VERWENDUNG VON COLOSTRININ, DESSEN PEPTIDBESTANDTEILE UND DEREN ANALOGA ZUR FÖRDERUNG DER NEURONALEN ZELLDIFFERENZIERUNG

CROSSLINKED AND CROSSLINKABLE HOLLOW FIBER MEMBRANE AND METHOD OF MAKING SAME

A composition of and a method of making high performance hollow fiber membranes is described. The membranes have a high resistance to plasticization by use of a predetermined amount of crosslinking. The preferred polymer material for the membrane is a polyimide polymer comprising covalently bonded ester crosslinks. The resultant hollow fiber membrane exhibits a high permeability of CO2 in combination with a high CO2/CH4 selectivity. Another embodiment provides a method of making the hollow fiber membrane from a monesterified polymer followed by final crosslinking after hollow fiber formation.

Crosslinked membrane and polymer for making same and method of using membrane

A composition of and a method of making high performance crosslinked membranes are described. The membranes have a high resistance to plasticization by use of crosslinking. The preferred polymer material for the membrane is a polyimide polymer comprising covalently bonded ester crosslinks. The resultant membrane exhibits a high permeability of CO2 in combination with a high CO2/CH4selectivity. Another embodiment provides a method of making the membrane from a monesterified polymer followed by final crosslinking after the membrane is formed.

METHODS FOR TREATING AND PREVENTING GI SYNDROME AND GRAFT VERSUS HOST DISEASE

We have discovered that administering anti-ceramide antibody treats and prevents an array of diseases mediated by cytolytic T lymphocyte (CTLs)-induced killing and by damage to endothelial microvasculture, including radiation-induced GI syndrome, Graft vs. Host diseases, inflammatory diseases and autoimmune diseases. We have also discovered new anti-ceramide monoclonal antibodies, that have therapeutic use preferably in humanized form to treat or prevent these diseases.

ANTIKÖRPER MIT BINDUNG AN ANIONISCHE PHOSPHOLIPIDE UND AMINOPHOSPHOLIPIDE UND IHRE VERWENDUNG BEI DER BEHANDLUNG VON VIRUSINFEKTIONEN

USE OF TEMPLATE SWITCHING FOR DNA SYNTHESIS

A method of preparing a DNA copy of a target polynucleotide using template switching is described. The method includes mixing a double stranded template/primer substrate made up of a DNA primer oligonucleotide associated with a complementary oligonucleotide template strand with a target polynucleotide in a reaction medium and adding a suitable amount of a non- retroviral reverse transcriptase to the reaction medium to extend the DNA primer oligonucleotide from its 3' end to provide a DNA copy polynucleotide. The DNA copy polynucleotide includes a complementary target DNA polynucleotide that is synthesized using the target polynucleotide as a template. Methods of adding nucleotides to the double stranded template/primer substrate are also described. The method can be used to facilitate detection, PCR amplification, cloning, and determination of RNA and DNA sequences.

HYPERTONIC ISOCHLOREMIC FORMULATION FOR CIRCULATORY SHOCK

MORAXELLA CATARRHALIS ANTIGENE USPA1 UND USPA2

MODULATOREN VON POLYSACCHARIDEN UND DEREN VERWENDUNGEN

Polynucleotides encoding calpain 10

The present invention relates generally to the field of diabetes. More particularly, it concerns the identification of genes responsible for NIDDM1 for use in diagnostic and therapeutic applications. The present invention demonstrates that the NIDDM1 locus is, in fact, the calpain 10 gene. The invention further relates to the discovery that analysis of mutations in calpain genes and gene products can be diagnostic for type 2 diabetes. The invention also contemplates methods of treating diabetes in view of the fact that calpain mutations can cause diabetes. Further, the invention relates to novel polynucleotides of the NIDDM1 locus and polypeptides encoded by such polynucleotides.

DURCH PHAGENDISPLAY IDENTIFIZIERTE ZIELPEPTIDE DES MENSCHEN UND DER MAUS

USE OF C-SRC INHIBITORS ALONE OR IN COMBINATION WITH STI571 FOR THE TREATMENT OF LEUKAEMIA

... ²²²The invention relates to a combination which comprises (a) at least one ²compound decreasing the c-Src activity and (b) N-{5-[4-(4-methyl-piperazino-²methyl)-benzoylamdio]-2-methylphenyl}-4-(3-pyridyl)-2-pyrimidine-amine or the ²monomethanesulfonate salt thereof; to pharmaceutical compositions comprising ²said combinations; and to a method of treating a warm-blooded animal having ²leukaemia, especially chronic myelogenous leukaemia, comprising administering ²to the animal at least one compound inhibiting the activity of a member of the ²Src kinase family,the Tec kinase family or a Raf kinase inhibitor, in ²particular inhibiting the c-Src protein tyrosine kinase activity or inhibiting ²simultaneously the c-Src protein tyrosine kinase activity and the Bcr-Abl ²tyrosine kinase activity, alone or in combination with a Bcr-Abl inhibitor, in ²particular N-{5-[4-(4-methyl-piperazino-methyl)-benzoylamido]-2-methylphenyl}-²4-(3-pyridyl)-2-pyrimidine-amine.² ...

RADIOAKTIV MARKIERTE VERBINDUNGEN UND LIPOSOME UND IHRE HERSTELLUNGS- UND ANWENDUNGSVERFAHREN

Verfahren und Vorrichtung zur Herstellung von gesinterten Formkörpern durch Teilsinterung

SCHLAGINSTRUMENT

Combination immunotherapy for the treatment of cancer

Agonists to ICOS in combination with a blocking agent to a T cell inhibitory receptor (e.g., CTLA-4, PD-I, etc.) are demonstrated herein to be useful for the treatment of tumors.

VERWENDUNG VON COLOSTRININ, DESSEN PEPTIDBESTANDTEILE UND DEREN ANALOGA ZUR FÖRDERUNG DER NEURONALEN ZELLDIFFERENZIERUNG

Promoters from chlorella virus genes providing for expression of genes in prokaryotic and eukaryotic hosts

The invention is directed to novel promoters or mutants thereof from Chlorella virus DNA methyltransferase genes. A Chlorella virus gene promoter is operably linked to a first and/or second DNA sequence encoding a gene that is different from the Chlorella virus gene to form an expression cassette. An expression cassette can be introduced into prokaryotic and/or eukaryotic cells and can provide for a high level of expression of the gene encoded by the first and/or second DNA sequence. The invention also provides a method for screening other Chlorella virus genes for promoters that can function to express a heterologous gene in prokaryotic and/or eukaryotic hosts.

Tomotherapy treatment table positioning device

An integrated positioning device for a tomotherapy treatment couch is disclosed. The integrated positioning device has a central frame, two positioning tables, and an attachment arm. The central frame is mounted on the base of the tomotherapy treatment couch. The positioning tables position the moveable tabletop of the treatment couch in the lateral and longitudinal directions. Each table is able to position and lock the tabletop in one of the directions to a high degree of accuracy. The attachment arm connects the positioning tables to the tabletop and holds the tabletop in position for tomotherapy treatments.

ANTI-TUMOR EFFEKT VON BIK-MUTANTEN

DNA coding for a Mg2+/H+ or Zn2+/H+ exchanger and transgenic plants expressing same

An isolated DNA molecule is provided coding for a polypeptide of the 11-12 transmembrane domain transporter family having a Mg<2+>/H<+> or Zn<2+>/H<+> exchange activity, herein designated MHX. The genomic MHX DNA was isolated from Arabidopsis thaliana cv. C-24. Transgenic plants transformed with said DNA and expressing MHX are shown to have a lower content of sodium as compared with corresponding wild-type plants or a higher dry matter weight upon growth in calcium-rich media as compared with corresponding wild-type plants. These transgenic plants are tolerant to stress conditions, particularly high salinity and calcium-rich media, e.g. saline and calcareous soils.

Programmable fluidic processors

Disclosed are apparatuses, systems, and methods for programmable fluidic processors. In one embodiment, the invention involves manipulating droplets across a reaction surface of the processor substantially contact-free of any surfaces. The reaction surface and the electrodes of the processor may include a coating repelling the droplets. Further, the present invention provides for a suitable suspending medium for repelling droplets away from fixed surfaces.

Polyamine/alkali salt blends for carbon dioxide removal from gas streams

Novel solvents and methods of use for the removal of CO2 from flue gas, natural gas, hydrogen gas, synthesis gas, and other process and waste gas streams are provided. The solvent contains an alkali salt such as potassium carbonate and a polyamine such as piperazine (PZ) where the polyamine concentration is at least 1.5 equivalents/Kg H2O and the alkali salt concentration is at least 0.5 equivalents/Kg H2O. The preferred alkali salt/polyamine ratio is from approximately 1:2 to 2:1, and no additional alcohol is required for solubilizng the PZ. This chemical solvent and method of use provides efficient and effective removal of CO2 from gaseous streams and other sources.

VERFAHREN ZUR VERHINDERUNG VON FIBRINGERINNSELN IM LUNGENGEWEBE DURCH VERWENDUNG VON AEROSOLISIERTEN GERINNUNGSHEMMERN

EIN TUMORSUPPRESSOR MIT DER BEZEICHNUNG TS10Q23.3

SCREENING KOMBINATORISCHER PROTEINBIBLIOTHEKEN MITTELS PERIPLASMATISCHER EXPRESSION

ISOLIERUNG VON BINDUNGSPROTEINEN MIT HOHER AFFINITÄT FÜR LIGANDEN

ARGININANTAGONISTEN ZUR HEMMUNG DES SYSTEMISCHEN BLUTDRUCKES IN ZUSAMMENHANG MIT STICKOXIDBILDUNG ODER ENDOTHELIAL DERIVED RELAXING FAKTOR

MODULATOREN VON POLYSACCHARIDEN UND DEREN VERWENDUNGEN

Pyrolized carbon molecular sieve particles and methods of making and using the same

METHODS AND COMPOSITIONS FOR THE IDENTIFICATION, CHARACTERIZATION AND INHIBITION OF FARNESYL PROTEIN TRANSFERASE

Verfahren und Vorrichtung zur Herstellung von gesinterten Formkörpern durch Teilsinterung

Mixed matrix membranes and methods for making the same

Mixed matrix membranes capable of separating carbon dioxide from mixtures including carbon dioxide and methane, and processes for purifying methane using the membranes, are disclosed. The membranes are preferably polymer membranes that include discrete carbon-based molecular sieve particles with sizes of between about 0.5 microns to about 5.0 microns. The particles are formed by pyrolyzing a precursor polymer in the form of a powder or film. The pyrolyzed polymer is then ideally milled to desired small size particles. The preferred ratio of particles to polymer is about 0.25 to about 1.0 by volume. A preferred method for preparing the mixed matrix membrane is by dispersing the particles in a solvent, adding a small quantity of the desired polymer or "sizing agent" to "size" or "prime" the particles, adding a polymer, casting a film of the polymer solution, and evaporating the solvent to form a mixed matrix membrane film. The mixed matrix membrane film permits passage of carbon dioxide and ...

Optoacoustic monitoring of blood oxygenation

An optoacoustic apparatus is disclosed which includes a radiation source of pulsed radiation and a probe having a front face to be placed in close proximity to or in contact with a tissue site of an animal body. The probe further includes a plurality of optical fibers terminating at the surface of the front face of the probe and connected at their other end to a pulsed laser. The front face of the probe also has mounted therein or thereon a transducer for detecting an acoustic response from blood in the tissue site to the radiation pulses connected to a processing unit which converts the transducer signal into a measure of venous blood oxygenation.

Dietary supplementation with potassium magnesium citrate

BACILLUS THURINGIENSIS TOXIN ACTIVE AGAINST FORMICIDAE (ANT)

Imaging agents, precursors thereof and methods of manufacture

Compounds of formula (I) and (II):wherein groups R1, R2, RE, PG1 and PG2 have the definitions provided in the specification, methods of manufacture and methods of use.

Method and apparatus for rapid drying of coated materials with close capture of vapors

A method and apparatus for the removing solvents from coated materials while capturing evaporated vapors in a confined space and maintaining non-explosive conditions within the space. Microwave energy may be applied to a coated material as the coated material passes through a cavity configured to produce an electromagnetic resonance mode. The application of microwaves to the coated material causes rapid evaporation of the solvents. The cavity is also configured to confine the evaporated vapors in a small volume and control the inflow of air into the volume so as to produce an effluent waste stream which includes a relatively high concentration of solvent molecules while maintaining a non-explosive atmosphere within the cavity. The method and apparatus are particularly suited for treating coated web materials, especially continuous webs.

Ultra-low shrinkage composite resins based on blended nematic liquid crystal monomers

Resin blends comprising liquid crystal monomers and secondary monomers useful to blend with liquid crystal monomers to maintain a nematic state under processing conditions while maintaining low cute shrinkage, particularly suitable for use in dental resin composites.

Hot-melt extrudable pharmaceutical formulation

The present invention relates to pharmaceutical formulations comprising a hot-melt extrudable mixture of a therapeutic compound and a high molecular weight poly(ethylene oxide) in an essentially non-film like preparation. In some embodiments, the formulation further comprises poly(ethylene glycol). The present invention also includes efficient methods for hot-melt extruding pharmaceutical formulations in essentially non-film preparations.

USE OF COLOSTRININ, CONSTITUENT PEPTIDES AND ANALOGS THEREOF TO PROMOTE NEURAL CELL DIFFERENTIATION

ULTRA-LOW SHRINKAGE COMPOSITE RESINS BASED ON BLENDED NEMATIC LIQUID CRYSTAL MONOMERS

Detection system based on an analyte reactive particle

A system for the rapid characterization of multi-analyte fluids, in one embodiment, includes a light source, a sensor array, and a detector. The sensor array is formed from a supporting member into which a plurality of cavities may be formed. A series of chemically sensitive particles are, in one embodiment positioned within the cavities. The particles may be configured to produce a signal when a receptor coupled to the particle interacts with the analyte. Using pattern recognition techniques, the analytes within a multi-analyte fluid may be characterized.

Prokaryotic host cells for expressing proteins rich in disulfide bonds

The invention provides composition and methods for producing proteins of interest which comprise at least one disulfide bond, include proteins which in their mature form do not contain disulfide bonds, but whose precursor molecule contained at least one disulfide bond. The methods employ a host cell modified to more efficiently produce properly folded disulfide bond containing proteins. The host cells generally contain a mutation in one or more reductase genes, and can be further genetically modified to increase their growth rate, and are further optionally modified to increase the expression of a catalyst of disulfide bond formation. Host cells, methods for u sing such to produce proteins of interest, proteins of interest produced by these methods are within the scope of the invention.

