Настройки

Укажите год
-

Небесная энциклопедия

Космические корабли и станции, автоматические КА и методы их проектирования, бортовые комплексы управления, системы и средства жизнеобеспечения, особенности технологии производства ракетно-космических систем

Подробнее
-

Мониторинг СМИ

Мониторинг СМИ и социальных сетей. Сканирование интернета, новостных сайтов, специализированных контентных площадок на базе мессенджеров. Гибкие настройки фильтров и первоначальных источников.

Подробнее

Форма поиска

Поддерживает ввод нескольких поисковых фраз (по одной на строку). При поиске обеспечивает поддержку морфологии русского и английского языка
Ведите корректный номера.
Ведите корректный номера.
Ведите корректный номера.
Ведите корректный номера.
Укажите год
Укажите год

Применить Всего найдено 2. Отображено 2.
04-04-2023 дата публикации

Real-time monitoring device for electric power engineering

Номер: CN115899518A
Принадлежит:

The invention discloses a real-time monitoring device for electric power engineering, and relates to the field of monitoring devices.The real-time monitoring device comprises a monitoring device, a rain baffle is arranged on the upper surface of the monitoring device, a rotating plate is arranged below the monitoring device, and a connecting shaft is arranged on the inner wall of the rotating plate; the two ends of the connecting shaft are rotationally connected with the same supporting plate correspondingly, and a fixing plate is arranged on the left side of the supporting plate. According to the monitoring device, the whole monitoring device can be fixed outside conveniently by arranging a pressing plate and a contact plate, the whole monitoring device is stably supported by arranging a supporting plate, a fixing plate and a rotating plate, the monitoring device is convenient to disassemble and assemble by arranging a rain baffle for rainproof operation and arranging an adjusting swing ...

Подробнее
27-01-2010 дата публикации

Primer, probe and method for real-time fluorescence PCR detection of chicken derived component

Номер: CN0101633953A
Принадлежит:

The invention discloses a primer, a probe and a method for real-time fluorescence PCR detection of a chicken derived component. The primer sequence is as follows: an upstream primer P1 is CAAACAACCCTGCAAACAAAATTA, and a downstream primer P2 is GGGCTTGAGAATTGGTCGAA; the probe sequence is CCCCTGAACCTGACCATGAACCTAAGCTT, the 5' end of the probe is marked with fluorescent reporting dye FAM, and 3' end is marked with fluorescent quenching dye TAMRA. The invention has the following beneficial effects that the invention has favourable sensitivity and specificity, simple and quick operation and accurate and reliable detecting result, provides a simple, effective and accurate detecting method for identifying and detecting chicken derived components, further perfects the food detection system and increases protection force for the benefits of consumers.

Подробнее