Porous cordierite block preparation method

The present invention discloses a porous cordierite block preparation method, which sequentially comprises: 1) at a room temperature, dissolving magnesium chloride hexahydrate, aluminum chloride hexahydrate and polyacrylamide in a solvent, adding tetramethyl orthosilicate in a dropwise manner, and continuously carrying out a stirring reaction for 50-70 min at a temperature of 50-70 DEG C; 2) naturally cooling the transparent clear solution obtained in the step 1) to a room temperature, adding propylene oxide, and uniformly stirring; 3) placing the homogeneous solution obtained in the step 2) into a container, sealing, and carrying out gelation for 3-5 min at a temperature of 35-45 DEG C; 4) placing the wet gel obtained in the step 3) in an environment with a temperature of 35-45 DEG C, and aging for 60-80 h; and 5) placing the aged gel obtained in the step 4) in an environment with a temperature of 50-70 DEG C, carrying out normal pressure drying for 72-96 h, and carrying out a heat treatment ...

Infrared reflexive aggregate and preparation method thereof

The invention discloses an infrared reflexive aggregate. In the infrared reflexive aggregate, pretreated mica is taken as a substrate, and a clading layer with the thickness of between 0.5 and 5 micrometers is coated on the outer surface of the substrate; the thickness of the mica is between 0.5 and 5 micrometers, and the grain diameter is between 0.5 and 120 micrometers; and the cladding layer is doped zinc oxide, and the doped zinc oxide consists of ZnO serving as a main metal oxide and doping metal in a molar ratio of 0.1 to 10 percent. The invention also provides a preparation method of the infrared reflexive aggregate simultaneously, which comprises the following steps of: 1) pretreating the mica; and 2) coating the cladding layer outside the outer surface of the pretreated mica serving as the substrate. In the aggregate, the excellent infrared reflexive performance of the doped zinc oxide serving as a film is reserved, the aggregate is used for preparing a transparent or semitransparent ...

Nano silicon carbide ceramic preparation method

The invention discloses a nanometer carborundum ceramic, the weight percentages of the components of which are 75 percent to 90 percent of nanometer carborundum, 10 percent to 15 percent of yttrium aluminum garnet and 0 percent to 10 percent of nanometer titanium nitride. The preparation method of the nanometer carborundum ceramic comprises the steps as follows: firstly, the transparent sol of yttrium aluminum garnet is made by the wet chemical method; secondly, the nanometer carborundum and the nanometer titanium nitride are added into the transparent sol of yttrium aluminum garnet and mixedwith water for obtaining composite sol; thirdly, nanometer composite powder is obtained after the composite sol is aged, dried, heat-treated and grinded; fourthly, the nanometer composite powder is treated for the prepressing of dry press and the cold isostatic pressing to obtain compact biscuit, and then the compact biscuit is put into a vacuum non-pressure sintering furnace to be sintered. The nanometer ...

Optimization method for thermal schedule of glass-ceramic nucleation and crystallization furnace

The invention discloses a method for optimizing a thermal regulation of a nucleation and crystallization furnace of neoceramic glass. The steps comprise 1) collecting actual parameter of heat treating furnace process, 2) designing and calculating models, 3) calculating the temperature of neoceramic glass panel products in any position of the furnace via setting the actual heat treating furnace processing parameter, thereby confirming the retention time of the neoceramic glass in nucleation segment and in crystallization segment. The best processing condition can be obtained by employing the method of the invention, thereby realizing low cost and low energy-consumption of the neoceramic glass panel finally.

A carbonaceous silicon carbide sealed ring and preparation method thereof

The invention discloses a preparation method of carbonaceous silicon carbide sealed ring, taking silicon carbide powder, yttrium aluminum garnet and carbon powder as the main raw material, includes the following steps in sequence: 1) adding the main raw material, binder, and dispersant in the deionized water, performing ball mill mixing, and then confecting into a water-based silicon carbide compound slurry; 2) using spray granulation process to performing spray drying to the water-based silicon carbide compound slurry; 3) adding the obtained silicon carbide granulation powder into an annular mold, and adopting prepressing and cold isostatic pressing end pressing two-step mode molding; 4) placing the obtained high-density sealed ring blank body into a vacuum non-pressure fritting furnace for sintering, to obtain the carbonaceous silicon carbide sealed ring. The invention also provides a carbonaceous silicon carbide sealed ring prepared by the above method, which has low friction coefficient ...

Preparation method of zirconium carbide micropowder

The invention discloses a preparation method of zirconium carbide micropowder, which comprises the following steps in sequence: 1) taking bamboo charcoal micropowder with grain size of 0.1-1 micrometer as carbon source and zirconium dioxide sol as zirconium source; 2) respectively adding the bamboo charcoal micropowder, dispersing agent and catalyst into the zirconium dioxide sol under room temperature, stirring for 0.5-4h, then drying at 100-200 DEG C, grinding to get zirconium carbide precursor; and 3) putting the get zirconium carbide precursor in a vacuum sintering furnace, heating under 1,600-2,200 DEG C for 1-10h, and finally cooling. In this way, the zirconium carbide micropowder can be prepared. The zirconium carbide micropowder prepared through the method has the characteristic that the grain size is even and controllable.

Pyroceram-ceramic composite plate and preparation method thereof

The invention discloses a pyroceram-ceramic composite plate. The pyroceram in the composite plate consists of main materials and antimony trioxide (Sb2O3), wherein the Sb2O3 accounts for 0.8 to 1.2 percent of the total weight of the main materials; and the main materials consist of the following components in percentage by weight: 45 to 55 percent of silicon dioxide (SiO2), 4 to 10 percent of magnesium oxide (MgO), 15 to 20 percent of calcium oxide (CaO), 10 to 14 percent of aluminum oxide (Al2O3), 3 to 6 percent of sodium oxide (Na2O) or potassium oxide (K2O) and 6 to 10 percent of calcium fluoride (CaF2). The invention also discloses a method for preparing the pyroceram-ceramic composite plate. The method comprises the following steps of: 1) mixing the main materials and the Sb2O3 uniformly and heating the mixture; 2) pouring the obtained glass liquid into an iron mould to form and cool, then annealing, and preparing the obtained mother glass into glass powder and glass particles respectively ...

Membrane bioreactor

Surface microporous SiC ceramic material and preparation method thereof

The invention discloses a surface microporous SiC ceramic material, which consists of main raw materials, polycarbosilane and carboxymethyl cellulose, wherein the main raw materials consist of the following components in percentage by weight: 85 to 90 percent of silicon carbide powder and 10 to 15 percent of yttrium aluminum garnet; the polycarbosilane is 5 to 10 percent of the total weight of the main raw materials; and the carboxymethyl cellulose is 2 to 8 percent of the total weight of the main raw materials. Meanwhile, the invention discloses a method for preparing the surface microporous SiC ceramic material, which comprises the following steps of: uniformly mixing the silicon carbide powder, the yttrium aluminum garnet and the polycarbosilane, and adding aqueous solution of the carboxymethyl cellulose and performing ball-milling mixing; drying the obtained size; and molding the obtained powder and performing vacuum sintering at high temperature so as to prepare the surface microporous ...

Process for separating zinc and lead from metallurgic furnace dust

A process for separating Zn and Pb from metallurgical furnace dust is characterized by use of fusion reduction process. Its advantages are short time and less energy consumption.

Optimization method for thermal schedule of glass-ceramic nucleation and crystallization furnace

The invention discloses a method for optimizing a thermal regulation of a nucleation and crystallization furnace of neoceramic glass. The steps comprise 1) collecting actual parameter of heat treatingfurnace process, 2) designing and calculating models, 3) calculating the temperature of neoceramic glass panel products in any position of the furnace via setting the actual heat treating furnace processing parameter, thereby confirming the retention time of the neoceramic glass in nucleation segment and in crystallization segment. The best processing condition can be obtained by employing the method of the invention, thereby realizing low cost and low energy-consumption of the neoceramic glass panel finally.

Calcium phosphate opaque glass and method for making same

Bamboo charcoal-tourmaline far infrared composite material and preparation thereof

The invention discloses a bamboo charcoal-tourmaline far IR composite material. The weight percentage of the formula components thereof are as follows: 40 to 60 percent of bamboo charcoal as well as 40 to 60 percent of tourmaline. The invention also provides a preparation method for the composite material, which comprises the following steps: 1) the tourmaline is calcined for 1 to 3 hours at the temperature between 500 and 700 DEG C; 2) the calcined tourmaline and the bamboo charcoal are fully mixed and grinded according to the formula proportion to lead the granularity of the obtained mixed powder to achieve 0.1 to 1um; 3) the mixed powder is shaped under the pressure between 90 and 110MPa and then calcined for 1 to 5 hours at the temperature between 850 and 1000 DEG C under a vacuum environment to obtain a calcined substance; and 4) the calcined substance is cooled to normal temperature to obtain the composite material. The composite material has the characteristic of high far IR transmission ...

Binary nanometer cooperative reinforcing and toughening silicon carbide ceramics and preparing method thereof

The invention discloses a method for preparing binary nanometer cooperative reinforcing and toughening silicon carbide ceramics, and silicon carbide powder, yttrium aluminum garnet, nano particles and nano crystal whickers are taken as the main raw materials. The method comprises the following steps: 1) the main raw materials, a binder and a dispersant are added into de-ionized water, after being ball-milled and mixed, water-base silicon carbide slurry is prepared; 2) the water-base silicon carbide slurry is sprayed and dried by adopting a spray granulation technology; 3) the obtained silicon carbide granulating powder is formed by adopting pre-pressing of dry pressing and final pressing of cold isostatic pressing; and 4) the obtained green body of silicon carbide is put in a vacuum non-pressure sintering furnace to be treated, thus obtaining the binary nanometer cooperative reinforcing and toughening silicon carbide ceramics. The invention also discloses the binary nanometer cooperative ...