High carbon content filamentary membrane and method of making the same

A high carbon content membrane and method for making the same are disclosed. The carbon membrane includes an asymmetric hollow filamentary carbon membrane, including a partial carbonization product of an asymmetric hollow filament including an aromatic imide polymer material. The carbon membrane is at least 95 weight percent carbon, and has a dense layer located in the outside surface portion of the hollow filamentary membrane and a porous base layer continued from the dense layer and located in the inside portion of the hollow filamentary membrane. A process for separating CO2 from natural gas is described including: contacting a mixture of CO2 and natural gas with a first side of a carbon membrane in a manner to cause a portion of the mixture to pass through the carbon membrane to a permeate side. The resulting mixture on the permeate side becomes enriched in CO2 over that of the mixture on the first side. The contacting step occurs at a pressure of at least about 200 psia.

Carbon molecular sieves and methods for making the same

Mixed matrix membranes capable of separating carbon dioxide from mixtures including carbon dioxide and methane, and processes for purifying methane using the membranes, are disclosed. The membranes are preferably polymer membranes, that include discrete carbon-based molecular sieve particles with sizes of between about 0.5 microns to about 5.0 microns. The particles are formed by pyrolyzing a precursor polymer in the form of a powder or film. The pyrolyzed polymer is then ideally milled to desired small size particles. The preferred ratio of particles to polymer is about 0.25 to about 1.0 by volume. A preferred method for preparing the mixed matrix membrane is by dispersing the particles in a solvent, adding a small quantity of the desired polymer or "sizing agent" to "size" or "prime" the particles, adding a polymer, casting a film of the polymer solution, and evaporating the solvent to form a mixed matrix membrane film. The mixed matrix membrane film permits passage of carbon dioxide ...

MODULATORS OF POLYSACCHARIDES AND USES THEREOF

MIXED MATRIX MEMBRANES WITH PYROLIZED CARBON SIEVE PARTICLES AND METHODS OF MAKING THE SAME

Compositions and methods for administering Borrelia DNA

Disclosed is a vaccine against Lyme Disease or its causative agent Borrelia burgdorferi (sensu stricto or sensu lato) containing a plasmid a DNA encoding a promoter for driving expression in a mammalian cell, DNA encoding a leader peptide for facilitating secretion/release of a prokaryotic protein sequence from a mammalian cell, a DNA encoding Borrelia OspA or OspB, and a DNA encoding a terminator. Disclosed too is an immunogenic composition against Lyme Disease or its causative agent Borrelia burgdorferi (sensu stricto or sensu lato) containing a plasmid comprising a DNA encoding a promoter for driving expression in a mammalian cell, DNA encoding a leader peptide for facilitating secretion/release of a prokaryotic protein sequence from a mammalian cell, a DNA encoding a Borrelia OspC, and a DNA encoding a terminator. And, methods for making and using such vaccines and the immunogenic composition are also disclosed.

Modulators of polysaccharides and uses thereof

The present invention provides peptides with a specific affinity for glycosaminoglycan molecules. These peptides may have any number of functions, including but not limited to use as inhibitors of glycosaminoglycan-mediated processes, enhancers of glycosaminoglycan-mediated processes, and as molecular probes to identify the presence of a specific glycosaminoglycan. Peptides of the invention may be directed against any glycosaminoglycan, including hyaluronic acid, chondroitin sulfate A, chondroitin sulfate C, dermatan sulfate, heparin, keratan sulfate, keratosulfate, chitin, chitosan 1, and chitosan 2. These isolated peptides may have therapeutic uses in the treatment or prevention of diseases involving infection, inflammatory diseases, cancer, infections, etc. The peptides may also have other biological functions such as contraception.

Methods of immunoassay for human CDC6

The invention pertains to novel genes which function in the regulation of DNA replication and/or entry of a cell into mitosis. Tile invention also pertains to novel proteins encoded by the genes described herein, antibodies which bind the encoded protein, and homologs of the novel genes which function in regulation of DNA replication and/or entry of a cell into mitosis find hybridize to the DNA sequence of the novel genes. The invention also includes methods for determining the presence of a proliferative disorder comprising determining the presence of level of hscdc6.

Modulators of polysaccharides and uses thereof

The present invention provides peptides with a specific affinity for glycosaminoglycan molecules. These peptides may have any number of functions, including but not limited to use as inhibitors of glycosaminoglycan-mediated processes, enhancers of glycosaminoglycan-mediated processes, and as molecular probes to identify the presence of a specific glycosaminoglycan. Peptides of the invention may be directed against any glycosaminoglycan, including hyaluronic acid, chondroitin sulfate A, chondroitin sulfate C, dermatan sulfate, heparin, keratan sulfate, keratosulfate, chitin, chitosan 1, and chitosan 2. These isolated peptides may have therapeutic uses in the treatment or prevention of diseases involving infection, inflammatory diseases, cancer, infections, etc. The peptides may also have other biological functions such as contraception.

Just-in-time analytics on large file systems and hidden databases

A just-in-time sampling-based system can, after consuming a small number of disk accesses or queries, produce extremely accurate answers for a broad class of aggregate and top-k queries over a file system or database without the requirement of prior knowledge. The system is efficient, accurate, and scalable. The system performs aggregate estimations of a hidden database through its web interface by employing techniques that use a small number of queries to produce unbiased estimates with small variance. It conducts domain discovery over a hidden database through its web interface by employing techniques which provide effective guarantees on the effectiveness of domain discovery. Systems and methods enhance forms used by mobile devices to access hidden databases. It employs data analytics to improve the usage of form fields, including providing context-sensitive auto-completion suggestions, highlighting selections in drop-down boxes and eliminating suggestions in drop-down boxes.

Compositions and methods for administering Borrelia burgdorferi antigens

Mucosal administration of OspA and compositions therefor are disclosed and claimed. More particularly, oral administration of OspA and compositions therefor for eliciting an immunological response against Borrelia burgdorferi, such as a protective response preventive of Lyme disease are disclosed and claimed. Thus, oral Lyme disease vaccines or immunological compositions and methods of use are disclosed and claimed.

Inhibitors of glycosaminoglycans

The present invention provides peptide derivatives with a specific affinity for glycosaminoglycan molecules. These peptide derivatives include multimers as well as chemically modified peptides and may be prepared by a variety of methods. The peptides of the invention have numerous functions, including but not limited to use as inhibitors of glycosaminoglycan-mediated signaling events and targeting agents. Peptides of the invention may be directed against any glycosaminoglycan, including hyaluronic acid, chondroitin sulfate A, chondroitin sulfate C, dermatan sulfate, heparin, keratan sulfate, keratosulfate, chitin, chitosan 1, and chitosan 2. The peptide derivatives of the invention also have therapeutic uses in the treatment and prevention of diseases involving inflammatory diseases, cancer, and cancer metastasis, autoimmune diseases, etc.

Gas separations using mixed matrix membranes

Mixed matrix membranes capable of separating carbon dioxide from mixtures including carbon dioxide and methane, and processes for purifying methane using the membranes, are disclosed. The membranes are polymer membranes with a selective layer thickness of between about 1000 Angstroms to about 0.005 inch, that include discrete carbon-based molecular sieve particles with sizes of between about 0.5 microns to about 5.0 microns. The preferred ratio of particles to polymer is about 20% to about 50% by volume. A preferred method for preparing the mixed matrix membrane is by dispersing the particles in a solvent, adding a small quantity of the desired polymer or "sizing agent" to "size" or "prime" the particles, adding a polymer, casting a film of the polymer solution, and evaporating the solvent to form a mixed matrix membrane film. The mixed matrix membrane film permits passage of carbon dioxide and methane, but at different permeation rates, such that the ratio of the relative permeation rates ...

Single expandable double lumen cannula assembly for veno-venous ECMO

The present invention provides an apparatus, system, and method of use of a simple, less invasive, self-expandable percutaneous double lumen cannula assembly for VV ECMO that overcomes the limitations and obstacles of the techniques described above. The present invention achieves near theoretical total venous blood drainage, total extracorporeal gas exchange, and prevents recirculation and multiple cannulation, thereby simplifying VV ECMO, decreasing surgical and blood trauma, and expanding its application.

Process for CO2/natural gas separation

The invention includes a process for separating CO2 from natural gas including: contacting a mixture of CO2 and natural gas with a first side of a carbon membrane in a manner to cause a portion of the mixture to pass through the carbon membrane to a permeate side. The resulting mixture on the permeate side becomes enriched in CO2 over that of the mixture on the first side. The carbon membrane includes an asymmetric hollow filamentary carbon membrane, including a partial carbonization product of an asymmetric hollow filament including an aromatic imide polymer material. The carbon membrane is at least 95 weight percent carbon, and has a dense layer located in the outside surface portion of the hollow filamentary membrane and a porous base layer continued from the dense layer and located in the inside portion of the hollow filamentary membrane. The contacting step occurs at a pressure of at least about 200 psia.

Screening for disease susceptibility by genotyping the CCR5 and CCR2 genes

Provided are compositions, methods and uses for identifying persons at an increased risk of infection by, transmission of, or accelerated progression of a disease caused by an HIV-1 virus. Diagnostic, prognostic and combined therapeutic kits are also provided.

Nanofiber Actuators and Strain Amplifiers

Nanofiber actuators and strain amplifiers having a material that generates a force or generates a displacement when directly or indirectly electrically driven. This material is an aerogel or a related low density or high density network comprising conducting fibers that are electrically interconnected and can substantially actuate without the required presence of either a liquid or solid electrolyte. Reversible or permanently frozen actuation is used to modify the properties of the actuator material for applications. 1. An electrically powered actuator , comprising:(i) a counter electrode; and (a) the actuating electrode comprises a network of electrically interconnected nanofibers,', '(b) the actuator is configured to change dimension, generate stress, or a combination thereof during actuation of the actuating electrode in the absence of liquid or solid electrolyte, wherein said actuation comprises direct or indirect application of voltage to the actuating electrode with respect to the counter electrode, '(ii) an actuating electrode electrically coupled to the counter electrode, wherein'}2. The electrically powered actuator of claim 1 , wherein the nanofibers predominately have a smallest lateral diameter that is at most about 100 nm.3. (canceled)4. The electrically powered actuator of claim 1 , wherein the nanofibers are selected from the group consisting of graphene ribbons claim 1 , carbon nanotubes claim 1 , superconducting nanofibers claim 1 , non-elastomeric conducting polymer nanofibers claim 1 , elastomeric conducting polymer nanofibers claim 1 , electrically conducting oxide nanofibers claim 1 , conductor coated nanofibers claim 1 , and combinations thereof.5. The actuator of wherein said counter electrode is a ground plane at an arbitrarily large distance from the actuating electrode.6. The actuator of claim 1 , wherein the actuating electrode and the counter electrode are proximate.7. The actuator of claim 1 , wherein the counter electrode comprises an ...

SOLID-STATE ACOUSTIC METAMATERIAL AND METHOD OF USING SAME TO FOCUS SOUND

A phonemic crystal is made of a first solid medium having a first density and a substantially periodic array of structures disposed in the first medium, the structures being made of a second solid medium having a second density different from the first density. The first medium has a speed of propagation of longitudinal sound waves and a speed of propagation of transverse sound waves, the speed of propagation of longitudinal sound waves being approximately that of a fluid, and the speed of the propagation of transverse sound waves being smaller than the speed of propagation of longitudinal sound waves. 1. A phononic crystal comprising:a first solid medium having a first density; anda substantially periodic array of structures disposed in the first medium, the structures being made of a second solid medium having a second density different from the first density;wherein the first medium has a speed of propagation of longitudinal sound waves and a speed of propagation of transverse sound waves, the speed of propagation of longitudinal sound waves being equal to that of a fluid, and the speed of the propagation of transverse sound waves being smaller than the speed of propagation of longitudinal sound waves.2. The phononic crystal of claim 1 , wherein the structures are cylindrical.3. The phononic crystal of claim 2 , wherein the structures form a two-dimensional phononic structure.4. The phononic crystal of claim 1 , wherein the first solid medium comprises rubber.5. The phononic crystal of claim 4 , wherein the second solid medium comprises steel.6. The phononic crystal of claim 1 , wherein the structures form a phononic structure in at least two dimensions.7. A method for focusing sound claim 1 , the method comprising:(a) providing a phononic crystal comprising:a first solid medium having a first density; anda substantially periodic array of structures disposed in the first medium, the structures being made of a second solid medium having a second density different ...

AD AUCTION OPTIMIZATION

The present disclosure generally relates to ad auction optimization. In some examples, methods, systems, and computer programs for ad auction optimization using machine learning algorithms to estimate a likelihood that a consumer will purchase an advertised product and balance long term and short term goals to determine modeled data for a keyword in an auction are described. 1. A system for ad auction optimization comprising:an estimation and prediction module configured to receive information and use machine logic on the information to estimate a likelihood a consumer will purchase an advertised item, the estimation and prediction module being further configured to output estimation and prediction module information; andan optimization module configured to receive estimation and prediction module information from the estimation and prediction module and other information and use machine logic on the received information to determine a bid amount for a keyword in an auction, wherein the optimization module includes a single-day optimizer and a multi-day optimizer and the optimization module balances short-term and long-term goals in making such determination.2. The system of claim 1 , further comprising a position analyzer configured to estimate advertiser results on an advertisement framework.3. The system of claim 2 , wherein the position analyzer analyzes impressions and average ad positions to determine and output total impressions claim 2 , bid ranks claim 2 , and impression ranges to the estimation and prediction module.4. The system of claim 1 , wherein the estimation and prediction module includes a user model claim 1 , the user model including a particle filter claim 1 , the user model being configured to predict information about the consumer including whether the consumer is in a buying state or a browsing state.5. The system of claim 1 , wherein the estimation and prediction module includes an advertiser model claim 1 , the advertiser model being ...

STABILIZED REVERSE TRANSCRIPTASE FUSION PROTEINS

Stabilized reverse transcriptase fusion proteins including a thermostable reverse transcriptase connected to a stabilizer protein are described. Attaching the stabilizer protein to the thermostable reverse transcriptase stabilizes the fusion protein and can aid in its purification, provide increased solubility, allow for longer storage, or allow the fusion protein to be used under more rigorous conditions such as higher temperature. The stabilized reverse transcriptase fusion protein can also include a linker between the stabilizer protein and the thermostable reverse transcriptase. The stabilized reverse transcriptase fusion proteins are suitable for use in nucleic acid amplification methods such as the reverse transcription polymerase chain reaction and other applications involving cDNA synthesis. 1. A stabilized reverse transcriptase fusion protein comprising a thermostable reverse transcriptase connected to a stabilizer protein.2. The stabilized reverse transcriptase fusion protein of claim 1 , wherein the thermostable reverse transcriptase comprises a bacterial reverse transcriptase.3. The stabilized reverse transcriptase fusion protein of claim 2 , wherein the bacterial reverse transcriptase comprises a group-II intron-derived reverse transcriptase.4Thermosynechococcus elongatusGeobacillus stearothermophilus. The stabilized reverse transcriptase fusion protein of claim 3 , wherein the bacterial reverse transcriptase is a reverse transcriptase claim 3 , or reverse transcriptase.5. The stabilized reverse transcriptase fusion protein of claim 1 , wherein the thermostable reverse transcriptase comprises a polypeptide with at least 85% amino acid sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 claim 1 , SEQ ID NO: 2 claim 1 , SEQ ID NO: 3 claim 1 , SEQ ID NO: 4 claim 1 , or SEQ ID NO: 5.6. The stabilized reverse transcriptase fusion protein of claim 1 , wherein the stabilizer protein comprises an affinity protein or a solubility- ...

