordingly formed on an exposed portion of the metal feature. The method further includes, in a production tool having a vacuum environment, performing a plasma process to remove the oxide layer. Between the step of forming the opening and the oxide-removal process, no additional oxide-removal process is performed to the metal feature outside the production tool. The method further includes, in the production tool, forming a diffusion barrier layer in the opening, and forming a seed layer on the diffusion barrier layer 1. A method of forming an integrated circuit structure , the method comprising:providing a substrate;forming a metal feature over the substrate;forming a dielectric layer over the metal feature;forming an opening in the dielectric layer, wherein at least a portion of the metal feature is exposed through the opening, and wherein an oxide layer is formed on an exposed portion of the metal feature; and performing a remote plasma process to remove oxide from the exposed portion of the metal feature;', 'forming a diffusion barrier layer in the opening; and', 'forming a seed layer on the diffusion barrier layer., 'in a production tool having a vacuum environment2. The method of claim 1 , after performing the remote plasma process claim 1 , releasing moisture trapped in the substrate by performing a degas process using one or more gases that do not react with the metal feature.3. The method of claim 1 , wherein the steps of performing the remote plasma process claim 1 , forming the diffusion barrier layer claim 1 , and forming the seed layer are performed in different chambers of the production tool claim 1 , and wherein when the substrate is ...

STRUCTURE, SYNTHESIS, AND APPLICATIONS FOR OLIGO PHENYLENE ETHYNYLENES (OPEs)

The present disclosure provides novel oligo phenylene ethynylene (OPE) compounds, methods for synthesizing these compounds, and materials and substances incorporating these compounds. The various OPEs show antibacterial, antiviral and anti-fungal activity. 2. The oligo-(phenylene ethynylene) of wherein Z=O(CH)(CHN)CH; A and B=CCH claim 1 , C=CH claim 1 , and X and Y=COOCHCH.3. The oligo-(phenylene ethynylene) of wherein j=3.4. The OP-E oligo-(phenylene ethynylene) of wherein A and B=CCH claim 1 , C=CH claim 1 , and X and Y=O(CH)N(CH).5. The oligo-(phenylene ethynylene) of where k=2.6. The oligo-(phenylene ethynylene) of wherein A and B=CCH claim 1 , C=CH claim 1 , and X and Y=O(CH)SO.7. The oligo-(phenylene ethynylene) of wherein A=CCHS claim 1 , B=CCH claim 1 , C=CH claim 1 , and X and Y=O(CH)N(CH).8. The oligo-(phenylene ethynylene) of wherein A and B=CCH claim 1 , C is not present claim 1 , X=O(CH)N(CH) and Y=CH(OCH).9. The oligo-(phenylene ethynylene) of wherein A and B=CCH claim 1 , C=CH claim 1 , and X and Y=O(CH)(CHN)CH.10. The oligo-(phenylene ethynylene) of wherein A=CCHS claim 1 , B=CCH claim 1 , C=CH claim 1 , and X and Y=O(CH)(CHN)CH.11. The oligo-(phenylene ethynylene) of wherein the oligo-(phenylene ethynylene) exhibits biocidal activity.12. The oligo-(phenylene ethynylene) of wherein the oligo-(phenylene ethynylene) exhibits antiviral activity.13. The oligo-(phenylene ethynylene) of wherein the oligo-(phenylene ethynylene) exhibits antifungal activity.14. The oligo-(phenylene ethynylene) of functionally attached to a material or substance so that the oligo-(phenylene ethynylene) can interfere with the pathogenicity of a pathogen that contacts the oligo-(phenylene ethynylene).15. The oligo-(phenylene ethynylene) of where k=3.16. A material incorporating an oligo-(phenylene ethynylene) of claim 1 , wherein the oligo-(phenylene ethynylene) is grafted thereto by chemisorption or wherein the positively charged polymer attaches to a negatively charged ...