Method and system for achieving call interception based on Internet and communication network

The invention provides a method and system for achieving call interception based on Internet and a communication network. Through the method and the system, call interception is achieved by combination of the Internet and the communication network, and thus shielding against harassing phone calls is truly achieved; different means of interception can be provided according to the pre-setting by a user, and the setting is done in a convenient and flexible manner; and a short message can be sent to inform the user of information on the interception of phone calls. Interception rules are set in a call interception setting module of a mobile terminal, flexible rules are set for getting through a call, any scene, preset list or duration and the like can be set, synchronization onto a call interception platform can be achieved via an interface server, and unconditional call forwarding of the user can also be set.

Ecological ceramic tile and preparation method of the ecological ceramic tile

The invention discloses an ecological ceramic tile. Main raw materials of the ecological ceramic tile comprise 70 to 90 percent of gold tailings particles, 5 to 25 percent of bamboo carbon and 5 to 15 percent of purple gold clay. Aqueous solution of sodium silicate, with the weight of 2 to 4 percent of the total weight of the raw materials, is used as a bonder. A preparation method of the ecological ceramic tile comprises the following steps of: 1, placing the main raw materials into a mixer to mix the main raw materials for 5 to 15 minutes, then adding the aqueous solution of sodium silicateto mix for 60 to 120 minutes and carrying out ageing mixture for 10 to 14 hours to obtain a mixture; 2, carrying out pressure forming on the mixture under the pressure of 30 to 80MPa and then naturally drying the obtained product by 12 to 24 hours to obtain a dried formed product; and 3, sintering the dried formed product for 2 to 4 hours at the temperature of 1,000 to 1,250 DEG C to obtain the ecological ...

Modification bamboo charcoal having Ag and porous TiO2 and the preparing method

The invention relates to a modified bamboo-carbon product and the manufacturing method. In detail, it is the porous TiO2 bamboo-carbon product with Ag on the surface and high specific surface area, notable photocatalysis and antibacterial performances and the manufacturing method. The porous TiO2 modified bamboo-carbon with Ag on the surface comprises pretreated bamboo-carbon material and TiO2 nanometer sol doped pore-making agent Ag/N filled in bamboo-carbon duct or vascular bundle. The TiO2 nanometer sol doped pore-making agent Ag/N comprises TiO2 sol particle, pore-making agent, nitrogen doped component and Ag+. No only the invention changes the distribution of pore channels but also pore channels can not be jammed. So it can improve bamboo-carbon specific surface area in effect and increases absorption and the concentration of anion. At the same time, when there is no light source, the abundant Ag on the surface is made use of so that the bamboo-carbon is provided with permanent antibacterial ...

A preparation method of carborundum composite-phase ceramic

Preparation method of alumina porous microsphere

The invention discloses a preparation method of an alumina porous microsphere. The preparation method comprises the following steps: 1) dissolving a surfactant in deionized water, stirring the solution, and using the solution as a water phase; 2) mixing a chelating agent, an alumina precursor and octanol, stirring the materials, and using the mixture as an oil phase; 3) adding Span80 and a pore-forming agent to the oil phase, and stirring the materials; 4) pouring the clear oil phase obtained in the step 3) into the water phase, and continuously stirring and emulsifying the materials; 5) carrying out vacuum filtration on the product obtained in the step 4), and washing and then drying the obtained filter cake, thus obtaining the alumina porous microsphere. The microsphere has an internally closed macroporous structure and has a microsphere dimension of 1-100mu m and an internally closed pore diameter of 50nm-5mu m.

Cobalt-containing blue microcrystalline glass and prepration method thereof

The invention discloses a cobalt-containing blue microcrystalline glass which consists of base glass and cobalt monoxide with the weight ratio of cobalt monoxide to base glass of 0.001-0.1%, and the base glass comprises the following components by weight percent: 62% of silicon dioxide, 8.2% of lithium oxide, 18% of aluminum oxide, 0.7% of magnesium oxide, 0.7% of zinc oxide, 0.7% of barium oxide, 0.7% of boron oxide, 4.5% of titanium oxide, 2% of potassium oxide, 1% of sodium oxide and 1.5% of antimony trioxide. The invention simultaneously discloses the preparation method which comprises the following steps: melting raw materials obtained by ball milling treatment at the temperature of 1380 DEG C-1450 DEG C, pouring the obtained glass liquid into a mold for molding, annealing the molded glass at the temperature of 480-520 DEGC, then cooling and carrying out heat treatment at the temperature of 600 DEG C-750 DEG C. The cobalt-containing blue microcrystalline glass has high and strong heat ...

CaO-MgO-Al2O3-SiO2 microcrystalline glass and preparation method thereof

The invention discloses a CaO-MgO-Al2O3-SiO2 microcrystalline glass which is composed of glass aggregate and oxide nucleating agent accounting for 3wt% of glass aggregate, wherein the glass aggregate is composed of the following components in percentage by weight: 50-55wt% of SiO2, 6-10wt% of MgO, 15-18wt% of CaO, 10-12wt% of Al2O3, 3-6wt% of Na2O and/ or K2O, 8wt% of CaF2 and 1wt% of Sb2O3. The invention simultaneously provides a preparation method of the CaO-MgO-Al2O3-SiO2 microcrystalline glass. In the CaO-MgO-Al2O3-SiO2 microcrystalline glass, nucleating agent of oxide and fluoride is adopted, so that the devitrification activation energy of a system is lowered, a crystal growth index is improved, and the devitrification capability of the microcrystalline glass is greatly enhanced, thereby bringing convenience for preparing the microcrystalline glass with a whole method.

Preparation of multielement codoped nanaotitania film

The invention discloses a method for preparing a multielement co-doped nano titanium dioxide film comprising the following steps: 1) adding ferric nitrate nonahydrate, silver nitrate and guanidine hydrochloride solid into abatase titanium dioxide solution to prepare a mixed solution; 2) sustainably magnetically stirring the mixed solution under the water bath condition and obtaining an uniform sol; 3) storing the sol at room temperature for 10-12 days to obtain aging solution, preparing a coating glass slide by the aging solution and drying; 4) heat-treating the dried coating glass slide at 350-450 DEG C for 1 hour to obtain the multielement co-doped nano titanium dioxide film. The titanium dioxide film of the invention has functions of achievement the red shift of the ultraviolet absorbance, visible light response of the photocatalysis and no light antibacteria.

Process for separating zinc and lead from metallurgic furnace dust

Intelligent door, window and sunshade integrated device

The invention discloses an intelligent door, window and sunshade integrated device. The device comprises an intelligent control system, a window frame system and a sunshade shutter system, wherein the intelligent control system comprises an optical radiation intensity sensor (1), a signal receiving control component (2) and the like; the window frame system comprises a frame (9); a heat insulation hollow vitreous body (7) is arranged in the frame (9); the sunshade shutter system comprises a blind (6) which consists of a dentiform scroll component (5) and aluminum foil leaves (61); the dentiform scroll component (5) is used for controlling the rolling of the blind (6) and an overturning angle of the aluminum foil leaves (61); the blind (6) and the dentiform scroll component (5) are arranged in the cavity of the heat insulation hollow vitreous body (7); and the cavity of the heat insulation hollow vitreous body (7) is full of inert gas (8). The device can not only automatically adjust the ...

Purplish-red glass-ceramic containing neodymium and preparation method thereof

The invention discloses purplish-red glass-ceramic containing neodymium. The base material of the purplish-red glass-ceramic containing neodymium comprises the following components by weight percent: 60-61 percent of silicon dioxide, 9-11 percent of Lithia, 18-19 percent of aluminum oxide, 1.5-2 percent of a mixture I consisting of magnesium oxide, zinc oxide, barium oxide and boron oxide, 4-5 percent of titanium oxide, 2.5-3.5 percent of a mixture II consisting of potassium oxide and sodium oxide and 1.5-2 percent of antimony trioxide. The weight percentage of neodymium nitrate acting as colorant in the base material is 0.1-2 percent. The invention also discloses a preparation method of the purplish-red glass-ceramic containing neodymium, comprising the following steps of: evenly mixing the base material and the neodymium nitrate, ball milling, melting, molding, annealing and heat treatment. The purplish-red glass-ceramic containing neodymium prepared by the method has stable and pure ...

Aluminium nitride reinforced sibicon carbide ceramic and its preparation method

Preparation method for hierarchical porous titanium dioxide block

A disclosed preparation method for a hierarchical porous titanium dioxide block comprises: taking titanium oxysulfate as a titanium source, taking methanamide as a gel accelerator and taking polyvinylpyrrolidone as a phase separation inducer to successively perform the following steps: 1) dissolving titanium oxysulfate in deionized water; 2) slowly adding glycol into the transparent solution obtained in the step 1), and stirring; 3) adding polyvinylpyrrolidone into the solution obtained in the step 2) and stirring; 4) slowly adding methanamide into the solution obtained in the step 3) and stirring, firstly ageing the obtained substance at 35-45 DEG C for 10-24 h, then respectively using deionized water and isopropanol to perform solvent displacement, and then drying the gel at 50-65 DEG C for 3-5 days after displacement, so as to obtain a dry gel; and 5) processing the dry gel at 500-800 DEG C for 3-5 h, so as to obtain the hierarchical porous titanium dioxide block. The titanium dioxide ...