COMMUNICATING CHANNEL STATE INFORMATION USING PREDICTIVE VECTOR QUANTIZATION

Techniques are generally described here for communicating channel state information using predictive vector quantization. In some examples, a method may include measuring channel state information based, at least in part, on signals received over a communications channel. An error vector may be calculated between the measured channel state information and predicted channel state information. The error vector may be quantized, and subsequent channel state information may be predicted based, at least in part, on the quantized error vector. 1. A method for communicating channel state information , the method comprising:measuring channel state information based, at least in part, on signals received over a communications channel;calculating an error vector between the measured channel state information and predicted channel state information;quantizing the error vector; andpredicting subsequent channel state information based, at least in part, on the quantized error vector.2. The method of claim 1 , further comprising generating a quantized estimate of the channel state information based claim 1 , at least in part claim 1 , on the predicted channel state information and the quantized error vector.3. The method of claim 1 , wherein the channel state information comprises a unit vector.4. The method of claim 1 , wherein the channel state information is in the Grassmann manifold.5. The method of claim 1 , wherein the error vector comprises a tangent vector from the measured channel state information to the predicted channel state information.6. The method of claim 1 , further comprising transmitting an indicator associated with the quantized error vector to a receiver.7. The method of claim 6 , wherein quantizing the error vector comprises selecting at least one of the values stored in an electronic codebook claim 6 , and wherein transmitting the indicator comprises transmitting an index value corresponding to the selected value to a receiver.8. The method of claim 1 , ...

SINGLE ANTENNA SINGLE READER SYSTEM AND METHOD FOR LOCATING A TAG

A single antenna single reader (SASR) system and method for locating a tag. The reader connects to a single antenna that is in motion. The reader transmits an interrogation signal to the tag. The reader receives a response signal from the tag. The reader determines the range of the tag from the reader, the received signal strength (RSS) of the response signal at the reader from the tag, and the maximum correlation of the response signal at the reader from the tag. The reader determines the location of the tag using range of the tag from the reader, received signal strength and maximum correlation of the response signal. 1. A method for locating a tag , comprising:transmitting an interrogation signal from a reader with a single antenna to the tag, wherein the single antenna is in motion;receiving a response signal at the reader from the tag;determining the range of the tag from the reader;determining the received signal strength (RSS) of the response signal at the reader from the tag;determining the maximum correlation of the response signal at the reader from the tag; anddetermining the location of the tag using range of the tag from the reader, received signal strength and maximum correlation of the response signal.2. The method of claim 1 , wherein the interrogation signal is an impulse spike or ramp signal.3. The method of claim 1 , wherein the single antenna rotates at an angular velocity.4. The method of claim 1 , wherein determining the range comprises:determining roundtrip time of flight from transmitting interrogation signal to receiving the response signal;subtracting tag time delay from roundtrip time of flight, wherein the tag time delay is a known value from design of tag;calculating the one-way time of flight from reader to tag by dividing by two the result of subtracting tag time delay from roundtrip time of flight; andmultiplying the one-way time of flight by velocity of radio frequency signal to determine the range of the tag from the reader.5. A ...

ELECTROMECHANICAL LYSING OF ALGAE CELLS

Methods and electroporation devices for electrical treatment of algal cell cultures for release of lipids and proteins are described herein. The method of the present invention exploits the differences in electrical time constants for the media inside the cell and outside the cell to produce a net force to cause cellular lysis and extract cellular components. The method of the present invention can be used in the treatment of flocculated as well as unflocculated algal cell cultures. The device of the present invention provides efficient cell lysing in a low-energy cost set-up. 1. A method for electrical treatment of one or more biological cells comprising the steps of:providing the one or more biological cells suspended or surrounded by a lysing medium comprising a fresh water, a salt water, a brackish water, a growth medium, a culture medium or combinations thereof, wherein an electrical conductivity of the lysing medium is different from the electrical conductivity of a cell membrane and the cytoplasm of the one or more biological cells;applying a time varying electromagnetic field to the one or more biological cells using one or more electrode pairs placed within or externally to the lysing medium, wherein the electromagnetic field applies a mechanical force on a cell membrane comprising a force stress; andapplying and rapidly switching off one or more voltage pulses to the one or more biological cells resulting in lysis of the one or more biological cells.2. The method of claim 1 , further comprising the steps of:releasing one or more cellular components from the lysed biological cells into the lysing medium; andseparating and collecting the released cellular components for further processing.3. The method of claim 2 , wherein the cellular components comprise neutral lipids claim 2 , proteins claim 2 , triglycerides claim 2 , sugars or combinations and modifications thereof.4. The method of claim 3 , wherein the neutral lipids claim 3 , triglycerides or both are ...

PRO-NEUROGENIC COMPOUNDS

This technology relates generally to compounds and methods for stimulating neurogenesis (e.g., post-natal neurogenesis, including post-natal hippocampal and hypothalamic neurogenesis) and/or protecting neuronal cell from cell death. Various compounds are disclosed herein. In vivo activity tests suggest that these compounds may have therapeutic benefits in neuropsychiatric and/or neurodegenerative diseases such as schizophrenia, major depression, bipolar disorder, normal aging, epilepsy, traumatic brain injury, post-traumatic stress disorder, Parkinson's disease, Alzheimer's disease, Down syndrome, spinocerebellar ataxia, amyotrophic lateral sclerosis, Huntington's disease, stroke, radiation therapy, chronic stress, abuse of a neuro-active drug, retinal degeneration, spinal cord injury, peripheral nerve injury, physiological weight loss associated with various conditions, as well as cognitive decline associated with normal aging, chemotherapy, and the like. 2. The method of claim 1 , wherein said post-natal mammalian neurogenesis includes hippocampal and/or hypothalamic neurogenesis.3. The method of claim 1 , wherein said neuronal cell death includes hippocampal and/or hypothalamic neuronal cell death.4. The method of claim 1 , wherein Ris selected from halo claim 1 , hydroxyl claim 1 , sulfhydryl claim 1 , C-Calkoxy claim 1 , C-Cthioalkoxy claim 1 , C-Chaloalkoxy claim 1 , C-Cthiohaloalkoxy claim 1 , C-Calkyl claim 1 , C-Chaloalkyl claim 1 , C-Calkynyl claim 1 , cyclopropyl claim 1 , —N claim 1 , cyano claim 1 , —NH claim 1 , —NH(C-Calkyl) claim 1 , —N(C-Calkyl) claim 1 , —NHC(O)(C-Calkyl) claim 1 , and nitro.5. The method of claim 1 , wherein Ris halo.6. The method of claim 1 , wherein Ris bromo.7. The method of claim 1 , wherein each of R claim 1 , R claim 1 , and Ris hydrogen.9. The method of claim 1 , wherein Ris selected from halo claim 1 , hydroxyl claim 1 , sulfhydryl claim 1 , C-Calkoxy claim 1 , C-Cthioalkoxy claim 1 , C-Chaloalkoxy claim 1 , C- ...

Methods and Devices for Treating Obesity

Methods and devices for treating obesity. Pressure is applied to gastric walls in at least one segment of a stomach such that the pressure distends the gastric walls and induces satiety. A hollow capsule can be used to distend the gastric walls. Alternatively, a doughnut- shaped ring may be inflated to an amount sufficient to create intragastric tension and induce satiety. A c-ring including at least one balloon may be placed at a segment of the stomach, where the balloon inflates to a size that creates tension at the segment. A biocompatible material can be injected into the fundus and antrum of the stomach to stiffen the gastric wall to create a fullness feeling. 111.-. (canceled)12. A method for inducing gastric satiety , comprising:placing an inflatable ring within a stomach for retention within the stomach; anddynamically adjusting the volume of the inflatable ring according to one or more feedback loops in an amount sufficient for inducing satiety.13. The method of claim 12 , where the step of dynamically adjusting the volume comprises injecting air or fluid into the inflatable ring.14. The method of claim 12 , where the ring is temporarily retained in the stomach for a period of at least one year.15. A device for inducing gastric satiety claim 12 , comprising:an inflatable ring configured to be placed and retained within a stomach; anda regulatory device coupled to the inflatable ring configured to dynamically adjust a volume of the inflatable ring according to one or more feedback loops in an amount sufficient for inducing satiety.16. The device of claim 15 , where the regulatory device is positioned external to the stomach.17. The device of claim 15 , the regulatory device comprising a barostat.18. A method for inducing gastric satiety claim 15 , comprising:attaching a ring comprising a balloon to a stomach for retention within the stomach; andadjusting a volume of the balloon in an amount sufficient for exerting pressure on a wall of the stomach for ...

INHIBITORS OF STAT3 AND USES THEREOF

Compounds which inhibit the activity of signal transducer and activator of transcription 3 (STAT3) are provided together with methods of making and using the same. The compounds are designed to bind to the SH2 domain of STAT3, preventing STAT3 from binding to receptors for interleukin-6 family cytokines, growth factors such as the platelet-derived growth factor, the epidermal growth factor, vascular endothelial growth factor, and other signaling molecules such as leptin. Blocking these interactions prevents STAT3 from being phosphorylated on Tyr705, which is required for the dimerization of STAT3, translocation to the nucleus, binding to STAT3 response elements on promotors, and transcription of genes. In addition to these activities, binding to the SH2 domain of STAT3 breaks up pre-formed dimmers, thereby preventing the transcriptional activity of the inhibitor. 4. A compound selected from the group consisting of Example 1 to Example 25.5. A pharmaceutical composition as recited in , , , or useful for the treatment or prevention of a STAT3-mediated disease.64. Compound according to any one of , , , or as a medicament for the treatment and prevention of cancer.7. A compound or composition as recited in , , or for use in the manufacture of a medicament for the prevention or treatment of a disease or condition ameliorated by the inhibition of STAT3.8. A method of inhibition of STAT3 comprising contacting STAT3 with a compound as recited in , , or .9. A method of treatment of a STAT3-mediated disease comprising the administration of a therapeutically effective amount of the compound as recited in , , or to a patient in need thereof.10. The method as recited in above wherein the disease is cancer This application claims priority to U.S. Pat. App. Ser. No. 61/168,454 filed Apr. 10, 2010. The application is incorporated by reference herein in its entirety.This invention was made with government support under CA096652 and CA070907 awarded by The National Institutes of ...

METHODS AND SYSTEMS FOR HANDLING OR DELIVERING MATERIALS FOR NATURAL ORIFICE SURGERY

The embodiments disclosed herein relate to various medical systems, including systems that can be used in conjunction with medical devices used in endoscopic surgery. Certain embodiments include various material handling devices that can transport materials between the inside and the outside of an endoscopic surgery patient. 1. A system configured to transport a material between the outside of an endoscopic surgery patient and the inside of the endoscopic surgery patient , the system comprising:a. a compliant overtube having a primary lumen and a proximal end and a distal end;b. a material capture device comprising a retaining mechanism disposed within the primary lumen; andc. a drive member configured to shuttle the material capture device between the proximal end and the distal end.2. The system of claim 1 , wherein the drive member is a helical drive member disposed within the primary lumen.3. The system of claim 2 , wherein the capture device further comprises a tab that can be disposed between adjoining coils of the helical drive member and further can be disposed into a slot defined in the wall of the primary lumen.4. The system of claim 3 , wherein the slot constrains the orientation of the material capture device within the primary lumen.5. The system of claim 1 , wherein the drive member is a hydraulic or pneumatic system.6. The system of claim 1 , wherein the retaining mechanism comprises a passive spring-type grasper.7. The system of claim 6 , wherein the retaining mechanism comprises a shape memory alloy.8. The system of claim 6 , wherein the retaining mechanism is shaped into a plateau-like profile.9. The system of claim 1 , wherein a motor that drives the drive member is housed within an electronic housing.10. The system of claim 9 , further comprising motor controls disposed on or within the electronic housing.11. The system of claim 9 , wherein the motor is controlled using components remote from the electronic housing.12. The system of claim 1 , ...

Storing Carbon Dioxide and Producing Methane and Geothermal Energy from Deep Saline Aquifers

A novel idea involving the coupling of COgeological storage with methane and/or heat production (geothermal energy) from geopressured-geothermal aquifers is described herein. The production of energy from the extracted brine offsets the cost of capture, pressurization, and injection and the subsequent injection of brine containing carbon dioxide back into the aquifer. Calculations described in the present invention indicate that this offset would reduce the cost of carbon capture and sequestration (CCS) to a point that CCS could survive in a competitive market environment without subsidies or a price on carbon. 1. A process for producing methane from an aquifer , a reservoir , or combinations thereof comprising the steps of:collecting a native brine obtained by flowing or pumping to the surface from a first well or a set of wells made by drilling, digging, driving, boring, or combinations thereof, at a first location in the aquifer or the reservoir; and{'sub': 2', '2, 'extracting methane from a gas phase comprising methane in the native brine, wherein the extraction is done by contacting the native brine with carbon dioxide (CO) under pressure or by reducing pressure at a surface of the native brine, wherein the COdisplaces the gas phase comprising methane from the native brine.'}2. The process of claim 1 , wherein the COis in a pure form or is a mixture of gases.3. The process of claim 1 , further comprising the step of using the methane to generate electricity claim 1 , as a fuel claim 1 , or to convert into chemicals.4. The process of claim 1 , wherein the process further comprises the step of storing the carbon dioxide by injection of COdissolved in brine after separation of the methane or injection of both supercritical COand COdissolved in brine as a two-phase mixture into a second location in the aquifer or reservoir by the use of a second well or a set of wells claim 1 , wherein the second well or set of wells is created by drilling claim 1 , digging claim 1 ...