METHODS AND APPARATUS BY WHICH PERIODICALLY BROADCASTING NODES CAN RESOLVE CONTENTION FOR ACCESS TO A SMALLER POOL OF BROADCASTING RESOURCES

A method, a computer program product, and an apparatus for wireless communication are provided. The apparatus transmits broadcast information in a first broadcast resource from a first set of broadcast resources. In addition, the apparatus determines based on the broadcast information a need for a second broadcast resource from a second set of broadcast resources. Furthermore, the apparatus selects the second broadcast resource based on a priority associated with the first broadcast resource. 1. A method of wireless communication , comprising:transmitting broadcast information in a first broadcast resource from a first set of broadcast resources;determining based on the broadcast information a need for a second broadcast resource from a second set of broadcast resources; andselecting the second broadcast resource based on a priority associated with the first broadcast resource.2. The method of claim 1 , further comprising transmitting information in the first broadcast resource indicating the selected second broadcast resource.3. The method of claim 1 , further comprising:receiving a broadcast signal in a third broadcast resource of the first set of broadcast resources, the third broadcast resource having a higher priority than the first broadcast resource; anddetermining a fourth broadcast resource in the second set of broadcast resources based on the broadcast signal in the third broadcast resource.4. The method of claim 3 , wherein the priority of an earlier broadcast resource is higher than the priority of a later broadcast resource.5. The method of claim 3 , wherein the second broadcast resource is selected based on the fourth broadcast resource.6. The method of claim 5 , wherein the second broadcast resource is the next resource following the fourth broadcast resource.7. The method of claim 5 , further comprising:determining that a fifth broadcast resource in the second set of broadcast resources is being utilized based on the determined fourth broadcast ...

Tool Induced Shift Reduction Determination for Overlay Metrology

One embodiment relates to a method for semiconductor workpiece processing. In this method, a baseline tool induced shift (TIS) is measured by performing a baseline number of TIS measurements on a first semiconductor workpiece. After the baseline TIS has been determined, the method determines a subsequent TIS based on a subsequent number of TIS measurements taken on a first subsequent semiconductor workpiece. The subsequent number of TIS measurements is less than the baseline number of TIS measurements. 1. A method for measuring tool induced shift (TIS) , comprising:positioning a semiconductor workpiece so that a field of view (FOV) corresponding to a first alignment mark on the semiconductor workpiece changes its directional orientation from a first angular orientation to a second angular orientation, wherein the first and second angular orientations are measured with respect to a first diametric axis extending through the semiconductor workpiece;viewing the first alignment mark at a plurality of optical angles at both the first angular orientation and the second angular orientation; andmeasuring a first plurality of overlay offsets, respectively, for the plurality of optical angles at the first and second angular orientations for the first alignment mark.2. The method of claim 1 , further comprising:using the first plurality of overlay offsets to determine a first curve or line representing TIS for the first alignment mark as a function of optical angle.3. The method of claim 2 , further comprising:repositioning the semiconductor workpiece so that the FOV corresponds to a second alignment mark on the semiconductor workpiece;viewing the second alignment mark at a plurality of optical angles at both the first angular orientation and the second angular orientation;measuring a second plurality of overlay offsets, respectively, for the plurality of optical angles at the first and second angular orientations for the second alignment mark; anddetermining a plurality of ...

METHOD OF FORMING DIAMOND CONDITIONERS FOR CMP PROCESS

A method for making a conditioner disk used in a chemical mechanical polishing (CMP) process comprises applying a first layer of at least one binder over a substrate; disposing a plurality of diamond particles on the first layer of the at least one first binder at the plurality of locations; and fixing the plurality of diamond particles to the substrate by heating the substrate to a raised temperature and then cooling the substrate. The plurality of diamond particles disposed over the substrate are configured to provide a working diamond ratio higher than 50% when the conditioner disk is used in a CMP process. 1. A method for making a conditioner disk used in a chemical mechanical polishing (CMP) process , comprising:applying a first layer of at least one binder over a substrate;disposing a plurality of diamond particles on the first layer of the at least one first binder at a plurality of locations; andfixing the plurality of diamond particles to the substrate by heating the substrate to a raised temperature and then cooling the substrate,wherein the plurality of diamond particles disposed over the substrate are configured to provide a working diamond ratio higher than 50% when the conditioner disk is used in a CMP process.2. The method of claim 1 , further comprising coating a second layer of at least one second binder claim 1 , wherein a material of the at least one second binder is the same as the at least one first binder.3. The method of claim 2 , wherein the second binder layer is heated concurrently while the first binder layer is heated.4. The method of claim 2 , wherein the first binder layer and the second binder layer are coated through a process selecting from the group consisting of spin coating claim 2 , dip coating claim 2 , screen printing claim 2 , spraying coating and electroplating.5. The method of claim 1 , further comprising controlling distribution of the plurality of diamond particles during the steps of heating and cooling the substrate.6. ...