Carbon-containing wall surface decoration materials and method for preparing the same

The invention discloses a method for preparing carbon-containing wall surface decoration materials. The raw materials comprise 5 to 50 percent of carbon, 0 to 70 percent of diatomaceous earth and 0 to 50 percent of clay by weight. The method comprises the following steps: 1) washing the clay with water to remove impurities on the surface; 2) respectively grinding the washed clay, the diatomaceousearth and the carbon; 3) blending and mixing clay powder, diatomaceous earth powder and carbon powder with water, and then standing the mixture; 4) shaping the acquired mixture at a pressure of between 30 and 80 MPa; 5) drying the acquired unburned bricks; and 6) calcining the acquired dried unburned bricks for 3 to 4 hours, and cooling the calcined bricks to acquire the carbon-containing wall surface decoration materials. The invention also discloses the carbon-containing wall surface decoration materials which have the functions of absorption, humidification, heat preservation and insulation and ...

Preparation method for hierarchical porous silicon oxide

The invention discloses a preparation method for hierarchical porous silicon oxide. The preparation method comprises the following steps: 1) adding a template into a hydrochloric acid solution, carrying out magnetic stirring, then adding an expanding agent, methyl silicate used as a precursor and epoxypropane used as a gel promoter, carrying out stirring for 50 to 70 min and placing an obtained mixture into a baking oven with a temperature of 35 to 45 DEG C for a reaction for 3 to 5 d; 2) carrying out solvent exchanging on formed gel with absolute ethyl alcohol so as to obtain absolute ethyl alcohol-exchanged gel; and 3) drying the absolute ethyl alcohol-exchanged gel obtained in the step 2) in the baking oven with a temperature of 55 to 65 DEG C for 3 to 5 d so as to prepare hierarchical porous silicon oxide. With the method, a hierarchical porous silicon oxide block material with coherent macro pores and a long-range ordered meso-structure can be obtained.

Surface strengthening method for lithium silicon aluminum micro-crystal glass

The invention discloses a surface peening method for lithium aluminosilicate glass-ceramics, wherein the steps of the invention comprise that (1) preparing mixed molten salt, the mixed molten salt is composed of raw materials with following weight percentages, sodium nitrate 25%-50% and Sodium Sulfate 50%-75%, (2) the lithium aluminosilicate glass-ceramics are dropped into the mixed molten salt after accurately grinding, and are impregnated for 15-90 minutes at the temperature between 450 DEC G-750 DEC G, fetching and cleaning the mixed molten salt, then drying the mixed molten salt for 5-12 hours. Adopting the process of the invention is capable of obviously improving dent resistance of lithium aluminosilicate glass-ceramics.

Preparation method of soluble medicine loaded microcapsule

The invention discloses a preparation method of a soluble medicine loaded microcapsule. The preparation method comprises the following steps: dispersing porous microspheres in a soluble medicine saturated solution, continuously stirring for 0.5-2 hours to obtain a dispersion solution which is formed by dispersing the porous microspheres in the medicine saturated solution; adding a hot melt material and a surfactant into the dispersion solution which is formed by dispersing the porous microspheres in the medicine saturated solution, heating until the hot melt material is fully molten, preserving heat and continuously stirring for 0.5-2 hours to form an uniform emulsion; quenching the emulsion under the water bath condition at the temperature of 0-10 DEG C, carrying out suction filtration, washing a filter cake and then drying the filter cake to obtain the soluble medicine loaded microcapsule. The microcapsule has high loading capacity on the soluble medicine.

Bamboo charcoal-tourmaline far infrared composite material and preparation thereof

The invention discloses a bamboo charcoal-tourmaline far IR composite material. The weight percentage of the formula components thereof are as follows: 40 to 60 percent of bamboo charcoal as well as 40 to 60 percent of tourmaline. The invention also provides a preparation method for the composite material, which comprises the following steps: 1) the tourmaline is calcined for 1 to 3 hours at the temperature between 500 and 700 DEG C; 2) the calcined tourmaline and the bamboo charcoal are fully mixed and grinded according to the formula proportion to lead the granularity of the obtained mixed powder to achieve 0.1 to 1um; 3) the mixed powder is shaped under the pressure between 90 and 110MPa and then calcined for 1 to 5 hours at the temperature between 850 and 1000 DEG C under a vacuum environment to obtain a calcined substance; and 4) the calcined substance is cooled to normal temperature to obtain the composite material. The composite material has the characteristic of high far IR transmission ...

Preparation of multielement codoped nanaotitania film

The invention discloses a method for preparing a multielement co-doped nano titanium dioxide film comprising the following steps: 1) adding ferric nitrate nonahydrate, silver nitrate and guanidine hydrochloride solid into abatase titanium dioxide solution to prepare a mixed solution; 2) sustainably magnetically stirring the mixed solution under the water bath condition and obtaining an uniform sol; 3) storing the sol at room temperature for 10-12 days to obtain aging solution, preparing a coating glass slide by the aging solution and drying; 4) heat-treating the dried coating glass slide at 350-450 DEG C for 1 hour to obtain the multielement co-doped nano titanium dioxide film. The titanium dioxide film of the invention has functions of achievement the red shift of the ultraviolet absorbance, visible light response of the photocatalysis and no light antibacteria.

Glass ceramic board for industrial protection and preparation method thereof

The invention discloses a glass ceramic board for industrial protection and a preparation method thereof. The preparation method comprises the following steps: 1) preparing raw materials according to requirements of the system CaO-MgO-Al2O3-SiO2 and allowing the raw materials to comprise the basic compound components consisting of, by weight, 50 to 55% of SiO2, 8 to 10% of MgO, 12 to 14% of CaO, 8 to 10% of Al2O3, 3 to 5% of FeO, 2 to 4% of Na2O and K2O, 6 to 8% of CaF2 and 3% of TiO2; 2) uniformly mixing the raw materials and carrying out melting and homogenization so as to obtain glass liquid; 3) subjecting the glass liquid to continuous calendering molding and annealing; 4) directly sending an annealed glass plate to a nucleation and crystallization furnace on line for nucleation and crystallization; and 5) and subjecting a glass ceramic plate having undergone nucleation and crystallization to on-line cutting and cooling to room temperature so as to obtain the glass ceramic board for ...

Gene chip and kit for detecting human papillomavirus (HPV)

The invention discloses a gene chip for detecting human papillomavirus (HPV), comprising a solid carrier and a human papillomavirus detecting probes fixed on the solid carrier. The detecting probes comprise nucleotide sequences in SEQ ID No.9-37, and the 27 types of HVP subtype specific probes in the invention correspondingly comprise 22 kinds of high-risk and mediate-risk HPV, and 5 kinds of low-risk HPV and two kinds of high-risk HPV integration (HPV16/HPV18). The invention also discloses a detecting kit for detecting various subtypes of HPV in a sample with high speed and high flux, and the kit comprises the gene chip, a primer sequence for detection, a human GAPDH gene, special HPV lysing solution, PCR reaction liquid and a color reagent, wherein the detecting probe fixed on the gene chip has the nucleotide sequence in the SEQ ID No.9-37; the primer sequence for detection is used for amplifying the DNA sequence of the HPV in a clinical sample, and the human GAPDH gene is used for amplifying ...

Preparation method of polymeric porous microsphere

The invention discloses a preparation method of a polymeric porous microsphere. The preparation method comprises the following steps: (1) preparation of an ethyl acetate saturated aqueous solution; (2) preparation of emulsion, including the following detailed steps: (i) dissolving 0.5-5.0g of a surfactant in 100g of ethyl acetate saturated aqueous solution to obtain a mixed solution as an aqueous phase, (ii) adding 0.2-2.0g of ethyl cellulose in 10g of ethyl acetate, and then performing mixing and stirring to obtain a mixture as an oil phase, and (iii) adding the oil phase in the aqueous phase and stirring to obtain emulsion; and (3) solvent dispersion, i.e., metering the volume of 0.5-5.0g of surfactant with deionized water to 300g; pouring the emulsion obtained from the step (2) into the deionized water solution of the surfactant and performing stirring; later, collecting powder by vacuum suction filtration; and drying at the temperature of 40 DEG C for 24 hours, thereby obtaining the ...

Preparation method for iron oxide microspheres as negative electrode material of lithium ion battery

The invention discloses a preparation method for iron oxide microspheres as the negative electrode material of a lithium ion battery, which comprises the steps of 1) dissolving the ferric salt in de-ionized water to obtain a ferric salt solution; 2) adding acid in the ferric salt solution obtained in the step 1), then adding PVP in the solution and stirring the solution till the PVP is completely dissolved; 3) adding methanamide while vigorously stirring the solution, and then aging the solution at 50 to 70 DEG C for 2 to 3 hours to obtain a gel; 4) drying the gel at 50 to 70 DEG C for 24 hours under the normal pressure to obtain a precursor product; 5) heating the precursor product obtained in the step 4) in the air atmosphere to about 500 to 800 DEG C, then thermally preserving the product for 4 to 6 hours, and cooling the product to the room temperature to obtain iron oxide microspheres as the negative electrode material. By the above method, the volume expansion problem of Fe2O3 during ...

Preparation method of porous aluminum phosphate block

The invention discloses a preparation method of a porous aluminum phosphate block. According to the preparation method, aluminum chloride hexahydrate is taken as an aluminum source, phosphoric acid is taken as a phosphorus source, a mixture of deionized water and absolute methanol is taken as a solvent, propylene epoxide is taken as a gel accelerator, and polyoxyethylene is taken as a phase separation inductive agent; the following steps are sequentially performed: 1), aluminum chloride hexahydrate and polyoxyethylene are put in a reaction flask, deionized water, absolute methanol and phosphoric acid are doped, and stirring is performed until polyoxyethylene is dissolved completely; 2), under the condition of ice bath, propylene epoxide is doped into a solution obtained in step 1), stirring is continuously performed until propylene epoxide is dissolved completely; 3), the reaction flask is sealed and aged, then a lid is opened, and drying is performed; and 4), obtained xerogel is processed ...