DIAGNOSTIC AND THERAPEUTIC METHODS AND COMPOSITIONS INVOLVING PTEN AND BREAST CANCER

Patients with ErbB2-overexpressing cancers can be given an ErbB2 targeting agent as a therapeutic regimen but not all patients are responsive. The present invention concerns the diagnostic, prognostic and therapeutic methods and compositions for evaluating potential efficacy of an ErbB2 targeting agent in an ErbB2-overexpressing cancers by evaluating PTEN expression, which is predictive of responsiveness or resistance to ErbB2 targeting agents such as trastuzumab. Low PTEN expression is predictive of a patient who will respond poorly to trastuzumab. 1. A method of determining whether a patient has a lower probability of response to treatment comprising an ErbB2-targeting anti-cancer agent , the method comprising: determining the PTEN nucleic acid status of a sample obtained from said patient and correlating PTEN negative or PTEN low status to a lower probability of response to said treatment.2. The method of claim 1 , wherein determining the PTEN nucleic acid status of said sample comprises determining the expression level of PTEN transcript in said sample.3. The method of claim 2 , wherein said sample is contacted with an oligonucleotide hybridizing under high stringency conditions to a PTEN transcript or a complementary DNA derived therefrom.4. The method of claim 1 , wherein determining the PTEN nucleic acid status of said sample comprises determining the genomic copy number of PTEN in said sample.5. The method of claim 1 , wherein determining the PTEN nucleic acid status of said sample comprises determining whether cells in said sample have mutations in PTEN.6. The method of claim 1 , wherein said ErbB2-targeting anti-cancer agent is trastuzumab.7. The method of claim 1 , wherein said patient's cancer overexpresses ErbB2.8. The method of claim 1 , further comprising determining ErbB2 status in a sample from said patient.9. The method of claim 8 , wherein determining ErbB2 status in a sample from said patient comprises determining whether cells in said sample ...

Method and Apparatus for Electrocatalytic Amplification on Pre-Oxidized Measuring Electrode

The present invention includes methods and compositions having at least one nanoparticle for analyzing a chemical analyte. The device includes an electrochemical cell connected to a measuring apparatus, wherein the electrochemical cell comprises a container and at least one electrode comprising a surface modification; a solution within the container comprising one or more chemical analytes and one or more metal nanoparticles in the solution, wherein one or more electrocatalytic properties are generated by the one or more metal nanoparticles at the at least one electrode and the contact of individual nanoparticles can be measured. 1. A method of analyzing a sample using nanoparticle collision amplification at a surface modified electrode comprising the steps of:providing a sample chamber having at least 2 electrodes, wherein one or more of the at least 2 electrodes comprise a surface modification;combining one or more metal nanoparticles with a liquid sample within the sample chamber;detecting an oxidation or reduction reaction between the one or more nanoparticles and at least one of the at least 2 electrodes, wherein the detector can detect individual nanoparticles contacting the electrode by measuring at least one of electrical current, potential, charge, impedance, light, and color; andobserving one or more electrocatalytic properties generated by the oxidation or reduction reaction.2. The method of claim 1 , wherein the oxidation or reduction reaction comprise an electrocatalytic amplification from a reduction reaction or an oxidation reaction catalyzed by the one or more nanoparticles.3. The method of claim 1 , wherein the one or more metal nanoparticles comprise platinum nanoparticles claim 1 , gold nanoparticles claim 1 , silver nanoparticles claim 1 , copper nanoparticles claim 1 , ruthenium nanoparticles claim 1 , palladium nanoparticles claim 1 , tin oxide nanoparticles claim 1 , carbon nanoparticles or a combination thereof.4. The method of claim 1 , ...

Polyamine/Alkali Salt Blends for Carbon Dioxide Removal From Gas Streams

Novel solvents and methods of use for the removal of COfrom flue gas, natural gas, hydrogen gas, synthesis gas, and other process and waste gas streams are provided. The solvent contains an alkali salt such as potassium carbonate and a polyamine such as piperazine (PZ) where the polyamine concentration is at least 1.5 equivalents/Kg HO and the alkali salt concentration is at least 0.5 equivalents/Kg HO. The preferred alkali salt/polyamine ratio is from approximately 1:2 to 2:1, and no additional alcohol is required for solubilizing the PZ. This chemical solvent and method of use provides efficient and effective removal of COfrom gaseous streams and other sources. 110-. (canceled)11. A composition , comprising:a piperazine derivative having a concentration of at least 3.0 equivalents/Kg water,a potassium salt having a concentration of at least 1.0 equivalents/Kg water, and water,wherein the ratio of equivalents of alkali salt to equivalents of the piperazine derivative is 0.3-3.0.12. The composition of claim 11 , wherein the piperazine derivative is piperazine.13. The composition of claim 11 , wherein the potassium salt is potassium carbonate claim 11 , potassium bicarbonate claim 11 , potassium bisulfide claim 11 , or potassium hydroxide.14. The composition of claim 11 , wherein the ratio of equivalents of alkali salt to equivalents of piperazine derivative is 0.5-2.0.15. The composition of claim 11 , wherein the concentration of the piperazine derivative is at least 5.1 equivalents/Kg HO and the concentration of the alkali salt is approximately 5.1 equivalents/Kg HO.16. The composition of claim 11 , further comprising an antifoaming agent claim 11 , an antioxidant claim 11 , a corrosion inhibitor claim 11 , a flocculation aid claim 11 , or a mixture thereof.1742-. (canceled) This application claims priority to, and incorporates by reference, U.S. Provisional Patent Application Ser. No. 60/460,532 filed Apr. 4, 2003. The present invention relates generally to the ...

HUMAN AND MOUSE TARGETING PEPTIDES IDENTIFIED BY PHAGE DISPLAY

The present invention concerns methods and compositions for in vivo and in vitro targeting. A large number of targeting peptides directed towards human organs, tissues or cell types are disclosed. The peptides are of use for targeted delivery of therapeutic agents, including but not limited to gene therapy vectors. A novel class of gene therapy vectors is disclosed. Certain of the disclosed peptides have therapeutic use for inhibiting angiogenesis, inhibiting tumor growth, inducing apoptosis, inhibiting pregnancy or inducing weight loss. Methods of identifying novel targeting peptides in humans, as well as identifying endogenous receptor-ligand pairs are disclosed. Methods of identifying novel infectious agents that are causal for human disease states are also disclosed. A novel mechanism for inducing apoptosis is further disclosed. 1. A method comprisinga) injecting a subject with a phage display library;b) obtaining samples of one or more organs or tissues;c) producing thin sections of the samples; andd) recovering phage from the thin sections.2. The method of claim 1 , further comprising selecting one or more portions of a thin section by PALM (Positioning and Ablation with Laser Microbeams).3. The method of claim 2 , wherein the selected portion contains a specific cell type.4. The method of claim 2 , wherein the selected portion contains a homogenous population of cells.5. The method of claim 3 , wherein the cells are cancer cells.6. The method of claim 1 , wherein the phage are recovered by infecting bacteria with the phage.7. The method of claim 1 , wherein the phage are recovered by amplifying phage inserts and ligating the amplified inserts to phage DNA to produce new phage.8. A method of preparing a phage display library comprising:a) immunizing a host animal with a target organ, tissue or cell type;b) obtaining mRNAs encoding antibodies from the host animal;c) preparing cDNAs from the mRNAs encoding antibodies; andd) preparing a phage display library from ...

POROUS STRUCTURES WITH MODIFIED BIODEGRADATION KINETICS

Biodegradation kinetics of biodegradable porous objects, such as porous silicon objects, can be controlled by a molecular weight of polymer chains, such as polyethylene glycol chains, disposed on an outer surface of the object. Provided are biodegradable porous objects, which have their biodegradation kinetics controlled by a molecular weight of the disposed polymer chains. Also provided are methods of making such biodegradable porous objects as well as methods of using such biodegradable porous objects for delivery of active agents, such as therapeutic agents and/or imaging agents. 1. A biodegradable object , comprising a porous body , that has an outer surface , and polymer chains disposed on said outer surface , wherein biodegradation kinetics of the object is determined by a pore size in the porous body and a molecular weight of the polymer chains.2. The object of claim 1 , wherein said object comprises a plurality of microparticles or nanoparticles.3. The object of claim 1 , that is an implant.4. The object of claim 1 , wherein the porous body comprises a porous etched material.5. The object of claim 4 , wherein the porous body comprises porous silicon.6. The object of claim 1 , wherein the porous body comprises a nanoporous material.7. The object of claim 1 , wherein the polymer chains are hydrophilic polymer chains.8. The object of claim 1 , wherein the polymer chains comprise polyethylene glycol.9. The object of claim 1 , wherein the polymer chains are covalently bound to the outer surface.10. The object of claim 1 , wherein the porous body has a pore size from 25 to 120 nm.11. The object of claim 10 , wherein the porous body has a pore size from 30 to 60 nm.12. The object of claim 10 , wherein the polymer chains have a molecular weight from about 800 to about 10 claim 10 ,000.13. The object of claim 10 , wherein the polymer chains have a molecular weight from about 800 to about 7 claim 10 ,000.14. The object of claim 1 , that is biocompatible.15. The object ...

SYSTEMS AND METHODS FOR PRESSURE MEASUREMENT USING OPTICAL SENSORS

Embodiments of systems and methods for pressure measurement using optical sensors are disclosed that include a computer processor that executes logic instructions to receive data based on optical signals from an optical sensor. The data represents velocity of the object after being exposed to a first pressure force. The velocity is determined from an unshifted, reference optical signal and a Doppler-shifted optical signal reflected off the object. The pressure force applied to the object is determined based on the velocity of the object. 1. A pressure gauge system comprising: receive data based on optical signals from an optical sensor, the data represents velocity of the object after being exposed to a first pressure force, the velocity is determined from an unshifted, reference optical signal and a Doppler-shifted optical signal reflected off the object;', 'determine the velocity of the object from the data; and', 'determine the first pressure force applied to the object based on the velocity of the object., 'a computer processor including logic instructions operable to2. The system of claim 1 , further comprising:a housing, a first opening in one end of the housing, the opening exposes a portion of the object to the first pressure force; andthe object, wherein the object is configured to move in an inner portion of the housing when the pressure force is applied to the object.3. The system of claim 2 , further comprising:the optical sensor positioned to emit an optical signal on the object.4. The system of claim 2 , further comprising: a laser operable to emit optical signals; and', 'a detector that detects the optical signals reflected off the object and the optical signals from the laser., 'the optical sensor includes5. The system of claim 1 , further comprising:the object includes a reflective surface that reflects the optical signals back toward the optical sensor.6. The system of claim 1 , further comprising:calibration data that maps different velocities to ...

Systems and Methods for Detecting a Novel Data Class

Systems and methods for data classification and novel data class detection are provided. In one illustrative embodiment, a system or method for detecting a novel class includes receiving a data stream comprising a plurality of data points, and identifying a set of filtered outliers, in the plurality of data points, that are outside of a decision boundary. A cohesion and a separation for the set of filtered outliers may be determined. A novel class may be detected using the cohesion and the separation of the set of filtered outliers, and the novel class may include the set of filtered outliers. 1. A method for detecting a novel class , the method comprising:receiving a data stream comprising a plurality of data points;identifying a set of filtered outliers, in the plurality of data points, that is outside of a decision boundary;determining a cohesion and a separation for the set of filtered outliers; anddetecting a novel class using the cohesion and the separation of the set of filtered outliers, the novel class comprising the set of filtered outliers.2. The method of claim 1 , wherein the cohesion for a filtered outlier comprises a measure of closeness between the filtered outlier and other filtered outliers in the set of filtered outliers.3. The method of claim 1 , wherein the separation for a filtered outlier comprises a measure of separation between the filtered outlier and a set of training data points in the plurality of data points.4. The method of claim 1 , wherein detecting the novel class using the cohesion and the separation of the set of filtered claim 1 , outliers comprises detecting the novel class in response to a threshold number q of the set of filtered outliers having the cohesion and the separation exceeding a predetermined threshold.5. The method of claim 1 , further comprising:classifying a portion of the plurality of data points into one or more existing classes in response to the portion of the plurality of data points being within the decision ...

THERMOELECTRIC MATERIALS

A thermoelectric material having a high ZT value is provided. In general, the thermoelectric material is a thin film thermoelectric material that includes a heterostructure formed of IV-VI semiconductor materials, where the heterostructure includes at least one potential barrier layer. In one embodiment, the heterostructure is formed of IV-VI semiconductor materials and includes a first matrix material layer, a potential barrier material layer adjacent to the first matrix material layer and formed of a wide bandgap material, and a second matrix material layer that is adjacent the potential barrier material layer opposite the first matrix material layer. A thickness of the potential barrier layer is approximately equal to a mean free path distance for charge carriers at a desired temperature. 1. A thermoelectric material comprising:a first matrix material layer formed of a IV-VI semiconductor material;a potential barrier material layer adjacent to the first matrix material layer and formed of a wide bandgap IV-VI semiconductor material, the potential barrier material layer having a thickness that is approximately equal to a mean free path of charge carriers between scattering events for a desired temperature; anda second matrix material layer adjacent to the potential barrier material layer opposite the first matrix material layer and formed of the IV-VI semiconductor material.2. The thermoelectric material of wherein a thickness of the second matrix material layer is equal to or greater than three times the thickness of the potential barrier material layer.3. The thermoelectric material of wherein the second matrix material layer is downstream from the potential barrier material layer in a direction of charge carrier flow when the thermoelectric material is incorporated into a thermoelectric device.4. The thermoelectric material of wherein a Fermi energy of the thermoelectric material is approximately equal to a barrier height of the potential barrier material layer ...

METHODS AND APPARATUS FOR REAL-TIME MONITORING OF CADMIUM ION DURING SOLUTION GROWTH OF CADMIUM SULFIDE THIN FILMS

The present invention provides a reaction chamber to monitor a metal ion in solution during the formation of a metal-sulfide layer on a substrate. The reaction chamber houses a solution of an ammonium ion, a metal ion and a buffer. The reaction chamber includes an anion-selective electrode in the solution to monitor the metal ion that measures the metal ion during metal-ammonium complex formation, metal-thiourea complex formation, metal sulfide composition formation, metal sulfide layer formation or a combination thereof. 1. A reaction chamber to monitor a metal ion in solution during the formation of a metal-sulfide layer on a substrate comprising:a reaction chamber that houses a solution, wherein the solution comprises an ammonium ion, a metal ion, and a buffer; andan anion-selective electrode in the solution to monitor the metal ion, wherein the anion-selective electrode measures the metal ion during metal-ammonium complex formation, metal-thiourea complex formation, metal sulfide composition formation, metal sulfide layer formation or a combination thereof.2. The apparatus of claim 1 , wherein the metal ion is selected from a group consisting of silver claim 1 , nickel claim 1 , zinc claim 1 , cadmium claim 1 , tin claim 1 , copper claim 1 , or combinations or mixtures thereof.3. The apparatus of claim 1 , wherein the substrate comprises a solar cell.4. A method for forming a metal layer on a solar cell substrate comprising the steps of:providing a reaction chamber in communication with a solution;combining an ammonium ion, a metal ion, and a buffer in the solution;monitoring the metal ion in the solution with an anion-selective electrode;forming a metal-ammonium complex in the reaction chamber;decomplexing the metal-ammonium complex;titrating with a thiourea composition to form a metal-thiourea complex;forming a metal sulfide composition from the metal-thiourea complex; anddepositing a metal sulfide layer on a solar cell substrate in the reaction chamber.5. The ...