METHOD OF MANUFACTURING SEMICONDUCTOR DEVICE

In a method of manufacturing a semiconductor device, a source/drain feature is formed over a substrate. A Si-containing layer is formed over the source/drain feature. A metal layer is formed over the Si-containing layer. A metal silicide layer is formed from the metal layer and Si in the Si-containing layer. 1. A method of manufacturing a semiconductor device , said method comprising:forming a source/drain feature in a substrate;forming a Si-containing layer over the source/drain feature;forming a metal layer over the Si-containing layer; andforming a metal silicide layer from the metal layer and Si in the Si-containing layer.2. The method of claim 1 , wherein the Si-containing layer comprises a Si layer grown over the source/drain feature.3. The method of claim 1 , wherein the Si-containing layer has a thickness from 10 to 20 nm.4. The method of claim 1 , wherein said forming the source/drain feature comprises:forming a recess in the substrate; anddepositing the source/drain feature in the recess.5. The method of claim 4 , wherein said depositing comprises epitaxially growing the source/drain feature to fill the recess.6. The method of claim 1 , wherein the source/drain feature comprises at least one selected from the group consisting of SiGe claim 1 , SiC claim 1 , GeSn claim 1 , and SiGeSn.7. A method of manufacturing a semiconductor device claim 1 , said method comprising:forming an isolation feature in a substrate;forming a source/drain feature in the substrate, the source/drain feature including opposite first and second sides, the first side contacting the isolation feature, the source/drain feature having a greater thickness at the second side than at the first side;forming a Si layer over the source/drain feature, the Si layer sloping downwardly from the second side to the first side;forming a metal layer over the Si layer; andforming a metal silicide layer from the metal layer and the Si layer.8. The method of claim 7 , wherein the Si layer has a thickness ...

METHOD FOR INHIBITING MICROORGANISMS OR PLANT PESTS USING EXFOLIATED CLAY/SURFACTANT COMPLEX

The present invention provides a method for inhibiting microorganisms or plant pests using exfoliated clay/surfactant complex. The weight ratio of the exfoliated clay to the surfactant can range from 99/1 to 1/99. Preferably, the exfoliated clay is an inorganic layered clay on a nano scale and the surfactant is cationic, nonionic, anionic or amphoteric. 1. A method for inhibiting plant pests , comprising a step of spraying a dispersion of an exfoliated clay/surfactant complex on a plant; wherein:the weight ratio of the exfoliated clay to the surfactant is 99/1 to 1/99;the exfoliated clay is nanosilicate platelets (NSPs); andthe surfactant is a nonionic surfactant.2. The method of claim 1 , wherein the surfactant is polyoxyethylene alkyl ether.3. The method of claim 1 , wherein the surfactant is polyoxyethylene stearylcetyl ether.4. The method of claim 1 , wherein the exfoliated clay/surfactant complex is dispersed in water or alcohol.5. A method for inhibiting microorganism claim 1 , comprising a step of mixing a dispersion of an exfoliated clay/surfactant complex with the microorganism; wherein:the weight ratio of the exfoliated clay to the surfactant is 99/1 to 1/99;the exfoliated clay is nanosilicate platelets (NSPs); andthe surfactant is a cationic surfactant.6. The method of claim 5 , wherein the surfactant is ammonium chloride of tallow having 12 to 18 carbon atoms or ammonium chloride of hydrogenated tallow.7. The method of claim 5 , wherein the surfactant is alkyl dimethyl benzyl ammonium chloride.8. The method of claim 5 , wherein the weight ratio of the exfoliated clay to the surfactant is 95/5 to 50/50.9Escherichia coli.. The method of claim 5 , wherein the microorganisms is10. The method of claim 5 , wherein the exfoliated clay/surfactant complex is dispersed in water or alcohol. The present application is a continuation of prior U.S. application Ser. No. 13/007,906 filed Jan. 17, 2011, entitled “EXFOLIATED CLAY/SURFACTANT COMPLEX FOR INHIBITING ...