Preparation method for lithium titanate-titanium dioxide cathode material of micro-nano structure

The present invention discloses a preparation method for the lithium titanate-titanium dioxide cathode material of a micro-nano structure, which comprises the steps of 1) adding a lithium source in alcohol, stirring uniformly the alcohol to obtain a settled solution; adding a titanium source in the vigorous stirring condition to obtain a transparent solution A; 2) adding a high-molecular polymer in a mixed solution of alcohol and de-ionized water, stirring the mixed solution to completely dissolve the high-molecular polymer, and then adding glacial acetic acid to obtain a mixed gelatinoid B; 3) adding the mixed gelatinoid B in the solution A drop by drop in the vigorous stirring condition, stirring the solution for 2-3 hours to obtain a gel, then aging and drying the gel to obtain a dry gel; 4) heating the dry gel in a muffle furnace, then thermally insulating the dry gel at 600 to 800 DEG C for 5 to 8 hours, and cooling the gel to be at the room temperature so as to obtain the lithium ...

Porcelain granules containing carbon and preparation method thereof

The invention discloses a preparation method for porcelain granules containing carbon. According to the weight percentage, 5%-40% of carbon powder, 5%-25% of gold mine tailing powder and 35%-70% of fly ash make up main raw materials. The preparation method comprises the steps of: (1) the gold mine tailing powder is dipped in a HCl solution; (2) the carbon powder, the fly ash and the modified minetailing powder are uniformly blended; and then water is added for wet mixing; (3) the wet material is prepared into spheric granules with the grain diameter of 5-20mm; (4) the spheric granules are dried and sintered to obtain the porcelain granules containing carbon. The porcelain granules containing carbon are multifunctional porcelain granules with the functions of adsorption, light weight, highstrength, heat preservation, thermal insulation, etc.

Gene chip and kit for detecting human papillomavirus (HPV)

The invention discloses a gene chip for detecting human papillomavirus (HPV), comprising a solid carrier and a human papillomavirus detecting probes fixed on the solid carrier. The detecting probes comprise nucleotide sequences in SEQ ID No.9-37, and the 27 types of HVP subtype specific probes in the invention correspondingly comprise 22 kinds of high-risk and mediate-risk HPV, and 5 kinds of low-risk HPV and two kinds of high-risk HPV integration (HPV16/HPV18). The invention also discloses a detecting kit for detecting various subtypes of HPV in a sample with high speed and high flux, and the kit comprises the gene chip, a primer sequence for detection, a human GAPDH gene, special HPV lysing solution, PCR reaction liquid and a color reagent, wherein the detecting probe fixed on the gene chip has the nucleotide sequence in the SEQ ID No.9-37; the primer sequence for detection is used for amplifying the DNA sequence of the HPV in a clinical sample, and the human GAPDH gene is used for amplifying ...

Carbon-containing wall surface decoration materials and method for preparing the same

The invention discloses a method for preparing carbon-containing wall surface decoration materials. The raw materials comprise 5 to 50 percent of carbon, 0 to 70 percent of diatomaceous earth and 0 to 50 percent of clay by weight. The method comprises the following steps: 1) washing the clay with water to remove impurities on the surface; 2) respectively grinding the washed clay, the diatomaceous earth and the carbon; 3) blending and mixing clay powder, diatomaceous earth powder and carbon powder with water, and then standing the mixture; 4) shaping the acquired mixture at a pressure of between 30 and 80 MPa; 5) drying the acquired unburned bricks; and 6) calcining the acquired dried unburned bricks for 3 to 4 hours, and cooling the calcined bricks to acquire the carbon-containing wall surface decoration materials. The invention also discloses the carbon-containing wall surface decoration materials which have the functions of absorption, humidification, heat preservation and insulation ...

Intelligent door, window and sunshade integrated device

The invention discloses an intelligent door, window and sunshade integrated device. The device comprises an intelligent control system, a window frame system and a sunshade shutter system, wherein the intelligent control system comprises an optical radiation intensity sensor (1), a signal receiving control component (2) and the like; the window frame system comprises a frame (9); a heat insulation hollow vitreous body (7) is arranged in the frame (9); the sunshade shutter system comprises a blind (6) which consists of a dentiform scroll component (5) and aluminum foil leaves (61); the dentiform scroll component (5) is used for controlling the rolling of the blind (6) and an overturning angle of the aluminum foil leaves (61); the blind (6) and the dentiform scroll component (5) are arranged in the cavity of the heat insulation hollow vitreous body (7); and the cavity of the heat insulation hollow vitreous body (7) is full of inert gas (8). The device can not only automatically adjust the ...

Pyroceram-ceramic composite plate and preparation method thereof

The invention discloses a pyroceram-ceramic composite plate. The pyroceram in the composite plate consists of main materials and antimony trioxide (Sb2O3), wherein the Sb2O3 accounts for 0.8 to 1.2 percent of the total weight of the main materials; and the main materials consist of the following components in percentage by weight: 45 to 55 percent of silicon dioxide (SiO2), 4 to 10 percent of magnesium oxide (MgO), 15 to 20 percent of calcium oxide (CaO), 10 to 14 percent of aluminum oxide (Al2O3), 3 to 6 percent of sodium oxide (Na2O) or potassium oxide (K2O) and 6 to 10 percent of calcium fluoride (CaF2). The invention also discloses a method for preparing the pyroceram-ceramic composite plate. The method comprises the following steps of: 1) mixing the main materials and the Sb2O3 uniformly and heating the mixture; 2) pouring the obtained glass liquid into an iron mould to form and cool, then annealing, and preparing the obtained mother glass into glass powder and glass particles respectively ...

Transparent lyophobic alumina film and preparation method thereof

The invention discloses a preparation method of a transparent lyophobic alumina film, comprising the following steps: 1) aluminium iso-propoxide and water are mixed according to weight ratio of 1:60-1:110 for 6-12 hours of hydrolysis in water bath at 60-100 DEG C after pH value is adjusted to 2-4 to obtain alumina sol; 2) a matrix is immersed in the alumina sol, dipping and drawing method is employed for film forming on the surface of the matrix to obtain a matrix with film; the thickness of the film is 5-15 Mum; 3) the matrix with film is immersed in deionized water at 80-100 DEG C for 10-60seconds of treatment after 15-60 seconds of heat treatment in a high temperature furnace at 300-500 DEG C to obtain treated matrix with film; 4). coating the surface of the treated matrix with film with a surface active agent to obtain the transparent lyophobic alumina film after drying of the matrix. The transparent lyophobic alumina film prepared by the method has excellent hydrophobic propertyand ...

Titanium dioxide sol reinforced corundum-mullite product and production method thereof

The invention discloses a titanium dioxide sol reinforced corundum-mullite product which is produced from the following materials in percentage by weight: 15-55% of corundum particles, 15-55% of mullite particles, 15-45% of aluminum micro powder, 15-25% of silicon micro powder and 0-40% of andalusite particles, wherein the corundum particles, the mullite particles and the andalusite particles are all smaller than 3mm, both aluminum micro powder and the silicon micro powder are not larger than 2 mu m, and titanium dioxide sol accounting for 5-20% of the gross weight of the materials is used as the binding agent. the invention also provides a production method of the titanium dioxide sol reinforced corundum-mullite product, which comprises the following steps of: (1) mixing all the materials in a mixer under a dry condition; (2) adding titanium dioxide sol to the obtained dry power, and then mixing under a wet condition; and (3) sequentially carrying out ageing treatment, pressure molding ...

Method for preparing porous lanthanum zirconate block

The invention discloses a method for preparing a porous lanthanum zirconate block. The method comprises the following steps: at room temperature, dissolving inorganic salt of zirconium, inorganic salt of lanthanum and a phase separation inducer in a solvent and stirring until a transparent and clarified solution is obtained; adding a drying control chemical additive and stirring; adding a gel accelerator and stirring to obtain a homogeneous solution; placing the homogeneous solution into a sealed container and standing for 10-30 minutes at 30 DEG C-80 DEG C to obtain wet gel; aging the wet gel for 12-24 hours at 35-80 DEG C, firstly cleaning the wet gel with a solvent with a low surface tension and then soaking the wet gel with a surface modifier solution, and finally cleaning with the solvent with the low surface tension; drying the cleaned wet gel for 24-72 hours at 30-90 DEG C; and then carrying out heat treatment on the dried wet gel for 2-4 hours at 400-1300 DEG C to obtain the porous ...

Bamboo charcoal-based far infrared composite material and method for preparing same

The invention discloses a preparation method for charcoal-based far-infrared composite materials, comprising the following steps: (1), the following components are taken as raw materials based on weight percentage: 50%-95% of charcoal, 0.5%-30% of tourmaline, 1-10% of clay and 0.5-20% of maifan stone; (2), all the materials are put into deionized water, then binder is added to the water for ball-mill mixing; (3), the mixture obtained from the step (2) goes through high pressure forming and is then put into a vacuum graphite sintering furnace and calcined in a protective atmosphere of nitrogen;(4), the calcined product obtained from the step (3) is cooled to room temperature to get the charcoal-based far-infrared composite material. The invention also discloses the charcoal-based far-infrared composite material prepared through the method. The charcoal-based far-infrared composite material of the invention has high far-infrared emissivity and is environmental-friendly and healthy.