INHIBITION OF MAMMALIAN TARGET OF RAPAMYCIN

Disclosed are microcapsules that include an inhibitor of the mammalian target of rapamycin (mTOR) within the microcapsules, and pharmaceutical compositions and kits that include the microcapsules. Also disclosed are methods for treating or preventing an age-related disease, condition, or disorder in a subject that involve administering to a subject a pharmaceutically effective amount of microcapsules that includes an inhibitor of mTOR within the microcapsules. 145-. (canceled)46. A method for orally administering rapamycin to a subject in need thereof comprising administering to the subject a composition comprising rapamycin in combination with a hydrophilic , swellable , hydrogel forming material , wherein said composition is encased in a coating that includes a water insoluble polymer and a hydrophilic water permeable agent.47. The method of claim 46 , wherein the water insoluble polymer is a methyl methacrylate-methacrylic acid copolymer.48. The method of claim 46 , wherein the subject is a mammal.49. The method of claim 46 , wherein the subject is a human.50. The method of claim 46 , wherein the subject in need thereof is known or suspected to have an age-related disease.51. The method of claim 50 , wherein the age-related disease is Alzheimer's disease or cancer.52. The method of claim 50 , wherein the subject is a human greater than age 50.53. The method of claim 46 , wherein the composition reduces age-related decline in cognition in the subject.54. The method of claim 46 , wherein the rapamycin containing composition is comprised in a food or food additive.55. The method of claim 46 , wherein the rapamycin containing composition comprises 25% to 60% by weight of rapamycin.56. The method of claim 55 , wherein the average blood level of rapamycin in the subject is greater than 25 ng/ml after administration of the composition.57. A method for treating or delaying onset of an age-related disease or prolonging the lifespan of a mammalian subject in need thereof ...

METHOD FOR IMPARTING ANTIMICROBIAL ACTIVITY TO A MEDICAL DEVICE

A method for imparting broad spectrum antimicrobial activity to a medical device. The medical device is sequentially contacted with a first antimicrobial component, such as an antiseptic, and thereafter with a second antimicrobial component, such as a mixture of antibiotics. The first component may be a guanidium compound, such as chlorhexidine. The second component may be a mixture of a tetracycline, such as minocycline, and a rifamycin, such as rifampin. 1. A method for imparting antimicrobial activity to a medical device , comprising:providing a solution of a first antimicrobial component, said first antimicrobial component comprising an antiseptic;contacting at least a portion of the medical device with the solution of the first antimicrobial component, under conditions such that the first antimicrobial component coats or impregnates the medical device portion;providing a solution of a second antimicrobial component, said second antimicrobial component comprising at least one antibiotic; andcontacting said portion of the medical device with the solution of the second antimicrobial component, under conditions such that the second antimicrobial component forms a coating on the portion of the medical device having the first antimicrobial component coated or impregnated thereon, wherein the respective first and second antimicrobial components are coated on the medical device at a concentration effective to inhibit the adherence of bacterial and fungal organisms to the medical device.2. The method of claim 1 , wherein the solution of the second antimicrobial component is combined with the solution of the first antimicrobial component following the first contacting step claim 1 , and wherein the second contacting step is carried out with the combined solution.3. The method of claim 1 , wherein the antiseptic comprises a guanidium compound.4. The method of claim 3 , wherein said guanidium compound comprises chlorhexidine.5. The method of claim 1 , wherein the ...

NEEDLE BIOBSY IMAGING SYSTEM

Imaging techniques. Radiation is directed from a source onto a sample using an endoscope having cellular or subcellular resolution. The endoscope includes one or more fibers. The fibers have a proximate end and a distal end, and the distal end is lensless. A focal plane of the endoscope is substantially at a tip of the distal end. Radiation from the sample is directed onto a detector to diagnose or monitor the sample. 1. A method of imaging comprising:identifying a patient tissue sample for imaging with an endoscope containing a image guide, wherein the image guide includes a coherent fiber optic bundle having a proximal end and a lenseless transverse distal end;placing the distal end in contact with the tissue sample;directing radiation from a source onto the tissue sample through the distal end of the imaging guide; anddirecting radiation from the sample through the distal end of the imaging guide onto a detector.2. The method of claim 1 , wherein the coherent fiber optic bundle is designed to distinguish objects that are 2 μm or larger.3. The method of claim 1 , the tissue sample including one or more markers or contrast agents.4. The method of claim 3 , wherein the one or more markers or contrast agents comprise toluidine blue claim 3 , cresyl violet claim 3 , acetic acid claim 3 , fluorescein claim 3 , NBDG (a fluorescent glucose analog) claim 3 , antibody-targeted fluorescent dyes claim 3 , antibody-targeted nanoparticles claim 3 , antibody-targeted quantum dots claim 3 , Lugol's iodine claim 3 , methylene blue claim 3 , crystal violet claim 3 , fluorescent Dextran claim 3 , SYTO nucleic acid stains claim 3 , Alexa Fluor dyes claim 3 , gold nanoparticles or silver nanoparticles.5. The method of claim 3 , wherein one or more markers or contrast agents comprise a fluorophore or nanoparticle.6. The method of claim 1 , further comprising the step of analyzing the detected radiation from the sample to assess the tissue sample for a cancerous or a pre-cancerous area ...

NEEDLE BIOBSY IMAGING METHOD

Imaging techniques. Radiation is directed from a source onto a sample using an endoscope having cellular or subcellular resolution. The endoscope includes one or more fibers. The fibers have a proximate end and a distal end, and the distal end is lensless. A focal plane of the endoscope is substantially at a tip of the distal end. Radiation from the sample is directed onto a detector to diagnose or monitor the sample. 1. An imaging system for imaging a tissue sample , comprising:an image guide having a plurality of coherent optical fibers, the image guide having a proximate end and a lensless distal end, wherein a focal plane of the image guide is substantially at a transverse tip of the distal end;a radiation source;optics configured to direct radiation from the source to the proximate end of the fiber bundle;a detector; andoptics configured to direct a sample emission from the proximate end of the fiber bundle to the detector.2. The imaging system of claim 1 , wherein the imaging system is configured to image a sample in vivo.3. The imaging system of claim 1 , wherein the imaging system is configured to operate in a fluorescent mode.4. The imaging system of claim 1 , wherein the imaging system is configured to operate in a reflectance mode.5. The imaging system of claim 1 , wherein the imaging system is compatible with a Magnetic Resonance Imaging (MRI) device.6. The imaging system of claim 1 , wherein the resolution of the imaging system is about 2 micrometers.7. The imaging system of claim 1 , wherein the image guide contains a first set of fibers configured to transmit the radiation from the source to the tissue sample and a second set of fibers configured to transmit the sample emission from the tissue sample to the detector.8. The imaging system of claim 1 , wherein the image guide contains a plurality of fibers configured to both transmit the radiation from the source to the tissue sample and to transmit the sample emission from the tissue sample to the ...

Isolation and Characterization of Novel Green Fluorescent Proteins from Copepods

The isolation and characterization of two protein isoforms collected green fluorescent copepods is described herein. The new GFP-like isoforms pmimGFP1 and pmimGFP2 of the present invention are quick to mature and rapidly produce a fluorescent signal. The two isoforms are very similar in molar extinction coefficients (ME) with 105,000 Mcmfor pmimGFP1 and 103,000 Mcmfor pmimGFP2, respectively. The relative brightness of these two new copepod GFP-like proteins is the highest measured for any isolated GFP-like protein. 1. An isolated nucleic acid molecule comprising a nucleotide sequence that is at least 95% homologous to a SEQ ID NO.: 2 or to a SEQ ID NO.: 4.2. The nucleic acid molecule of claim 1 , wherein the nucleotide sequence is cloned from one or more RNA molecules isolated from one or more marine species.3. The nucleic acid molecule of claim 2 , wherein the marine species comprises one or more Pontellids claim 2 , jellyfish species claim 2 , hydrozoans claim 2 , anthozoans claim 2 , corals claim 2 , copepods claim 2 , arthropods claim 2 , crustaceans claim 2 , chordates claim 2 , cephalocordates or any combinations thereof.4. The nucleic acid molecule of claim 1 , wherein the nucleotide sequence is at least 95 claim 1 , 96 claim 1 , 97 claim 1 , 98 or 99% identical to SEQ ID NO.: 2 or to SEQ ID NO.: 4.5. The nucleic acid molecule of claim 1 , wherein the nucleotide sequence encodes one or more functional proteins.6. The nucleic acid molecule of claim 5 , wherein the one or more functional proteins comprise one or more green fluorescent proteins.7. The nucleic acid molecule of claim 6 , wherein the one or more green fluorescent proteins have a molar extinction coefficient of at least 100 claim 6 ,000 Mcm.8. The nucleic acid molecule of claim 6 , wherein the one or more green fluorescent proteins have a quantum yield of at least 0.90.9. The nucleic acid molecule of claim 6 , wherein the one or more green fluorescent proteins have an absorbance maximum between 480 ...

COVALENTLY FUNCTIONALIZED PARTICLES FOR SYNTHESIS OF NEW COMPOSITE MATERIALS

The present invention includes compositions and methods for synthesis of composite materials involving gas phase plasma polymerization to covalently plasma graft an organic molecule onto particles; covalently binding an organic monomer to the functionalized particles; and, polymerizing the organic monomers into hybrid polymer composite materials. 122-. (canceled)23. A method of making a material comprising:covalently plasma grafting an organic molecule onto a particle;covalently binding an organic monomer to the organic molecule on the particle; andpolymerizing the monomers into a hybrid polymer.24. The method of claim 23 , wherein the particles comprise metal particles.25. The method of claim 23 , wherein the particles comprise inorganic and organic particles.26. The method of claim 23 , wherein the organic molecule is a carboxy group claim 23 , a halide claim 23 , an epoxy group claim 23 , an isocyanate group claim 23 , a hydroxyl group claim 23 , an amine group claim 23 , aldehyde group claim 23 , acid group claim 23 , alkyl group claim 23 , alkane group claim 23 , alkene group claim 23 , alkyne group claim 23 , aromatic group claim 23 , alcohol group claim 23 , ether group claim 23 , ketone group claim 23 , ester group claim 23 , amide group claim 23 , amino acid group claim 23 , nitro group claim 23 , nitrile group claim 23 , carbohydrate group claim 23 , thiol group claim 23 , organic phosphate group claim 23 , lipid group claim 23 , phospholipid group and steroid group.27. The method of claim 23 , wherein the particles comprise metal particles.28. The method of claim 23 , wherein the particles comprise inorganic or organic particles.29. The method of claim 23 , wherein the particle comprises an element claim 23 , alloy claim 23 , oxide or nitride of a metal selected from the group consisting of Ga claim 23 , Au claim 23 , Ag claim 23 , Cu claim 23 , Al claim 23 , Ta claim 23 , Ti claim 23 , Ru claim 23 , Ir claim 23 , Pt claim 23 , Pd claim 23 , Os claim 23 , ...

Photovoltaic-Thermal (PV-T) System for Desalination

A photovoltaic-thermal (PV-T) system and a method of cooling photovoltaic (PV) cells in the system is described herein. Energy from an excitation source such as the sun hits the PV cells in the PV-T system causing heating that reduces PV efficiency. The PV cells are cooled by fluid in an intact heat-transfer system making a heated water byproduct while the PV cells release a form of energy. In addition, the PV-T system can be implemented in a desalination plant to harvest energy and heat for desalination processes. The present invention also includes methods for transferring heat from PV cells to the earth to improve PV performance and reduce thermal shock to the PV cells. 1. A photovoltaic-thermal (PV-T) based desalination system , wherein the PV-T desalination system comprises:one or more arrays of photovoltaic (PV) cells in thermal communication with an excitation source;a cooling system in contact with the PV-T system, wherein a fluid that traverses the cooling system cools the PV cells and makes a heated water byproduct; anda desalination system for capturing and using a thermal energy from the heated water byproduct.2. The system of claim 1 , wherein the desalination system comprises a reverse osmosis (RO) claim 1 , nanofiltration (NF) claim 1 , electrodialysis (ED) claim 1 , electrodialysis reversal (EDR) claim 1 , electrodeionization (EDI) claim 1 , capacitive deionization (CDI) claim 1 , membrane distillation (MD) claim 1 , evaporative desalination processes claim 1 , or any combinations thereof.3. The system of claim 1 , wherein one or more lenses or mirrors are used to intensify the thermal communication with the excitation source to harvest a form of energy.4. A method of cooling one or more photovoltaic (PV) cells in a photovoltaic-thermal (PV-T) based desalination system claim 1 , comprising the steps of:disposing a cooling system on, at, or about the one or more PV cells, wherein a fluid that traverses the cooling system cools the PV cells to produce ...

One-Step Processing of Hydrogels for Mechanically Robust and Chemically Desired Features

The application of a highly controlled, micron-sized, branched, porous architecture to enhance the handling properties and degradation rate of hydrogels is described in the instant invention. A previously described pattern created through one-step nucleated crystallization in a hydrogel film creates tunable mechanical properties and/or chemical stability for use in tissue engineering applications. The bulk mechanical properties and the degradation rate of the material can be tuned easily by the addition or subtraction of crystalline structure or by the addition and subtraction of backfill material, making this useful for a variety of applications. Relevant mechanical properties that can be tuned through the application of this unique porosity are moduli, elasticity, tensile strength, and compression strength. The method of the present invention can be applied to biopolymers and natural materials as well as synthetic materials. 1. A method of making a directed branched porous polymer comprising the steps of:preparing an aqueous mixture of one or more uncrosslinked polymers and a crystallizable molecule;casting the aqueous mixture onto a vessel, a slide, a plate, tissue-culture dish or combinations and modifications thereof to form a cast mixture;drying the cast mixture to form an amorphous polymer film;seeding the cast mixture with a seed crystal of the crystallizable molecule;growing the crystallizable molecule into a crystal structure within the uncrosslinked polymer;exposing the cast mixture to ultraviolet light, wherein the exposure results in a gelling or a crosslinking of the polymer;crosslinking the uncrosslinked polymer around the crystal structure by an addition of one or more crosslinking agents under conditions in which the crystal structure within the crosslinked polymer is maintained;removing the one or more crystals of the crystallizable polymers by rinsing with water to form a branched porous polymer base film;removing water from the porous polymer ...