TREATMENT OF PERITONEAL INJURY USING JAK INHIBITORS

The invention provides, in certain embodiments, a method of preventing and/or treating peritoneal injury and/or diminished function by administering an effective amount of one or more inhibitors of JAK. The invention also provides a pharmaceutical composition including a JAK inhibitor for the treatment of peritoneal injury and/or diminished function. In another aspect, the invention provides a method of detecting an indicator of peritoneal injury. The method entails assaying a biological sample for periostin, wherein the presence of periostin at an elevated level indicates the presence and/or degree of peritoneal injury. Also provided, are methods of identifying subject for treatment of peritoneal injury and/or diminished function, methods of determining progression of these conditions, as well as methods of determining subjects' response to treatment. 1. A method of preventing and/or treating peritoneal injury and/or improving peritoneal membrane function comprising administering an effective amount of an inhibitor of the JAK/STAT pathway to a subject who is at risk of peritoneal injury and/or has at least one symptom or sign of peritoneal injury and/or of diminished peritoneal membrane function , wherein the effective amount is an amount sufficient to reduce the subject's risk of peritoneal injury and/or mitigate the subject's at least one symptom or sign of peritoneal injury and/or improve peritoneal membrane function.2. (canceled)3. (canceled)4. The method of claim 1 , wherein the inhibitor of the JAK/STAT pathway is an inhibitor of JAK.5. The method of claim 4 , wherein the subject is not one who is being administered an inhibitor of the JAK/STAT pathway to treat or prevent rheumatoid arthritis claim 4 , cancer claim 4 , psoriasis claim 4 , polycythemia vera claim 4 , essential thrombocytosis claim 4 , diabetic kidney disease claim 4 , or myelofibrosis.6. The method of claim 4 , wherein the inhibitor of JAK inhibits kinases selected from the group consisting of ...

MODULATORS OF 5-HT RECEPTORS AND METHODS OF USE THEREOF

The present application relates to 1,2,3,4,4a,5,6,7-octahydropyrazino[1,2-a][1,4]benzodiazepine, 1,2,3,4,4a,5,6,7-octahydropyrazino[1,2-a][1,5]benzodiazepine, 2,3,4,4a,5,6,7,11b-octahydro-1H-pyrido[3,4-d][2]benzazepine, 1,2,3,4,4a,5,6,7-octahydropyrazino[1,2-a][1]benzazepine, 1,2,3,4,4a,5-hexahydro-7H-pyrazino[1,2-a][4,1]benzoxazepine, and 2,3,4,4a,5,6-hexahydro-1H-pyrazino[2,1-d][1,5]benzoxazepine, and 5,6,7,7a,8,9,10,11-octahydropyrazino[1,2-d]pyrido[3,2-b][1,4]diazepine derivatives of formula (I) 2. The compound of claim 1 , wherein Yis N claim 1 , Yis NR claim 1 , Yis C(O) claim 1 , and Ris hydrogen.3. The compound of claim 2 , wherein R claim 2 , R claim 2 , R claim 2 , and Rare each independently hydrogen claim 2 , halogen claim 2 , —NO claim 2 , —OR claim 2 , —OC(O)R claim 2 , —SR claim 2 , —S(O)R claim 2 , —S(O)N(R)(R) claim 2 , —N(R)(R) claim 2 , —N(R)C(O)R claim 2 , —N(R)C(O)O(R) claim 2 , —N(R)C(O)N(R)(R) claim 2 , or —N(R)S(O)(R) claim 2 , provided that no more than two of R claim 2 , R claim 2 , R claim 2 , and Rare other than hydrogen.4. The compound of claim 2 , wherein one or two of R claim 2 , R claim 2 , R claim 2 , and Rare each independently alkyl claim 2 , alkenyl claim 2 , alkynyl claim 2 , cyano claim 2 , haloalkyl claim 2 , -G claim 2 , —C(O)R claim 2 , —C(O)OR claim 2 , —C(O)N(R)(R) claim 2 , —(CRR)—NO claim 2 , —(CRR)—OR claim 2 , —(CRR)—OC(O)R claim 2 , —(CRR)—OC(O)N(R)(R) claim 2 , —(CRR)—SR claim 2 , —(CRR)—S(O)R claim 2 , —(CRR)—S(O)N(R)(R) claim 2 , —(CRR)—C(O)R claim 2 , —(CRR)—C(O)OR claim 2 , —(CRR)—C(O)N(R)(R) claim 2 , —(CRR)—N(R)(R) claim 2 , —(CRR)—N(R)C(O)R claim 2 , —(CRR)—N(R)C(O)O(R) claim 2 , —(CRR)—N(R)C(O)N(R)(R) claim 2 , —(CRR)-G claim 2 , —CR═CR-G claim 2 , or cyanoalkyl claim 2 , and the others of R claim 2 , R claim 2 , R claim 2 , and Rare hydrogen; or{'sup': 10', '11', '11', '12', '12', '13', '10', '11', '12', '13, 'Rand R, or Rand R, or Rand Rtaken together with the carbon atoms to which they are attached form a ...