Lithium-sulfur battery for early warning of internal short circuit and early warning method thereof

The invention belongs to the technical field of lithium batteries, and particularly relates to a lithium-sulfur battery for early warning of an internal short circuit and a preparation and early warning method thereof. The invention discloses a lithium-sulfur battery capable of early warning internal short circuit, which comprises a battery core body positioned in a battery shell, electrolyte is arranged in the battery shell, and the battery core body consists of a sulfur positive electrode, an upper diaphragm, a conductive interlayer, a lower diaphragm and a lithium negative electrode which are sequentially arranged from top to bottom. The invention also discloses an early warning method for the internal short circuit of the lithium-sulfur battery. The early warning method comprises the following steps: detecting the electrode potential phi of the conductive interlayer; detecting the electrode potential of the sulfur positive electrode to be phi +; the state of the lithium-sulfur battery ...

Preparation method of carbon in-situ composite titanium dioxide lithium ion battery negative electrode material

The invention discloses a preparation method of a carbon in-situ composite titanium dioxide lithium ion battery negative electrode material. The preparation method sequentially comprises the following steps: (1) dropwise adding a titanium source precursor into absolute ethyl alcohol and stirring; (2) uniformly mixing de-ionized water and alcohol; adding a phase separation inductive agent and then adding a chelating agent, and stirring; (3) dropwise adding the solution obtained by the step (2) into the solution obtained in the step (1) under violent stirring; stirring to obtain gel; after sealing, ageing the gel at 35-45 DEG C for 10-24 hours; carrying out solvent displacement by using the de-ionized water and an organic solvent and drying the gel subjected to displacement at 50-65 DEG C for 3-5 days to obtain dry gel; and (4) putting the dry gel into an inert atmosphere furnace and treating for 3-5 hours at 500-800 DEG C to obtain the carbon in-situ composite titanium dioxide lithium ion ...

Preparation method of porous calcium-aluminum stone block

The invention discloses a preparation method of a porous calcium-aluminum stone block. The method is characterized by comprising the following steps: 1) respectively dissolving calcium chloride dehydrate, aluminum chloride hexahydrate and polyoxyethylene in a solvent; 2) cooling a transparent clear solution obtained by the step 1) to 0 DEG C, slowly adding propylene epoxide, evenly stirring and carrying out ultrasonic treatment in an ultrasonic instrument for 20 to 30 seconds; 3) feeding a homogeneous solution obtained by the step 2) into a container, sealing and then gelling for 15 to 20 minutes at 35 DEG C to 45 DEG C; 4) aging wet gel obtained by the step 3) for 20 to 30 hours at 35 DEG C to 45 DEG C; and 5) drying aged gel obtained by the step 4) for 80 to 90 hours at 50 DEG C to 70 DEG C and then carrying out heat treatment for 2 to 4 hours at 400 DEG C to 1100 DEG C so as to obtain the porous calcium-aluminum stone block. The porous calcium-aluminum stone block prepared by using the ...

Zirconium sol reinforced corundum-mullite product and production method thereof

The invention discloses a zirconium sol reinforced corundum-mullite product. The raw materials of the product comprise the following components by weight percent: 10%-50% of corundum particles, 10%-50% of mullite particles, 10%-40% of aluminum micropowder, 10%-20% of silicon micropowder and 0%-9% of andalusite particles, and 5%-20% of zirconium dioxide sol is added in the raw materials to preparethe product. The invention also discloses a production method of the zirconium sol reinforced corundum-mullite product. The method comprises the following steps: 1) placing all the raw materials in amixer for dry mixing; then adding zirconium dioxide sol for wet mixing; and 2) pressing the obtained ageing mixture for forming, drying for 1-2 days naturally, and firing at 1450-1700 DEG C. The zirconium sol reinforced corundum-mullite product of the invention has good compressive strength, breaking strength and thermal shock resistance.

Bidirectional alternate type grouting and water plugging technology for governing laneway wash apron

The invention discloses a bidirectional alternate type grouting and water plugging technology for governing laneway wash apron. The bidirectional alternate type grouting and water plugging technology comprises the steps that 1, anchor rod hole positioning is conducted; 2, rock drilling and punching are conducted; 3, anchor rod driving and grouting are conducted; 4, grouting and water plugging are conducted; and 5, the hollow grouted anchor rod is recycled.

Boride reinforced silicon carbide ceramics and preparation method thereof

The invention discloses a preparation method of boride reinforced silicon carbide ceramics, taking silicon carbide powder, yttrium aluminum garnet and boride micro-powder as main raw materials and comprising the following steps: 1. adding the main raw materials, binding agent and dispersant into de-ionized water followed by ball-milling and mixing to prepare water-base silicon carbide slurry; 2. spray drying the water-base silicon carbide slurry with a spray granulating technique to obtain the silicon carbide granulation powder; 3. molding the silicon carbide granulation powder by dry pre-pressing and cold isostatic final pressing to obtain high density silicon carbide green brick; and 4. placing the high density silicon carbide green brick in a vacuum pressure-free sintering furnace to be heated to 1,900-2,000 DEG C and kept for 1-1.5 hours to obtain boride reinforced silicon carbide ceramics. The boride reinforced silicon carbide ceramics prepared by the method has the characteristics ...

Method of preparing high-strength wear-resisting glass ceramics by utilizing iron tailings

The invention discloses a method of preparing high-strength wear-resisting glass ceramics by utilizing iron tailings. The method comprises the following steps of preparing raw materials comprising the following components in parts by weight: 35-40 parts of iron tailings, 20-25 parts of quartz, 10-12 parts of magnesium carbonate, 13-15 parts of aluminum oxide, 3-4 parts of calcium oxide, 6-7 parts of titanium oxide, 3-5 parts of boron oxide and 1 part of antimony oxide; mixing the materials, fusing the materials at 1450 DEG C-1500 DEG C, preserving the heat, carrying out compression molding or calendaring molding on the obtained molten glass, annealing plate-shaped glass and then preserving the heat for 3-5 hours at 950 DEG C-1000 DEG C, and cooling to the room temperature to obtain the high-strength wear-resisting glass ceramics. The method is a preparation method of CMAS glass ceramics, which takes iron tailings as main materials and realizes integral crystallization.

Plate type water filtering apparatus

A plate-type water filter is composed of an assembled unit with water-tight top and bottom covers which have a central hole and at least one side hole, two stirring layers and two filtering units respectively arranged between said assembled unit and top and bottom covers, an annular bearing base for said assembled unit, and an external ring of said bearing base. Said stirring layer is installed in the through hole of said bearing base in rotary mode and limited by the track on said external ring.

Reagent for detecting copy number of EGFR gene and ploidy of chromosome 7

HPV (human papillomavirus) detection and typing method

The invention relates to an HPV detection and typing method, which comprises the following steps: carrying out lysis and separation on HPV in a biological sample by using HPV lysate to extract nucleic acid; amplifying an HPVL1 nucleic acid fragment from the nucleic acid obtained in the previous step by using specific primers SEQ ID No.1-SEQ ID No.4; carrying out pyrophosphoric acid sequencing reaction on the obtained HPVL1 nucleic acid fragment, wherein a pyrophosphoric acid sequencing primer is selected from any one or several of primers SEQ ID No.5-SEQ ID No.31; and comparing sequences read by pyrophosphoric acid sequencing with HPV type sequences to judge an HPV typing result. The invention detects and types the HPV in the biological sample by utilizing a DNA (deoxyribonucleic acid) bar code technique and a pyrophosphoric acid sequencing technique and can be used for estimating the carcinogenesis/progression of genital tract cancer and relevant diseases and carries out prognosis guidance ...

Method for preparing silicon carbide micropowder

The invention discloses a method for preparing silicon carbide micropowder, using bamboo charcoal micropowder as carbon source and silica sol as silicon source, and including the following steps: (1) selecting the bamboo charcoal micropowder with the particle size of 0.2 to 0.3 mum; (2) preparing homogeneity composite precursor: the bamboo charcoal micropowder, the silica sol, the dispersant and the catalyst are mixed, the mixture is in the ultrasonic treatment for 15 to 30 minutes, then is in the strong mechanical stirring for 6 to 12 hours to obtain the homogeneity composite precursor; (3) preparing silicon carbide micropowder: the homogeneity composite precursor is solidificated, then the solidificated precursor is heated in a vacuum high-temperature sintering furnace at 1600 to 2200 DEG C for 1 to 6 hours to obtain the silicon carbide micropowder. The silicon carbide micropowder prepared by the method has high purity, controllable particle size distribution and the like.

Group B streptococcus (GBS) nucleic acid detection kit and detection method

The invention discloses a group B streptococcus (GBS) nucleic acid detection kit and a detection method. The kit comprises single primer isothermal amplification enzyme (SPIA), a SPIA reaction liquid, a RIDA reaction system, a SPIA reaction primer, a RIDA probe, an internal amplification control RIDA primer and an internal amplification control RIDA probe, wherein the single primer isothermal amplification enzyme (SPIA) comprises BstDNA polymerase and RNaseH; the SPIA reaction liquid comprises dNTPs, a primer, Bst enzyme buffer and RNaseH buffer; the RIDA reaction system comprises nicking endonuclease Nb.BtsI and a probe; the sequence of the SPIA reaction primer is 5'-3'UCGAUCAUGTTAGCCGC, eight bases at the position after the 5' end are RNA, and the other bases are DNA; the sequence of the RIDA probe is 5'-3'GCTGAGTCCCCTTTCTTGACAAT; the sequence of the internal amplification control RIDA primer is 5'-3'CUGUCGAUCGCAATCGG, and eight bases at the position after the 5' end are RNA, and the ...