Anti-Adhesive Barrier Membrane Using Alginate and Hyaluronic Acid for Biomedical Applications

A non-synthetic, hydrophilic, biodegradable, biocompatible polysaccharide based non-toxic anti-adhesion hydrogel barrier is disclosed herein. The barrier of the present invention is formed by constructing a unique interpenetrating, crosslinked network with a unique porosity. Furthermore, the barrier of the present invention is comprised of tunable biopolymers for controllable mechanical robustness and degradation. The barrier of the present invention effectively reduces unwanted adhesions using non-synthetic components. 1. A method of making a porous anti-adhesion hydrogel comprising the steps of:preparing an aqueous mixture of one or more uncrosslinked polymers and a crystallizable molecule;casting the aqueous mixture onto a vessel, a slide, a plate, tissue-culture dish or combinations and modifications thereof to form a cast mixture;drying the cast mixture to form an amorphous hydrogel film;seeding the cast mixture with a seed crystal of the crystallizable molecule;growing the crystallizable molecule into a crystal structure within the uncrosslinked polymer;exposing the cast mixture to ultraviolet light, wherein the exposure results in a gelling or a crosslinking of the polymer;crosslinking the uncrosslinked polymer around the crystal structure by an addition of one or more crosslinking agents under conditions in which the crystal structure within the crosslinked polymer is maintained;removing the one or more crystals of the crystallizable polymers by rinsing with water to form the porous hydrogel; andremoving water from the porous hydrogel by controlled desiccation under pressure.2. The method of claim 1 , wherein the method comprises the optional step of surface coating claim 1 , modifying a surface or combinations thereof by soaking the dessicated hydrogel in an aqueous solution comprising the uncrosslinked polymer and one or more agents or chemicals to facilitate formation of one or more bonds.3. The method of claim 2 , wherein the one or more bonds comprise ...

METHODS AND DEVICES FOR DETERMINING QUALITY OF SERVICES OF STORAGE SYSTEMS

Methods and systems for allowing access to computer storage systems. Multiple requests from multiple applications can be received and processed efficiently to allow traffic from multiple customers to access the storage system concurrently. 1. A method for providing access to a storage system , the method comprising:(a) receiving a plurality of requests from a plurality of applications for access to the storage system;(b) assigning each application to one of a plurality of queues;(c) calculating an initial quanta for each queue;(d) selecting a first queue to access the storage system so that a request from the first queue can be serviced by the storage system;(e) calculating a subsequent quanta for the first queue after the request from the first queue has been serviced by the storage system;(f) determining if the subsequent quanta for the first queue is greater than or less than a predetermined value;(g) selecting the first queue to access the storage system if the subsequent quanta for the first queue is greater than the predetermined value, so that a subsequent request from the first queue can be serviced by the storage system; and(h) selecting a second queue to access the storage system if the subsequent quanta for the first queue is less than the predetermined value, so that a request from the second queue can be serviced by the storage system.2. The method of wherein steps (c) through (g) are repeated until the subsequent quanta for the first queue is less than the predetermined value.3. The method of further comprising:(i) calculating a subsequent quanta for the second queue after the request from the second queue has been serviced by the storage system;(j) determining if the subsequent quanta for the second queue is greater than or less than the predetermined value;(k) selecting the second queue to access the storage system if the subsequent quanta for the second queue is greater than the predetermined value, so that a subsequent request from the second queue ...

Cyclic Peptide Analogues For Non-Invasive Imaging of Pancreatic Beta-Cells

Compositions, methods of using and methods of making a cyclic peptide analog imaging agent that includes at least portions of a peptide or protein that binds specifically to the GLP-1 receptor (GLP-1R) and the cyclic analog has one or more conformational restrictions including, but not limited to, lactam bridges, disulfide bridges, hydrocarbon bridges, and their combinations, salts and derivatives thereof wherein the cyclic analog is more stable than a non-cyclic analog when incubated in the presence of enzymes that degrade GLP-1 and have an increased serum half-live, wherein the cyclic analog comprises at least a portion of a GLP-1 peptide or at least a portion of an Exendin peptide salts, derivatives or combinations thereof. 1. An imaging agent comprising:a cyclic peptide analog comprisinga portion of a peptide or protein that binds specifically to the GLP-1 receptor (GLP-1R) and the cyclic analog has one or more conformational restrictions including, but not limited to, lactam bridges, disulfide bridges, hydrocarbon bridges, and their combinations, salts and derivatives thereof wherein the cyclic analog is more stable than a non-cyclic analog when incubated in the presence of enzymes that degrade GLP-1 and have an increased serum half-live;a linker molecule connected to the portion of a peptide or protein; andan imaging molecule connected to the linker molecule.2. A composition comprising:at least a portion of an analogue with over 75% sequence homology to GLP-1 with one or more conformational restrictions including, but not limited to, lactam bridges, disulfide bridges, hydrocarbon bridges, and their combinations, between the positions 7 and 36 of GLP-1, salts and derivatives thereof wherein the agent is more stable than a non-cyclic analog when incubated in the presence of enzymes that degrade GLP-1 and have an increased serum half-live;a linker molecule connected to the at least a portion of an analogue; andan imaging molecules connected to the linker molecule ...

Attenuation of Encephalitogenic Alphavirus and Uses Thereof

The present invention is drawn to generating attenuated and less cytopathic forms of New World alphaviruses that can be used in immunogenic compositions as vaccines against both Old and New World alphaviruses. In this regard, the present invention discloses that the N-terminal, ˜35-aa-long peptide of VEEV, EEEV and, most likely, of WEEV capsid proteins plays the most critical role in the downregulation of cellular transcription and development of cytopathic effect. The identified, VEEV-specific peptide, C30-68, includes two domains with distinguished functions. The integrity of both domains determines not only the intracellular distribution of C, but is also essential for direct capsid function in the inhibition of transcription. The replacement of the N-terminal fragment of Cby its SINV-specific counterpart in VEEV TC-83 genome does not affect virus replication in vitro, but makes it less cytopathic and more attenuated in vivo. 115.-. (canceled)16. An attenuated encephalitogenic alphavirus comprising a capsid protein mutation in an N-terminal transcription inhibition domain of encephalitogenic alphavirus capsid protein that results in an attenuated encephalitogenic alphavirus.17. The attenuated encephalitogenic alphavirus of claim 16 , wherein the mutation is a deletion.18. The attenuated encephalitogenic alphavirus of claim 17 , wherein the mutation comprises a deletion in an α-helix subdomain of the N-terminal transcription inhibition domain.19. The attenuated encephalitogenic alphavirus of claim 17 , wherein the mutation comprises a deletion in a downstream positively charged subdomain of the N-terminal transcription inhibition domain.20. The attenuated encephalitogenic alphavirus of claim 17 , wherein the mutation comprises a deletion of the N-terminal transcription inhibition domain.21. The attenuated encephalitogenic alphavirus of claim 16 , wherein the mutation is a substitution.22. The attenuated encephalitogenic alphavirus of claim 21 , wherein the ...

Fabrication of Biscrolled Fiber Using Carbon Nanotube Sheet

Fabrication of yarns or other shaped articles from materials in powder form (or nanoparticles or nanofibers) using carbon nanotube/nanofiber sheet as a platform (template). This includes methods for fabricating biscrolled yarns using carbon nanotube/nanofiber sheets and biscrolled fibers fabricated thereby. 1. A method comprising the steps of:a. forming a nanofiber sheet or nanofiber sheet stack as a sheet platform for particle material deposition;b. depositing particle material onto the sheet platform to form a bilayered sheet structure; andc. scrolling the bilayered sheet structure into a biscrolled yarn.2. The method of claim 1 , further comprising densifying the biscrolled yarn using liquid absorption and subsequent evaporation.3. The method of claim 1 , further comprising introducing a twist during formation of the biscrolled yarn.4. The method of claim 3 , wherein the sheet platform comprises carbon nanotubes.5. (canceled)6. The method of claim 1 , wherein the biscrolled yarn has a specific strength at least about 50 MPa/(g/cm).7. The method of claim 4 , wherein the carbon nanotubes in the sheet platform are predominately oriented in the same in-plane direction.8. The method of claim 4 , wherein the carbon nanotube sheet platform is selected from the group consisting of (a) a carbon nanotube sheet wedge that results from direct twist-based spinning from a carbon nanotube forest and (b) a self-suspended nanotube sheet or sheet stack obtained by sheet draw from a carbon nanotube forest.911-. (canceled)12. The method of claim 1 , wherein the particle material comprises at least about 50 weight percent of the biscrolled yarn.1316-. (canceled)17. The method of claim 1 , wherein the particle material comprise nanoparticles.18. (canceled)19. The method claim 17 , wherein the nanoparticles comprise nanofibers.20. The method of claim 19 , wherein the nanofibers comprise nitrogen doped nanotubes or graphene ribbons.21. The method of claim 1 , wherein the particle ...

ALKOXY CARBOXYLATE SURFACTANTS

Provided herein are inter alia novel compositions and methods having application in a variety of fields including the field of enhanced oil recovery, the cleaning industry as well as groundwater remediation. In particular, the alkoxy carboxylate compounds and mixtures thereof presented herein can be used, inter alia, for the recovery of a large range of crude oil compositions from challenging reservoirs. 2. The compound of claim 1 , wherein Ris branched unsubstituted C-Calkyl or R-substituted phenyl.3. The compound of claim 1 , wherein Ris branched or linear unsubstituted C-Calkyl claim 1 , (CH—CHCH)CH— (TSP) claim 1 , (CH—CHCH)CH— (DSP) claim 1 , (CH—CHCH)CH— (MSP) claim 1 , or R-substituted or unsubstituted naphthyl.4. The compound of claim 1 , wherein Ris branched unsubstituted C-Calkyl.5. The compound of claim 1 , wherein Ris branched unsubstituted C-Calkyl.6. The compound of claim 1 , wherein Ris branched unsubstituted C-Calkyl.7. The compound of claim 1 , wherein Ris independently hydrogen or unsubstituted C-Calkyl.8. The compound of claim 1 , wherein Ris hydrogen.9. The compound of claim 1 , wherein n is 5 to 180.10. The compound of claim 1 , wherein n is 10 to 100.11. The compound of claim 1 , wherein z is 1.12. The compound of claim 1 , wherein M is Na claim 1 , K claim 1 , NH claim 1 , Ca claim 1 , Mgor Ba.14. The compound of wherein Ris ethyl.17. The compound of wherein:z is 1;{'sup': '3', 'Ris hydrogen;'}x and y are independently 5 to 100; and{'sup': '1', 'sub': 16', '50, 'Ris unsubstituted C-Calkyl or unsubstituted tristyrylphenyl.'}18. An aqueous composition comprising a co-surfactant and the compound of .19. The aqueous composition of claim 18 , wherein said co-surfactant is an anionic surfactant claim 18 , a non-ionic surfactant claim 18 , or a cationic surfactant.20. The aqueous composition of claim 18 , wherein said co-surfactant is an internal olefin sulfonate (IOS) claim 18 , an alfa olefin sulfonate (AOS) claim 18 , an alkyl aryl sulfonate (ARS) ...

AEROSOL-MEDIATED PARTICLE SYNTHESIS

Disclosed are aerosol-mediated methods for synthesizing particles for biomedical and drug delivery applications. The method is based on the production of particles from sprayed polymeric micro or nano-droplets obtained by, for example, an air-jet nebulization process that is followed by gelation and/or hardening in a crosslinking fluid, non-solvent, precipitating solvent, or supercritical fluid. 1. A method of producing a polymeric particle , comprising:a. providing an aqueous or non aqueous mixture of a polymer;b. aerosolizing the mixture; andc. contacting the aerosol with a crosslinking solution, non-solvent, precipitating solvent, or supercritical fluid, thereby producing the particle.2. The method of claim 1 , further comprising adding an oligouronate mixture to the polymer mixture.3. The method of claim 1 , wherein the crosslinking solution comprises a divalent cation.4. The method of claim 3 , wherein the divalent cation is Ca claim 3 , Ba claim 3 , or Sr.5. The method of claim 1 , wherein the non-solvent is ethanol claim 1 , aliphatic hydrocarbon claim 1 , acetic acid claim 1 , acetone claim 1 , ethyl acetate claim 1 , cyclohexanone claim 1 , methanol or hexane claim 1 , the precipitating solvent is dilute hydrochloric acid claim 1 , ethanol claim 1 , acetone claim 1 , ethyl acetate claim 1 , aliphatic hydrocarbon claim 1 , methanol or dilute acetic acid claim 1 , and the supercritical fluid is COor HO.6. The method of claim 1 , wherein the polymer is alginate and/or an alginate salt.7. The method of claim 1 , wherein the crosslinking solution comprises a second polymer.8. The method of claim 7 , wherein the second polymer is chitosan or a chitosan derivative.9. The method of claim 8 , wherein the chitosan is derivatized with polyethylene glycol claim 8 , stearic acid claim 8 , cholanic acid.10. The method of claim 1 , wherein the crosslinking solution is an aqueous solution comprising chitosan derivatized with polyethylene glycol and Ca.11. The method of ...

Remote Interrogation of a Passive Wireless Antenna Sensor

The condition of a structure using remote interrogation of a multi-state passive wireless antenna sensor that has a known resonant frequency when mounted on the structure. The passive wireless antenna sensor is connected to a remotely operated switching circuit that includes a photocell. An interrogation system transmits a series of radio frequency signals with sweeping frequencies around the known resonant frequency to the passive wireless antenna sensor, while simultaneously pulsing a laser to switch the passive wireless antenna sensor between a first state and a second state in which it is exposed to open-circuit or short-circuit conditions. A signal is reflected from the passive wireless antenna sensor in each of the first and second states, and a resonant frequency of the passive wireless antenna sensor is determined by normalizing the received signals to isolate the antenna mode. 1. An monitoring apparatus for determining a condition of a structure , comprising: means for remotely activating a switching circuit associated with the PWA sensor;', transmit to the PWA sensor a series of radio frequency (RF) signals with sweeping frequencies around a known resonant frequency of PWA sensor;', 'receive a response signal reflected by the PWA sensor in a first state prior to activating the switching circuit; and', 'receive a response signal reflected by the PWA sensor in a second state after the switching circuit has been activated; and, 'a transceiver that is configured to], 'a remote interrogation system that is configured to remotely interrogate a passive wireless antenna (PWA) sensor that is mounted on the structure, the remote interrogation system comprisinga signal analyzer that is configured to determine a measured resonant frequency of the PWA sensor based at least in part on the first state response signal and on the second state response signal.2. The apparatus of claim 1 , wherein the signal analyzer is further configured determine a measured resonant ...