SEMICONDUCTOR DEVICE CONTACT STRUCTURES

Semiconductor contact structures extend through a dielectric material and provide contact to multiple different subjacent materials including a silicide material and a non-silicide material such as doped silicon. The contact structures includes a lower composite layer formed using a multi-step ionized metal plasma (IMP) deposition operation. A lower IMP film is formed at a high AC bias power followed by the formation of an upper IMP film at a lower AC bias power. The composite layer may be formed of titanium. A further layer is formed as a liner over the composite layer and the liner layer may advantageously be formed using CVD and may be TiN. A conductive plug material such as tungsten or copper fills the contact openings. 1. A semiconductor device comprising:a contact structure disposed within a contact opening extending through a dielectric layer and terminating at a bottom surface;said contact structure comprising an inner tungsten plug surrounded by a TiN layer surrounded laterally and subjacently by an inner layer of a first material having a first resistivity, said inner layer surrounded laterally and subjacently by an outer layer of said first material having a second resistivity that is lower than said first resistivity, said outer layer contacting said bottom surface, said first material comprising one of titanium and cobalt.2. The semiconductor device as in claim 1 , wherein said bottom surface comprises a silicide surface and said inner layer and said outer layer have a combined thickness of about 250 angstroms or more.3. The semiconductor device as in claim 2 , further comprising a further contact structure disposed within a further contact opening extending through said dielectric layer and wherein said further contact opening terminates at a further bottom surface comprising silicon with a dopant impurity therein.4. The semiconductor device as in claim 1 , wherein said first resistivity is greater than 95 uohm-cm claim 1 , said second resistivity is ...