Preparation method of superfine-capsule-type gel breaker for shale gas fracturing fluid

The invention discloses a preparation method of a superfine-capsule-type gel breaker for a shale gas fracturing fluid. The method comprises the following steps: preparing a formula containing 65% to 75% of gel breaker saturation solution, 9% to 11% of porous microspheres, 5.5% to 10.5% of hot-melting material, 5.5% to 10.5% of cationic emulsifier or neutral emulsifier and 2% to 6% of anionic emulsifier; then, sequentially carrying out porous microsphere loading, formation of hot-melting coating and stabilization of a coating layer; and finally, carrying out suction filtration, washing and drying. The particle diameter of the obtained superfine-capsule-type gel breaker is only between 5mu m and 50mu m. According to the superfine-capsule-type gel breaker, the problem that the gel breaking of the fracturing fluid in a micropore channel of a rock stratum cannot be fully carried out is effectively solved; the gas yield of a shale gas is obviously increased. The method is simple in preparation ...

Method and system for implementation of roaming calling in one-card multi-number service

The invention provides a method and a system for implementation of roaming calling in a one-card multi-number service. The method includes: a one-card multi-number client makes a calling request; the client and a server perform interactive comparison to judge whether a user is in roaming or not; if yes, the client starts secondary dialing automatically, and separation of number receiving and call proceeding is realized; the server makes calls to an exchanger, and call proceeding is completed after the exchanger replays a confirm message. The invention further discloses a method for user roaming judgment in the one-card multi-number service. By the method and the system, when the user is in nonlocal roaming, roaming calling of a minor number can be realized as well, and the defect of limits on bit length of the exchanger is overcome by means of automatic secondary calling.

Transparent lyophobic alumina film and preparation method thereof

The invention discloses a preparation method of a transparent lyophobic alumina film, comprising the following steps: 1) aluminium iso-propoxide and water are mixed according to weight ratio of 1:60-1:110 for 6-12 hours of hydrolysis in water bath at 60-100 DEG C after pH value is adjusted to 2-4 to obtain alumina sol; 2) a matrix is immersed in the alumina sol, dipping and drawing method is employed for film forming on the surface of the matrix to obtain a matrix with film; the thickness of the film is 5-15 Mum; 3) the matrix with film is immersed in deionized water at 80-100 DEG C for 10-60 seconds of treatment after 15-60 seconds of heat treatment in a high temperature furnace at 300-500 DEG C to obtain treated matrix with film; 4). coating the surface of the treated matrix with film with a surface active agent to obtain the transparent lyophobic alumina film after drying of the matrix. The transparent lyophobic alumina film prepared by the method has excellent hydrophobic property and ...

Adsorption decomposition agent and preparation method thereof

The invention discloses an adsorption decomposition agent. 90 to 95 mass percent of bamboo charcoal grains and 5 to 10 mass percent of tourmaline grains form a base material; and titanium dioxide sol serving as photo-catalyst, which accounts for 10 to 20 percent of the total weight of the base material, is added into the base material and is used as an additive. The invention also discloses a preparation method for the adsorption decomposition agent, which comprises the following steps of: 1) performing ball-milling and mixing on the base material to obtain a dry powdery material; 2) adding the titanium dioxide sol serving as the photo-catalyst into the dry powdery material for ball milling and mixing to obtain a mixture; and 3) drying, sieving and thermally processing the mixture to obtain the adsorption decomposition agent. The adsorption decomposition agent has the characteristics of high adsorption, catalytic decomposition in the presence of light and antibacterium.

Adsorption decomposition agent and preparation method thereof

The invention discloses an adsorption decomposition agent. 90 to 95 mass percent of bamboo charcoal grains and 5 to 10 mass percent of tourmaline grains form a base material; and titanium dioxide sol serving as photo-catalyst, which accounts for 10 to 20 percent of the total weight of the base material, is added into the base material and is used as an additive. The invention also discloses a preparation method for the adsorption decomposition agent, which comprises the following steps of: 1) performing ball-milling and mixing on the base material to obtain a dry powdery material; 2) adding the titanium dioxide sol serving as the photo-catalyst into the dry powdery material for ball milling and mixing to obtain a mixture; and 3) drying, sieving and thermally processing the mixture to obtain the adsorption decomposition agent. The adsorption decomposition agent has the characteristics of high adsorption, catalytic decomposition in the presence of light and antibacterium.

Method for preparing silicon carbide ceramic

The invention discloses a method for preparing silicon carbide ceramic. The method comprises the following steps of: 1) ball-milling and mixing a main material, a dispersant, a binder and de-ionized water, wherein the main material consists of 92 to 96 weight percent of silicon carbide and 4 to 8 weight percent of mixture of lanthanum oxide and silicon dioxide; 2) spraying and granulating the obtained water-based silicon carbide slurry; 3) dry-pressing the obtained silicon carbide powder making granules and forming at one time; and 4) placing an obtained silicon carbide biscuit into a vacuum high-temperature sintering furnace for sintering at the temperature of between 1,750 and 1,900 DEG C for 0.5 to 2 hours to obtain the silicon carbide ceramic. The silicon carbide ceramic prepared by the method has the characteristics of reducing sintering temperature, reducing proportion of a sintering auxiliary agent, improving performance, reducing production cost and the like.

Fluorescence PCR detection kit used for RNaseP gene and detection method

The invention relates to the molecular biology field, and more specifically relates to a rapid detection kit for endogenous reference gene human ribonucleases P(RNaseP) and a detection method. A primer and a probe of the present invention comprise a specific upstream primer, a downstream primer and a Taqman probe used for detecting the RNaseP gene.

Cobalt-containing blue microcrystalline glass and prepration method thereof

The invention discloses a cobalt-containing blue microcrystalline glass which consists of base glass and cobalt monoxide with the weight ratio of cobalt monoxide to base glass of 0.001-0.1%, and the base glass comprises the following components by weight percent: 62% of silicon dioxide, 8.2% of lithium oxide, 18% of aluminum oxide, 0.7% of magnesium oxide, 0.7% of zinc oxide, 0.7% of barium oxide, 0.7% of boron oxide, 4.5% of titanium oxide, 2% of potassium oxide, 1% of sodium oxide and 1.5% of antimony trioxide. The invention simultaneously discloses the preparation method which comprises the following steps: melting raw materials obtained by ball milling treatment at the temperature of 1380 DEG C-1450 DEG C, pouring the obtained glass liquid into a mold for molding, annealing the moldedglass at the temperature of 480-520 DEGC, then cooling and carrying out heat treatment at the temperature of 600 DEG C-750 DEG C. The cobalt-containing blue microcrystalline glass has high and strongheat ...

Silicon carbide short fiber toughened and strengthened silicon carbide ceramics and preparation method thereof

The invention discloses a preparation method of silicon carbide short fiber toughened and strengthened silicon carbide ceramics, which takes silicon carbide powder, yttrium aluminum garnet and silicon carbide short fiber as the main materials and sequentially comprises the following steps of: 1) adding the main materials, a caking agent and a dispersant into de-ionized water and preparing water-based silicon carbide slurry after ball-mill mixing; 2) adopting a sponging drying technique to carry out spray drying to the water-based silicon carbide slurry; 3) adopting 160-200MPa to carry out dry pressing and shaping to the obtained strengthened silicon carbide palletizing powder to obtain a silicon carbide biscuit; and 4) arranging the silicon carbide biscuit in a vacuum pressureless sintering furnace for sintering to obtain the silicon carbide short fiber toughened and strengthened silicon carbide ceramics. The invention simultaneously provides the silicon carbide short fiber toughened and ...

Nanometer composite silicon carbide ceramic and preparation method thereof

This invention discloses a method for preparing nanometer complex silicon carbide ceramics. The production procedures are: (1), the main raw materials (silicon carbide, yttrium aluminium garnet), adhesion agent, water-soluble high molecular mixture sol, dispersing agent are added into de-ionized water, mixed by ball-milling, to produce water-based silicon carbide slurry with its solid content of 30-60%; (2), proceeding spray-drying to obtain powder; (3), two-step formation to obtain blank of silicon carbide; (4), being sintered in vacuum sintering furnace to obtain the final product. This inventive method is of simple process and the inventive product is with excellent properties.

A preparation method of nanometer composite silicon carbide ceramic

Bamboo charcoal-containing architectural coating and preparation method thereof

The invention discloses a bamboo charcoal-containing architectural coating, which comprises the following raw materials in parts by weight: 60-85 parts of acrylic emulsion, 60-80 parts of titanium white, 75-100 parts of bamboo charcoal absorption disintegrant, 200-300 parts of calcium carbonate, 300-400 parts of water, 1-2 parts of antifoaming agent 090, 5-10 parts of sodium polyacrylate and 1-2 parts of polypropylene oxide. The invention also provides a preparation method of the coating, comprising the following steps: 1) dissolving the sodium polyacrylate in the water, and adding the calcium carbonate and the titanium white for stirring; 2) adding the bamboo charcoal absorption disintegrant to the mixture in step 1) for stirring; and 3) adding the antifoaming agent 090and the polypropylene oxide to the mixture in step 2) for mixing, and then adding the acrylic emulsion. The bamboo charcoal-containing architectural coating has a capacity of absorbing and decomposing organic matters.

Method for determining coring condition of glass containing crystal nucleus agent

The invention discloses a determination method for nucleation conditions of glass containing crystal nucleus agents, which adopts differential thermal analysis method to obtain a best nucleation temperature and a best nucleation time, wherein specifically obtaining the best nucleation temperature is, proceeding differentially thermally analysis of the glass containing crystal nucleus agents after annealing, selecting different temperature points to proceed pre-nucleation treatment, then proceeding differentially thermally analysis of glass which is pre-nucleation treated, the pre-nucleation temperature relative to the minimum crystallization peak temperature is the best nucleation temperature of glass-ceramics. Specially obtaining the best nucleation time is, at the best nucleation temperature, selecting different time points to have pre-nucleation treatment, then proceeding differentially thermally analysis of glass which is pre-nucleation treated, the pre-nucleation time relative to the ...