COMPOSITIONS AND METHODS FOR TREATING AND DIAGNOSING IRRITABLE BOWEL SYNDROME

Compositions and methods for diagnosing and treating CVH and CVH-associated disorders are disclosed. Genes differentially expressed in CVH tissues relative to normal tissues are identified. The genes and the gene products (i.e., the polynucleotides transcribed from and polypeptides encoded by the genes) can be used as markers of CVH. The genes and the gene products can also be used to screen agents that modulate the gene expression or the activities of the gene products. 1. A method for detecting CVH in a subject , said method comprising:(a) contacting a biological sample with an agent that specifically binds to a polypeptide encoded by a gene listed in Tables 3-8 or a homolog thereof;(b) determining a level of binding of the agent to the polypeptide;(c) comparing the level of binding of the agent in the biological sample to a level of binding of the agent in a normal control sample; and(d) producing a diagnosis based on a result from step (c).2. The method of claim 1 , wherein said polypeptide comprises an amino acid sequence recited in any one of SEQ ID NOS:34-66.3. The method of claim 1 , wherein the agent is an antibody directed against the polypeptide.4. A method for detecting CVH in a subject claim 1 , said method comprising the steps of:(a) determining a level of a transcribed polynucleotide in a biological sample obtained from the subject, wherein the transcribed polynucleotide is transcribed from a gene listed in Tables 3-8 or homolog thereof;(b) comparing the level of the transcribed polynucleotide in the biological sample to a normal level of the transcribed polynucleotide; and(c) producing a diagnosis based on a result from step (b).5. The method of claim 4 , wherein said transcribed polynucleotide comprises a nucleic acid sequence recited in any one of SEQ ID NOS:1-33 claim 4 , or a complement of any of the foregoing nucleic acid sequences.6. The method of claim 4 , wherein the transcribed polynucleotide is an mRNA.7. A method for detecting CVH in a ...

Method for Increasing the Efficiency of Organic Photovoltaic Cells

The present invention is directed to an organic photovoltaic cell that contains one or more dipole regions generally disposed between an organic active region and the electrodes and a process for producing such an organic photovoltaic cell. 1. An organic photovoltaic cell comprising:(a) a cathode;(b) an anode;(c) an organic active region for absorbing photons and generating excitons disposed between the cathode and the anode; and (ii) an anode dipole region generally disposed between the organic active region and the anode, wherein the anode dipole region exhibits a negative charge near the organic active region; or', '(iii) both (i) and (ii)., '(d) (i) a cathode dipole region generally disposed between the organic active region and the cathode, wherein the cathode dipole region exhibits a positive charge near the organic active region;'}2. The organic photovoltaic cell of claim 1 , wherein:the cathode comprises magnesium, aluminum, calcium, lithium, sodium, potassium, strontium, cesium, barium, iron, cobalt, nickel, copper, silver, zinc, tin, samarium, ytterbium, chromium, gold, graphene, an alkali metal fluoride, an alkaline-earth metal fluoride, an alkali metal chloride, an alkaline-earth metal chloride, an alkali metal oxide, an alkaline-earth metal oxide, a metal carbonate, a metal acetate, or combinations thereof;the anode comprises indium-tin oxide, indium-zinc oxide, silver, gold, platinum, copper, chromium, indium oxide, zinc oxide, tin oxide, a polyaniline-based conducting polymer, a 3,4-polyethylenedioxythiopene-polystyrenesultonate-based conducting polymer, carbon nanotubes, graphite, graphene, graphene oxides, molybdenum oxide, tungsten oxide, vanadium oxide, silver oxide, aluminum oxide, or combinations thereof; and (i) an electron donor material that is selected from the group consisting of a phthalocyanine complex, a porphyrin complex, a polythiophene and derivatives thereof, a polycarbazole and derivatives thereof, a poly(p-phenylene vinylene) and ...

SYSTEMS AND METHODS FOR ULTRASONICALLY EVALUATING STRUCTURAL PROPERTIES

Systems and methods for ultrasonically evaluating one or more microstructural material properties of a structural specimen are disclosed. An example system comprises an ultrasonic sensor unit including a plurality of ultrasonic transducers that generate ultrasonic backscatter within the specimen, and an evaluation module that performs an autocorrelation function on the ultrasonic backscatter data. An autocorrelation algorithm is configured to execute a single scattering response (SSR) model that computes second order grain statistics of the structural specimen. 1. A system for ultrasonically evaluating one or more microstructural properties of a structural specimen , the system comprising:an ultrasonic sensor unit including a plurality of ultrasonic transducers configured for operating in a pulse-echo mode for transmitting ultrasonic waves to a target region on or within a structural specimen and receiving ultrasonic backscatter signals responsive to the ultrasonic waves; andan evaluation module configured for receiving the ultrasonic backscatter signals, the evaluation module configured for performing a statistical autocorrelation function on the ultrasonic backscatter signals and determining one or more microstructural material properties of the specimen.2. The system of claim 1 , wherein the plurality of ultrasonic transducers comprises:a normal incidence ultrasonic transducer configured to transmit ultrasonic waves at an angle normal to the structural specimen for inducing a longitudinal wave mode in the specimen; anda plurality of oblique incidence ultrasonic transducers each configured to transmit ultrasonic waves at an angle oblique to the structural specimen for inducing a shear wave mode in the specimen.3. The system of claim 2 , wherein the plurality of oblique incidence ultrasonic transducers comprises a first oblique incidence ultrasonic transducer and a second oblique incidence ultrasonic transducer.4. The system of claim 3 , wherein the first oblique ...

Step and Flash Imprint Lithography

A method of forming a relief image in a structure comprising a substrate and a transfer layer formed thereon comprises covering the transfer layer with a polymerizable fluid composition, and then contacting the polymerizable fluid composition with a mold having a relief structure formed therein such that the polymerizable fluid composition fills the relief structure in the mold. The polymerizable fluid composition is subjected to conditions to polymerize polymerizable fluid composition and form a solidified polymeric material therefrom on the transfer layer. The mold is then separated from the solid polymeric material such that a replica of the relief structure in the mold is formed in the solidified polymeric material; and the transfer layer and the solidified polymeric material are subjected to an environment to selectively etch the transfer layer relative to the solidified polymeric material such that a relief image is formed in the transfer layer. 1. A method of forming a layer on a surface , said method comprising:flowing a polymerizable composition between said surface and a mold in contact with said polymerizable composition by providing said polymerizable composition with a viscosity in a range 0.01 to 100 centipoise at 25° Celsius so that said polymerizable composition conforms to a shape of said mold;solidifying said polymerizable composition, defining a solidified composition; andincreasing a distance between said solidified composition and said mold.2. The method as recited in wherein flowing further includes providing said polymerizable composition with a viscosity in a range of 1 to 5 centipoise claim 1 , inclusive claim 1 , at 25° Celsius.3. The method as recited in wherein flowing further includes applying said polymerizable composition to said surface and placing said mold proximate to said polymerizable fluid composition.4. The method as recited in wherein flowing further includes applying said polymerizable composition to said surface and pressing ...

UNC-45A SPLICE VARIANTS BASED CANCER DIAGNOSTICS AND THERAPEUTICS

Methods and compositions to diagnose and treat cancers using UNC-45A splice variants are disclosed. Expression of a human UNC-45A929 splice variant that is shorter than UNC-45A944 splice variant is increased in cancer cells including metastatic cancers. siRNA to inhibit or downregulate UNC-45A splice variants in cancers are disclosed. 1. A short interfering RNA (siRNA) or a short hairpin RNA (shRNA) molecule for selectively reducing the expression of a human UNC-45A splice variant in a cell , wherein the RNA molecule is substantially complementary to at least a part of a mRNA encoding the splice variant , wherein the splice variant comprises a nucleic acid sequence as in SEQ ID NO: 1 (nucleotide positions 1-835) or SEQ ID NO: 2.2. The siRNA of claim 1 , wherein the siRNA targets TGGCCGTCACTACCCTGGTTTCTTT or GGACAGAGGTGGTAGTGAACT of the UNC-45A929 splice variant.3. The siRNA of claim 1 , wherein the siRNA targets GGTCCAGGGACCCCCGAGCCCCG or GTGAGTGGTCCAGGGACCCC of UNC-45A944.4. A pharmaceutical composition comprising an effective amount of a siRNA or shRNA of that specifically inhibits the expression of a human UNC-45A929 splice variant in a cancer cell.5. The pharmaceutical composition of claim 4 , wherein the siRNA comprises one or more modified nucleotides.6. The pharmaceutical composition of claim 4 , wherein the shRNA is expressed from a vector.7. A method of reducing the proliferation of a cancer cell claim 1 , the method comprising contacting the cancer cell with an RNAi agent of that specifically downregulates the expression of UNC-45A splice variants.8. The method of claim 7 , wherein the RNAi agent is a siRNA molecule that specifically targets UNC-45A929 splice variant.9. The method of claim 7 , wherein the RNAi agent is a shRNA molecule.10. The method of claim 7 , wherein the cancer cell is selected from the group consisting of breast cancer claim 7 , cervical cancer and colon cancer.11. The method of claim 7 , wherein the cancer cell is a metastatic breast ...

HEMOGLOBIN CONTRAST IN MAGNETO-MOTIVE OPTICAL DOPPLER TOMOGRAPHY, OPTICAL COHERENCE TOMOGRAPHY, AND ULTRASOUND IMAGING METHODS AND APPARATUS

A novel contrast mechanism for imaging blood flow using magneto-motive optical Doppler tomography (MM-ODT), Optical Coherence Tomography, and Ultrasound. MM-ODT, OCT, and ultrasound combined with an externally applied temporally oscillating high-strength magnetic field detects erythrocytes moving according to the field gradient. 1. A method for imaging a blood flow , comprising:applying a magnetic field to the blood flow, wherein the blood flow comprises a plurality of hemoglobin molecules and wherein the magnetic field interacts with the hemoglobin to cause a change in the blood flow; anddetecting the blood flow by detecting the change in the blood flow caused by the interaction with the hemoglobin molecules, wherein the change is detected using a optical coherence tomography system.2. The method of claim 1 , wherein the applying of the magnetic field comprises temporally oscillating the magnetic field.3. The method of claim 2 , further comprising coupling the optical coherence tomography system and the magnetic field to a probe.4. The method of claim 3 , wherein the detecting the blood flow by detecting the change in the blood flow caused by the interaction with the hemoglobin molecules claim 3 , wherein the change is detected using a magnetomotive optical Doppler tomography imaging system.5. The method of claim 4 , wherein the magneto-motive optical Doppler tomography system comprises the method ofproviding light energy through an interferometer;phase modulating the light energy in the interferometer at a modulation frequency;continuously scanning a blood flow sample with the light energy through the interferometer, wherein the blood flow sample includes a blood flow therein and a structure in which the blood flow is defined;detecting the magnetic resonance signal reflected off the moving blood sample and the interference fringes of the light energy backscattered from moving blood sample; anddata processing Doppler frequency changes of the detected backscattered ...

ISOLATION OF HUMAN UMBILICAL CORD BLOOD-DERIVED MESENCHYMAL STEM CELLS

Human umbilical cord blood (UCB) contains mesenchymal stem cells (MSCs) that have higher multipotentiality than adult marrow-derived MSCs. However, it has been difficult to obtain these cells because the frequency of MSCs in UCB is extremely rare (0.4-30 out of 1×10mononuclear cells). To date, the isolation of MSCs has depended upon their plastic-adhesion capacity. Some “true” MSCs could be missed because their ability to adhere to plastic may be poor. Previous studies demonstrated extracellular matrix (ECM) made by bone marrow cells enhanced MSC attachment and proliferation, and retained their stem cell properties. The present invention provides methods for isolating MSCs from umbilical cord blood by adherence to an ECM and uses for the isolated stem cells. 1. A method of isolating mesenchymal stem cells (MSCs) comprising:(a) collecting a sample;(b) seeding the sample on an extracellular matrix (ECM)-precoated culture dish; and(c) isolating the MSCs.2. The method of claim 1 , wherein the sample is from periosteum claim 1 , trabecular bone claim 1 , adipose tissue claim 1 , synovium claim 1 , skeletal muscle claim 1 , deciduous teeth claim 1 , fetal pancreas claim 1 , lung claim 1 , liver claim 1 , amniotic fluid claim 1 , umbilical cord blood and umbilical cord tissues.3. The method of claim 2 , wherein the sample is umbilical cord blood (UCB).4. The method of claim 3 , wherein the umbilical cord blood is human UCB (hUCB).5. The method of claim 1 , wherein the sample is collected after birth.6. The method of claim 4 , wherein the hUCB sample is centrifuged to collect mononuclear cells before seeding.7. The method of claim 1 , wherein the ECM is derived from human bone marrow cells.8. The method of claim 7 , wherein the ECM comprises collagen type I claim 7 , collagen type III claim 7 , fibronectin claim 7 , biglycan claim 7 , decorin claim 7 , perlecan claim 7 , and/or laminin.9. The method of claim 1 , further comprising implanting the isolated MSCs to obtain ...

TREATMENT OF ASTROCYTES-TUMOR CELLS INHIBITORS OF ENDOTHELIN RECEPTORS

The disclosure relates to an endothelin receptor antagonist for use in the prevention or treatment of brain metastases in combination with a cytotoxic chemotherapy agent, radiotherapy or both. The endothelin receptor antagonist may for example be bosentan, macitentan or a mixture of bosentan and macitentan. 126-. (canceled)27. A method of inhibiting an astrocyte mediated protection of a brain metastasis cell from a cytotoxic chemotherapy induced cell death , comprising administering an effective amount of an endothelin receptor antagonist to the brain metastasis cell and the astrocyte thereby inhibiting the astrocyte mediated protection.28. The method of claim 27 , further comprising super-sensitizing the brain metastasis cell to the cytotoxic chemotherapy induced cell death.29. The method of claim 27 , further comprising administering at least one cytotoxic chemotherapeutic agent to the brain metastasis cell.30. The method of claim 29 , wherein the brain metastasis cell is located in an existing brain metastasis tumor in a subject or is an isolated cell.31. The method of claim 30 , wherein the brain metastasis cell is located in an existing brain metastasis tumor in a subject and the tumor is a micrometastasis or a visible tumor.32. The method of claim 31 , wherein the tumor is a lung cancer claim 31 , breast cancer claim 31 , colon cancer claim 31 , melanoma claim 31 , or renal carcinoma brain metastasis tumor.33. The method of claim 29 , wherein the cytotoxic chemotherapy agent comprises paclitaxel claim 29 , adriamycin claim 29 , vinblastine claim 29 , vincristine claim 29 , 5-fluoro-1H-pyrimidine-2 claim 29 ,4-dione claim 29 , cisplatinum claim 29 , cyclophosphamide claim 29 , etoposide claim 29 , teniposide claim 29 , mitomycin claim 29 , irinotecan claim 29 , vinorelbine claim 29 , etoposide claim 29 , ifosfamide claim 29 , temozolomide claim 29 , or combinations thereof.34. The method of claim 27 , wherein the endothelin receptor antagonist is ACT-064992 ...