[1,2,4]TRIAZOLO[4,3-B][1,2,4]TRIAZINE COMPOUNDS, PREPARATION METHOD AND USE THEREOF

The present invention relates to a structurally novel [1,2,4]triazolo[4,3-b][1,2,4]triazine compounds represented by formula (I) or formula (II), pharmaceutically acceptable salts thereof, prodrugs thereof, hydrates or solvates thereof, and also relates to a preparation method of the compounds, a pharmaceutical composition including a therapeutically effective amount of the compounds, as well as the use thereof as protein tyrosine kinase inhibitors, particularly as c-Met inhibitors, in the preparation of medicaments for the prevention and/or treatment of diseases associated with c-Met abnormality. 2. The [1 claim 1 ,2 claim 1 ,4]triazolo[4 claim 1 ,3-b][1 claim 1 ,2 claim 1 ,4]triazine compound claim 1 , pharmaceutically acceptable salts claim 1 , prodrugs claim 1 , hydrates or solvates thereof according to claim 1 , wherein claim 1 , the aryl is phenyl claim 1 , substituted phenyl claim 1 , naphthyl or xenyl; the heteroaryl is pyrazolyl claim 1 , furyl claim 1 , pyrrolyl claim 1 , pyridyl claim 1 , thienyl claim 1 , imidazolyl claim 1 , quinolyl claim 1 , isoquinolyl or indolyl; the substituents for the substitution are 1-4 group(s) selected from the group consisting of halogen claim 1 , C1-C6 linear or branched alkyl claim 1 , nitro group claim 1 , amino claim 1 , hydroxyl claim 1 , hydroxymethyl claim 1 , trifluoromethyl claim 1 , trifluoromethoxy claim 1 , carboxyl claim 1 , C1-C4 alkoxy claim 1 , benzyloxy claim 1 , C1-C4 acyl claim 1 , benzyl claim 1 , piperidyl claim 1 , tert-butoxycarbonyl-substituted piperidyl and methoxyformyl.3. The [1 claim 1 ,2 claim 1 ,4]triazolo[4 claim 1 ,3-b][1 claim 1 ,2 claim 1 ,4]triazine compound claim 1 , pharmaceutically acceptable salts claim 1 , prodrugs claim 1 , hydrates or solvates thereof according to claim 1 , wherein claim 1 , the compound has a structure of formula (I) claim 1 , and R2 and R3 are each independently hydrogen atom.4. The [1 claim 1 ,2 claim 1 ,4]triazolo[4 claim 1 ,3-b][1 claim 1 ,2 claim 1 ,4]triazine ...

Device with MOS Device Including a Secondary Metal and PVD Tool with Target for Making Same

A device includes a substrate and a metal-oxide-semiconductor (MOS) device. The MOS device includes a gate dielectric over the substrate, a gate electrode over the gate dielectric, a source/drain region adjacent the gate dielectric, and a source/drain silicide over and contacting the source/drain region. The source/drain silicide comprises silicon, nickel, and a secondary metal. A ratio of a volume percentage of the secondary metal to a volume percentage of the silicon in the source/drain silicide is between about 0.005 and about 0.1. The secondary metal has a density between about 5,000 kg/mand about 15,000 kg/m. 1. A device comprising:a substrate; a gate dielectric over the substrate;', 'a gate electrode over the gate dielectric;', 'a source/drain region adjacent the gate dielectric; and', {'sup': 3', '3, 'a source/drain silicide over and contacting the source/drain region, wherein the source/drain silicide comprises silicon, nickel, and a secondary metal, and wherein a ratio of a volume percentage of the secondary metal to a volume percentage of the silicon in the source/drain silicide is between about 0.005 and about 0.1, and wherein the secondary metal has a density between about 5,000 kg/mand about 15,000 kg/m.'}], 'a metal-oxide-semiconductor (MOS) device comprising2. The device of claim 1 , wherein the secondary metal is selected from the group consisting essentially of zinc claim 1 , molybdenum claim 1 , ruthenium claim 1 , and combinations thereof.3. The device of claim 2 , wherein the secondary metal comprises zinc.4. The device of claim 2 , wherein the secondary metal comprises molybdenum.5. The device of claim 2 , wherein the secondary metal comprises ruthenium.6. The device of claim 1 , wherein the nickel has a volume percentage greater than about 90 percent.7. The device of claim 1 , wherein the gate electrode comprises a polysilicon gate and the substrate is a silicon-on-insulator substrate.8. A device comprising:a silicon-containing substrate; ...

Method and Kit for Determining Severity and Progression of Periodontal Disease

An improved method and kit of determining whether a patient is predisposed to having severe periodontal disease and/or having high risk of progression of periodontal disease, comprising the steps of (i) taking a biological sample from said patient; (ii) genotyping said biological sample for genetic polymorphism pattern comprising IL 1B (rs16944), IL 1B (rs1143623) and IL 1B (rs4848306); and (iii) comparing said genetic polymorphism patterns to a reference composite genotype pattern; wherein the similarity of said genetic polymorphism patterns to said reference pattern indicate said patient's predisposition to having severe periodontal disease and/or having high risk of progression of periodontal disease.