Direct fluorescent PCR detection kit for rs8099917 single nucleotide polymorphism and application thereof

The invention discloses a direct fluorescent PCR detection kit for rs8099917 single nucleotide polymorphism and an application thereof. The kit comprises a detection PCR reagent, a positive control PCR reagent and a negative control PCR reagent, wherein the detection PCR reagent comprises specific primer 1 and primer 2, a probe 1 and a PCR Mixture 1 of a single nucleotide polymorphism rs8099917 site. According to the kit, a human oral swab sample or a human peripheral blood sample is directly used as a template and is added into an optimized PCR reaction system for detecting, the process is completed in one step, and a cap does not need to be opened, so that experiment operation steps can be reduced, time can be saved, and sample pollution caused by cap opening operation can be avoided.

Preparation method of nano-silver loaded porous silicon dioxide

The invention discloses a preparation method of nano-silver loaded porous silicon dioxide. The preparation method of nano-silver supported porous silicon dioxide comprises the step of preparing hierarchy porous silicon dioxide by polyoxyethylene, and also comprises the following steps: 1) modifying the hierarchy porous silicon dioxide by taking amino propyl triethoxy silicane as a modifying agent and by adopting absolute ethyl alcohol as a modifying solvent; 2) loading: dissolving silver nitrate into glycol as a reducing agent, and carrying out magnetic stirring so as to obtain a glycol solution of silver nitrate; firstly, cleaning the modified hierarchy porous silicon dioxide obtained in the step 2) with deionized water, and then putting into the glycol solution of silver nitrate, and loading for 48-72 hours in a baking oven at 35-45 DEG C; forming nanoscale silver particles by taking glycol as a reducing agent to reduce silver nitrate; loading the nano silver particles to the modified ...

Reagent for detecting copy number of EGFR gene and ploidy of chromosome 7

The invention discloses a reagent for detecting a copy number of an EGFR gene and the ploidy of a chromosome 7. The reagent comprises a fluorescence probe RP11-339F13 used for detecting the copy number of the EGFR gene and a fluorescence probe RP11-144H20 used for detecting the ploidy of the chromosome 7, wherein the RP11-339F13 is cloned by BAC, which covers the whole EGFR gene, and marked with rhodamine fluorescein; and RP11-144H20 is cloned by specific BAC of the centromere of the chromosome 7 and marked with fluorescein isothiocyanate. The reagent can quickly, simply and conveniently detect the copy number of the EGFR gene and the ploidy of the chromosome 7, contributes to the judgment of medicament susceptibility and prognostic judgment, and has great significance for the guidance of use of molecular targeted medicament tyrosine kinase inhibitors (TKIs) of tumors, such as non-small cell lung cancer and the like.

Purplish-red glass-ceramic containing neodymium and preparation method thereof

The invention discloses purplish-red glass-ceramic containing neodymium. The base material of the purplish-red glass-ceramic containing neodymium comprises the following components by weight percent: 60-61 percent of silicon dioxide, 9-11 percent of Lithia, 18-19 percent of aluminum oxide, 1.5-2 percent of a mixture I consisting of magnesium oxide, zinc oxide, barium oxide and boron oxide, 4-5 percent of titanium oxide, 2.5-3.5 percent of a mixture II consisting of potassium oxide and sodium oxide and 1.5-2 percent of antimony trioxide. The weight percentage of neodymium nitrate acting as colorant in the base material is 0.1-2 percent. The invention also discloses a preparation method of the purplish-red glass-ceramic containing neodymium, comprising the following steps of: evenly mixing the base material and the neodymium nitrate, ball milling, melting, molding, annealing and heat treatment. The purplish-red glass-ceramic containing neodymium prepared by the method has stable and pure ...

高效率低成本的膜蒸馏海水淡化系统

The efficient and cheap sea water desalting membrane distillation system includes one sea water feeding loop; one micro bubble forming unit to pump sea water, pressurize and emulsify sea water into work liquid containing saturated water vapor; one desalting unit with at least one ventilation room, porous hydrophobic membranes inside the ventilation room, separate high temperature sea water regions, into which work liquid containing saturated water vapor is pumped into, and low temperature condensated fresh water regions; and one condensating desalting unit to condensate fresh water connected successively.

Plate type water filtering device

A plate-type water filter is composed of the top and bottom plates with ring slot, central hole and side hole, a group of basic plates with ring slots on their upper and lower surfaces, and central hole, and several filter units consisting of at least two filtering membranes, central water outlet, and turnable upper and lower net layers. Said top and bottom plates are connected to top and bottom basic plate in water-tight mode. It has long service life.

Titanium carbide micropowder and preparation method thereof

The invention discloses a method for preparing titanium carbide micropowder. The method comprises the following steps:1), preparing a titanium carbide precursor, wherein bamboo charcoal powder is added in titanium dioxide sol under a stirring condition, the mixture is stirred for 1 to 2 hours and then placed in an ultrasonic cleaner to be cleaned by ultrasonic waves for 15 to 30 minutes, and the product of the ultrasonic cleaning is dried at 160 to 200 DEG C in an oven and then ground into powder to obtain the homogeneous titanium carbide precursor, and the molar ratio of the titanium dioxide to the carbon in the bamboo charcoal powder is 1:3; and 2) placing the homogeneous titanium carbide precursor in a vacuum sintering furnace and heating the homogeneous titanium carbide precursor at 1,600 to 1,900 DEG C for 1 to 6 hours to obtain the titanium carbide micropowder. The invention also discloses the titanium carbide micropowder prepared by the method. The titanium carbide micropowder prepared ...

Method for preparing fluorine phosphorus composite opacifying glass

The invention discloses a method for preparing a fluorophosphate composite opaque glass, which comprises the following steps: 1) raw material preparation: 50 to 65 portions of silica, 0.5 to 6.5 portions boron oxide, 2 to 5 portions alumina, 10 to 17.5 portions calcium oxide, 0.5 to 6 portions of magnesium oxide, 0.5 to 2 portions of zinc oxide, 5 to 10 portions of sodium oxide, 5 to 8 portions of phosphorus pentoxide, 0.5 to 2 portions of sodium fluosilicate and 1 portion of calcium nitrate. The materials form the raw material after evenly mixing; 2) the raw material is melted under the temperature ranging from 1,300 DEG C to 1,480 DEG C and a clarification; the material then is extruded and pulled for shaping; an annealing is followed and the material is then cooled to a normal temperature. After a polishing and a cutting, the fluorophosphate composite opaque glass is obtained. The method for preparing the fluorophosphate composite opaque glass in the invention has the advantages of not ...

Codoping titanium dioxide nano sol and preparation method thereof

Bamboo charcoal-based far infrared composite material and method for preparing same

The invention discloses a preparation method for charcoal-based far-infrared composite materials, comprising the following steps: (1), the following components are taken as raw materials based on weight percentage: 50%-95% of charcoal, 0.5%-30% of tourmaline, 1-10% of clay and 0.5-20% of maifan stone; (2), all the materials are put into deionized water, then binder is added to the water for ball-mill mixing; (3), the mixture obtained from the step (2) goes through high pressure forming and is then put into a vacuum graphite sintering furnace and calcined in a protective atmosphere of nitrogen; (4), the calcined product obtained from the step (3) is cooled to room temperature to get the charcoal-based far-infrared composite material. The invention also discloses the charcoal-based far-infrared composite material prepared through the method. The charcoal-based far-infrared composite material of the invention has high far-infrared emissivity and is environmental-friendly and healthy.

Black high-strength microcrystalline glass and its preparation method

Calcium phosphate opaque glass and method for making same

The invention discloses a manufacturing method for calcium phosphate opaque glass, which includes following steps: firstly, 70-75 portions of silicon dioxide, 0.5-2.0 portions of alumina, 8.0-12.0 portions of calcium oxide, 2.0-5.0 portions of magnesium oxide, 9.8-15.0 portions of sodium oxide, 1-3 portions of phosphorus pentoxide, 0.1-0.2 portions of boron oxide and 0.1-0.5 portions of calcium nitrate are evenly mixed into raw material; secondly, the raw material is melted and clarified and is stretched into forming through squeezing to obtain raw glass; thirdly, the heat treatment of opacifying is implemented on the raw glass, whish is then cooled to be at the normal temperature, and the polishing and the cutting forming are implemented successively to obtain the calcium phosphate opaque glass. The invention also provides the calcium phosphate opaque glass, which is made according to the preparation method. The calcium phosphate opaque glass of the invention has the advantage of perfect ...

Method for preparing fluorine phosphorus composite opacifying glass

The invention discloses a method for preparing a fluorophosphate composite opaque glass, which comprises the following steps: 1) raw material preparation: 50 to 65 portions of silica, 0.5 to 6.5 portions boron oxide, 2 to 5 portions alumina, 10 to 17.5 portions calcium oxide, 0.5 to 6 portions of magnesium oxide, 0.5 to 2 portions of zinc oxide, 5 to 10 portions of sodium oxide, 5 to 8 portions of phosphorus pentoxide, 0.5 to 2 portions of sodium fluosilicate and 1 portion of calcium nitrate. The materials form the raw material after evenly mixing; 2) the raw material is melted under the temperature ranging from 1,300 DEG C to 1,480 DEG C and a clarification; the material then is extruded and pulled for shaping; an annealing is followed and the material is then cooled to a normal temperature. After a polishing and a cutting, the fluorophosphate composite opaque glass is obtained. The method for preparing the fluorophosphate composite opaque glass in the invention has the advantages ofnot ...

Preparation method of elastic silicon dioxide aerogel material

The invention discloses a preparation method of an elastic silicon dioxide aerogel material, which comprises the following steps: 1) adding ammonium chloride into a 0.001-0.01 mol.L<-1> hydrochloric acid solution, sequentially adding a solvent methanol, a precursor and a template, magnetically stirring, adding 0.4-0.5 mol/L ammonia water as a gel accelerator, stirring in a seal state for 50-70 minutes, and reacting in a 55-65 DEG C drying oven for 3-5 days; 2) carrying out primary replacement on the gel formed in the step 1) with an isopropanol-water mixed solution, and carrying out secondary replacement with isopropanol to obtain the gel subjected to solvent replacement; and 3) drying the gel subjected to solvent replacement in a 45-55 DEG C drying oven for 3-5 days to obtain the high-elasticity silicon dioxide aerogel material. The method can be used for obtaining the high-elasticity no-cracking silicon dioxide aerogel.

Membrane oxygen-enriched combustion device of lithium aluminosilicate glass melting furnace and using method thereof

The invention discloses a membrane oxygen-enriched combustion device of a lithium aluminosilicate glass melting furnace. The membrane oxygen-enriched combustion device of the lithium aluminosilicate glass melting furnace comprises a glass melting furnace (10), heavy oil spray guns (9), and an air blower (1), an air purifier (2), a gas separation device (3), a vacuum pump (4), a water gas separation device (5), a pressure stabilizing system (6), a preheating system (7) and oxygen-enriched air spray guns (8) which are connected with one another sequentially, wherein a nozzle of each heavy oil spray gun (9) is positioned in the glass melting furnace (10); one oxygen-enriched air spray gun (8) is correspondingly arranged below each heavy oil spray gun (9); and a nozzle of each oxygen-enrichedair spray gun (8) is positioned in the glass melting furnace (10). The invention also discloses an oxygen-enriched combustion method by using the oxygen-enriched combustion device by utilizing a lithium ...

膜蒸馏海水淡化法

A membrane distilling process for desalinating seawater includes filtering seawater, bubbling while pressure floating to rmeove seaweeds and solid impurities, bubbling again to mix air with water to become emulsion and making the bubbles contain saturated water vapour, delivering it into a desalinating equipment containing one or more porous hydrophobic membranes to penetrate the emulsion containing a lot of saturated water vapour through the membrane, and condensing the water vapour to obtain fresh water.

Preparation method of titanium dioxide/iron oxide composite anode material

The invention discloses a preparation method of a titanium dioxide/iron oxide composite anode material. The preparation method sequentially comprises the following steps of (1) dissolving titanyl sulfate into deionized water, then, adding iron salt, and stirring until the iron salt is dissolved; (2) adding polyvinylpyrrolidone into the solution obtained in the step (1), and stirring until polyvinylpyrrolidone is completely dissolved; (3) dropwise adding methanamide into the solution obtained in the step (2) while fiercely stirring, and aging gel after stirring for 5-10 minutes; (4) drying the gel obtained in the step (3) under normal pressure at 50-70 DEG C for 22-26 hours to obtain a precursor product; and (5) heating the precursor product at the air atmosphere to 500-800 DEG C, keeping the temperature for 5-7 hours, and cooling to the room temperature to obtain the titanium dioxide/iron oxide composite anode material. The titanium dioxide/iron oxide composite anode material has relatively-high ...

Preparation method of silver-loaded titanium dioxide anode material

The invention discloses a preparation method of a silver-loaded titanium dioxide anode material. The preparation method comprises the following steps of 1) stirring deionized water and ethylene glycol, and then adding titanyl sulfate to stir in order to obtain solution I; 2) adding polyvinylpyrrolidone into the solution I; 3) dropping methanamide into the solution II obtained in the step 2) under vigorous stirring, and drying after gel ageing in order to obtain aluminum hydroxide gel; 4) dissolving silver nitrate into alcohol to obtain mixed solution, adding the aluminum hydroxide gel, allowing the mixture to stand for 11-13 hours under the water bath condition of 50-70 DEG C, cleaning by utilizing deionized water, and drying at 50-70 DEG C for 11-13 hours to obtain a black gray block material; and 5) carrying out heat treatment on the black gray block material at 500 DEG C for 3-5 hours and cooling the material to the room temperature in order to obtain the silver-loaded titanium dioxide ...

Nano silicon carbide ceramic and preparation method thereof

板式滤水装置

A plate-type water filter is composed of two basic plates, a unidirectional guide plate, a water-tight top cover able to guide raw water, a water-tight bottom cover for discharging water, and several filter units. Said basic plates, top cover and bottom cover have relative ring channel unit. Said guide plate has arc channel unit. Its advantages are high filter effect and long service life.

Low-friction-factor silicon carbide ceramic sealing element and preparation method thereof

The invention discloses a low-friction-factor silicon carbide ceramic sealing element which is prepared from a main raw material, polyvinyl alcohol and tetramethyl ammonium hydroxide, wherein the main raw material comprises 65-75% of silicon carbide, 5-10% of boron nitride, 5-10% of fluoridized graphite, 5-10% of molybdenum disulfide and 10% of yttrium aluminium garnet; the polyvinyl alcohol accounts for 2.5-3.5 wt% of the main raw material; and the tetramethyl ammonium hydroxide accounts for 1.5-2.5 wt% of the main raw material. The preparation method comprises the following steps: (1) carrying out ball milling to mix the main raw material, polyvinyl alcohol, tetramethyl ammonium hydroxide and deionized water; (2) carrying out spray granulation on the obtained slurry; (3) putting the obtained granules in a mold, and carrying out dry pressing for primary molding; and (4) carrying out pressureless liquid-phase sintering on the obtained blank to obtain the low-friction-factor silicon carbide ...

Plate type water filtering apparatus

Method for preparing silicon carbide ceramic

Boron carbide micro powder and preparation method thereof

The invention discloses a preparation method of a boron carbide micro powder, which comprises the following steps: 1) mixing boron trioxide with bamboo carbon micro powder in the molar ratio of 2 to 7 at room temperature; and then mechanically grinding and crushing the mixture so as to obtain a homogeneous composite precursor; and 2) heating the homogeneous composite precursor in a vacuum sintering furnace for 1 to 4 hours at the temperature of 2,000 to 2,200 DEG C; and cooling the sintered product and taking the cooled product out so as to obtain boron carbide micro powder. The invention also provides the boron carbide micro powder prepared by the method. The boron carbide micro powder prepared by the method has the characteristics of high purity and controllable particle size distribution.

Plate type water filtering device

Boride reinforced silicon carbide ceramics and preparation method thereof

The invention discloses a preparation method of boride reinforced silicon carbide ceramics, taking silicon carbide powder, yttrium aluminum garnet and boride micro-powder as main raw materials and comprising the following steps: 1. adding the main raw materials, binding agent and dispersant into de-ionized water followed by ball-milling and mixing to prepare water-base silicon carbide slurry; 2. spray drying the water-base silicon carbide slurry with a spray granulating technique to obtain the silicon carbide granulation powder; 3. molding the silicon carbide granulation powder by dry pre-pressing and cold isostatic final pressing to obtain high density silicon carbide green brick; and 4. placing the high density silicon carbide green brick in a vacuum pressure-free sintering furnace to be heated to 1,900-2,000 DEG C and kept for 1-1.5 hours to obtain boride reinforced silicon carbide ceramics. The boride reinforced silicon carbide ceramics prepared by the method has the characteristics ...

Na2O-CaO-SiO2 opaque glass and preparation method thereof

The invention discloses Na2O-CaO-SiO2 opaque glass, which consists of the following components in percentage by weight: 59 to 70 percent of SiO2, 6.0 to 10 percent of CaO, 16 to 24 percent of Na2O, 1 to 2 percent of Al2O3, 0.5 to 3 percent of K2O, 1 to 3 percent of MgO, 1.0 to 5.0 percent of P2O and 1.0 to 5.0 percent of ZrO. The invention also discloses a method for preparing the opaque glass, which comprises the following steps of: 1) mixing materials, wherein Na2O is replaced by Na2CO3 with equal molar weight and K2O is replaced by K2CO3 with equal molar weight; 2) heating the mixed materials in a furnace to the temperature of between 1,420 and 1,470 DEG C for melting, and keeping the temperature for 2.8 to 3.2 hours; and 3) pouring molten glass obtained in the step 2) into a mould for forming, and naturally and slowly cooling to room temperature to obtain the milky opaque glass.

Detection reagents for severe acute respiratory syndrome coronavirus 2 and detection methods

The present invention provides a kit for quantitatively detecting a copy number of Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). The kit includes a nucleic acid extraction kit and a nucleic acid amplification kit. The nucleic acid extraction kit adopts a magnetic bead method to perform rapid nucleic acid lysis and adsorption on a sample. The nucleic acid amplification kit adopts a fluorescence quantitative RT-PCR technology for quantitative analysis. Meanwhile, optimal primer and probe sequences are designed, and a pseudotype virus containing SARS-CoV-2 and HCV gene fragments is used as a standard. A SARS-CoV-2 content of a pseudotype virus stock solution is subjected to calibrated detection by HCV with an international standard, so that a copy number of the standard is characterized very accurately, which overcomes inaccuracy of relative judgment standards of a CT value by fluorescent PCR analysis, further improves an effect of nucleic acid detection of the SARS-CoV-2, and improves detection sensitivity. The kit for quantitatively detecting the copy number of the SARS-CoV-2 provided by the present invention has relatively high sensitivity and specificity, can accurately quantify the copy number of the SARS-CoV-2, is easy and convenient to operate, and can provide accurate and reliable results.