COMPOSITIONS AND METHOD FOR DEIMMUNIZATION OF PROTEINS

The invention provides deimmunized mutant proteins having reduced immunogenicity while exhibiting substantially the same or greater biological activity as the proteins of interst from which they are derived, as exemplified by mutant L-asparaginase that comprises amino acid substitutions compared to wild type L-asparaginase. The invention further provides methods for screening mutant deimmunized proteins that have substantially the same or greater biological activity as a protein of interest, and methods for reducing immunogenicity, without substantially reducing biological activity, of a protein of interest. 1. A mutant L-asparaginase that 1) methionine at position 115 with valine (M115V),', '2) serine at position 118 with proline (S118P),', '3) serine at position 120 with arginine (S120R),', '4) alanine at position 123 with proline (A123P),', '5) isoleucine at position 215 with valine (1215V),', '6) asparagine at position 219 with glycine (N219G),', '7) glutamine at position 307 with threonine (Q307T), and', '8) glutamine at position 312 with asparagine (Q312N), 'A) comprises 8 amino acid substitutions that correspond to substitution of wild type L-asparaginase SEQ ID NO:03'}B) has the same or greater enzyme activity as wild type L-asparaginase SEQ ID NO:03, andC) has reduced immunogenicity compared to wild type L-asparaginase SEQ ID NO:03.2. The mutant L-asparaginase of claim 1 , wherein said mutant L-asparaginase has the same or greater stability of enzyme activity in serum as wild type L-asparaginase SEQ ID NO:03.3. The mutant L-asparaginase of claim 1 , wherein said mutant L-asparaginase comprises SEQ ID NO:01.4. A pharmaceutical composition comprising the mutant L-asparaginase of claim 1 , and a carrier.5. A recombinant nucleotide sequence encoding the mutant L-asparaginase of .6. The recombinant nucleotide sequence of claim 5 , wherein said nucleotide sequence comprises SEQ ID NO:02.7. An expression vector that comprises a nucleotide sequence encoding the ...

COMPOSITIONS AND METHODS OF TREATMENT FOR INFLAMMATORY DISEASES

Inflammatory bowel diseases are represented by two idiopathic disorders, which include ulcerative colitis and Crohn's disease. Ulcerative colitis is restricted to the colon and involves uncertain and inflammation of the lining (mucosa) of the large intestine. Crohn's disease, on the other hand, can involve the mucosa of the small and/or large intestine and may involve deeper layers of the bowel wall. The present invention is a combination of 5-aminosalicylic acid and one or more antioxidants (e.g., N-acetylcysteine) for treating such inflammatory bowel diseases. 1. A method of treating an inflammatory bowel disease in a mammal by reducing cytokine gene expression in colonic tissue of the mammal , the method comprisingadministering to the mammal by rectal delivery to a colon of the mammal a therapeutically-effective amount of 5-aminosalicylic acid or a pharmaceutically-acceptable salt thereof, and a therapeutically-effective amount of N-acetylcysteine or a pharmaceutically-acceptable salt thereof, whereby administration of the combination of 5-aminosalicylic acid, or a pharmaceutically-acceptable salt thereof, and N-acetylcysteine, or a pharmaceutically-acceptable salt thereof, causes reduced cytokine gene expression in colonic tissue of the mammal.2. The method of claim 1 , wherein the cytokine is selected from the group consisting of IL 1a claim 1 , IL 1b claim 1 , IL-4 claim 1 , IL-6 claim 1 , and TNFα.3. The method of claim 1 , wherein the 5-aminosalicylic acid or a pharmaceutically-acceptable salt thereof claim 1 , and the N-acetylcysteine or a pharmaceutically-acceptable salt thereof claim 1 , are together disposed in a pharmaceutically acceptable carrier.4. The method of claim 1 , wherein the 5-aminosalicylic acid or a pharmaceutically-acceptable salt thereof claim 1 , and the N-acetylcysteine or a pharmaceutically-acceptable salt thereof claim 1 , are administered separately.5. The method of claim 1 , wherein macroscopic injury or inflammation to colonic ...

NOVEL INHIBITORS OF PROLIFERATION AND ACTIVATION OF SIGNAL TRANSDUCER AND ACTIVATORS OF TRANSCRIPTION (STATS)

Pyridine compounds effective in modulation STAT3 and/or STAT5 activation are provided that are useful in the prevention and treatment of proliferative disease and conditions including cancer, inflammation and proliferative skin disorders. 3. The compound as recited in claim 6 , wherein at least one of Xand Xis selected from the group consisting of alkyl claim 6 , cycloalkyl claim 6 , aralkyl claim 6 , alkylester claim 6 , alkylesteralkyl claim 6 , alkylacetoxyl claim 6 , or hydroxylalkyl.4. The compound as recited in claim 6 , wherein at least one of X claim 6 , X claim 6 , X claim 6 , and Xis halogen.6. The compound as recited in claim 9 , wherein:{'sub': '1', 'Xis halogen;'}{'sub': 2', '3', '4', '2, 'X, Xand Xare each independently hydrogen, halogen, alkyl, alkoxy, OH, trihalomethyl, or NO; and'}{'sub': 5', '6', '3, 'Xand Xare each independently hydrogen, cyclopropyl, or —CH.'}7. The compound as recited in claim 9 , wherein:{'sub': '1', 'Xis Br or Cl; and'}{'sub': 2', '3', '4, 'X, X, and Xare each hydrogen.'}8. The compound as recited in claim 11 , wherein:{'sub': 5', '6', '3, 'Xand Xare each independently hydrogen, cyclopropyl, or —CH.'}936. A pharmaceutical composition comprising a compound as recited in claim claim 11 , together with a pharmaceutically acceptable carrier.1044. The pharmaceutical composition as recited in claim claim 11 , wherein said pharmaceutical composition is a topical pharmaceutical composition.1137. A pharmaceutical composition comprising a compound as recited in claim claim 11 , together with a pharmaceutically acceptable carrier.1246. The pharmaceutical composition comprising as recited in claim claim 11 , wherein said pharmaceutical composition is a topical pharmaceutical composition.1342. A pharmaceutical composition comprising a compound as recited in claim claim 11 , together with a pharmaceutically acceptable carrier.1448. The pharmaceutical composition as recited in claim claim 11 , wherein said pharmaceutical composition is a ...

Dopamine 3 receptor agonist and antagonist treatment of gastrointestinal motility disorders

Provided herein are methods of treating gastrointestinal motility disorders by targeting the dopamine 3 receptor (D3R). A D3R agonist is administered to a subject to decrease gastrointestinal motility to treat the disorder. A D3R antagonist is administered to a subject to decrease gastrointestinal motility to treat the disorder. 1. A method of treating a gastrointestinal motility disorder associated with an increase in gastrointestinal motility in a subject , comprising the step of:administering a therapeutically effective amount of a dopamine 3 receptor agonist or a pharmaceutically acceptable salt thereof to the subject.2. The method of claim 1 , wherein the subject is an animal or a human.3. The method of claim 1 , wherein the gastrointestinal motility disorder is at least one of inflammatory bowel disease claim 1 , ulcerative colitis claim 1 , granulomatous enteritis claim 1 , an infectious disease of the small or large intestine claim 1 , pyloric spasm claim 1 , abdominal cramps claim 1 , a functional bowel disorder claim 1 , mild dysenteries claim 1 , diverticulitis claim 1 , acute enterocolitis claim 1 , neurogenic bowel disorders claim 1 , splenic flexure syndrome claim 1 , neurogenic colon claim 1 , or spastic colitis.4. The method of claim 1 , wherein the increase in gastrointestinal motility is caused by one or more medications.5. The method of claim 1 , wherein the dopamine 3 receptor agonist is PD 128907 hydrochloride or 7-hydroxy-2-dipropylaminotetralin.6. The method of claim 1 , wherein the agonist of dopamine 3 receptor is present in a pharmaceutically acceptable sustained release formulation.7. The method of claim 1 , further comprising:administerting the dopamine 3 receptor agonist in combination with at least one other pharmaceutically active compound.8. The method of claim 7 , wherein the at least one other pharmaceutically active compound is a ganglionic blocker claim 7 , a nicotinic-receptor antagonist claim 7 , a gastrointestinal motility ...

Identification of Micro-RNAS Involved in Post-Myocardial Infarction Remodeling and Heart Failure

The present invention relates to the identification of miRNAs that are involved in heart failure and the process of post-myocardial infarction remodeling in heart tissue. Modulation of these identified miRNAs as a treatment for myocardial infarction, cardiac remodelling, and heart failure is described. 1. A method of treating or preventing myocardial infarction , cardiac remodelling , or heart failure in a subject in need thereof comprising modulating the expression or activity of one or more miRNAs listed in Tables 3-6 in the heart cells of the subject.2. The method of claim 1 , wherein the one or more miRNAs are selected from the group consisting of a let-7 family member claim 1 , miR-15b claim 1 , miR-21 claim 1 , miR-199a claim 1 , miR-199b claim 1 , miR-214 claim 1 , miR-10a claim 1 , miR-10b claim 1 , miR-16 claim 1 , miR-146a claim 1 , miR-146b claim 1 , miR-221 claim 1 , miR-222 claim 1 , miR-497 claim 1 , miR-20a claim 1 , miR-20b claim 1 , miR-93 claim 1 , miR-101 claim 1 , miR-126 claim 1 , a miR-30 family member claim 1 , miR-143 claim 1 , miR-145 claim 1 , miR-150 and miR-29a-c.3. The method of claim 2 , wherein modulating comprises administering to the subject an inhibitor of one or more miRNAs selected from the group consisting of a let-7 family member claim 2 , miR-15b claim 2 , miR-21 claim 2 , miR-199a claim 2 , miR-199b claim 2 , miR-214 claim 2 , miR-10a claim 2 , miR-10b claim 2 , miR-16 claim 2 , miR-146a claim 2 , miR-146b claim 2 , miR-221 claim 2 , miR-222 claim 2 , a miR-30 family member claim 2 , and miR-497.4. The method of claim 3 , wherein the inhibitor of one or more miRNAs is an antisense oligonucleotide or an antagomir.5. The method of claim 4 , wherein the antisense oligonucleotide comprises a sequence that is at least partially complementary to a mature sequence of said one or more miRNAs.6. The method of claim 4 , wherein the antisense oligonucleotide comprises at least one sugar and/or backbone modification.7. The method of claim ...

INCORPORATING CMOS INTEGRATED CIRCUITS IN THE DESIGN OF AFFINITY-BASED BIOSENSOR SYSTEMS

A biosensor system incorporating CMOS integrated circuits. In one type of biosensor system, the biosensor system includes a silicon substrate. The biosensor system further includes active devices fabricated on the silicon substrate. Additionally, the biosensor system includes a plurality of metal layers stacked on top of the active devices. Furthermore, the biosensor system includes a passivation layer covering a top metal layer, where the passivation layer includes an opening configured to expose the top metal layer, where the opening is used as a sensing electrode. Additionally, the biosensor system includes a plurality of probes attached to the sensing electrode. 1. A biosensor system , comprising:a silicon substrate;active devices fabricated on said silicon substrate;a plurality of metal layers stacked on top of said active devices;a passivation layer covering a top metal layer of said plurality of metal layers in order to protect said plurality of metal layers, wherein said passivation layer comprises an opening configured to expose said top metal layer, wherein said opening is used as a sensing electrode; anda plurality of probes attached to said sensing electrode.2. The biosensor system as recited in claim 1 , wherein said sensing electrode is placed in a solution containing analytes.3. The biosensor system as recited in further comprising:an interface between said sensing electrode and an electrolyte, wherein an impedance of said interface is changed when an analyte of interest binds to one of said plurality of probes.4. The biosensor system as recited in claim 3 , wherein said change in said impedance of said interface is measured using an electronic sensor.5. The biosensor system as recited in claim 3 , wherein said change in said impedance of said interface is measured using an integrated circuit.6. The biosensor system as recited in claim 5 , wherein said impedance is measured by de-coupling an excitation signal into a first and a second path.7. The ...

LIQUID SCINTILLATOR FOR 3D DOSIMETRY FOR RADIOTHERAPY MODALITIES

A liquid scintillator detector for three-dimensional dosimetric measurement of a radiation beam is provided wherein a volumetric phantom liquid scintillator is exposed to the radiation beam to produce light that is captured by the cameras that provide a three-dimensional image of the beam. 1. A liquid scintillator detector for three-dimensional dosimetric measurement of a radiation beam comprising:a volumetric phantom liquid scintillator; andat least two high-speed CCD cameras, wherein the volumetric phantom liquid scintillator is exposed to the radiation beam to produce light that is captured by the cameras that provide a three-dimensional image of the beam.2. The liquid scintillator detector of claim 1 , wherein the image is further processed to create three-dimensional dosage distributions.3. The liquid scintillator detector of claim 1 , wherein one of the CCD cameras is disposed orthogonally to the other.4. The liquid scintillator of claim 1 , wherein the volumetric phantom comprises at least 125 cmof liquid scintillator.5. A method of acquiring three dimensional dosimetric information from a radiation beam comprising the step of measuring light emitted through a liquid scintillator by a charged-couple device to produce an image wherein the image is used to characterize the radiation beam in realtime. This application claims priority to U.S. Provisional Patent Application Ser. No. 61/223,619 filed Jul. 7, 2009, which is herein incorporated by reference in its entirety.This invention was made with government support under CA120198-01 awarded by the National Institute of Health. The government has certain rights in the invention.Use of scintillating materials in scanning beam proton therapy have been limited to two-dimensional (“2D”) scintillation. Three dimensional (“3D”) scintillation has been only used in brachytherapy applications using radioactive sources to study the dosimetric properties of different scintillating solutions with the aim of developing water ...

METHODS AND COMPOSITIONS INVOLVING NUCLEOTIDE REPEAT DISORDERS

The present invention concerns the methods and compositions involving nucleic acids with long repeat sequences. In some embodiments of the invention, there are methods for generating such a nucleic acid, and in other methods, there are methods for using such a nucleic acid to screen for candidate therapeutic compounds. Furthermore the present invention relates to methods of screening for Notch inhibitors and other substances that may be used to treat muscle loss and wasting. 2. The method of claim 1 , wherein the RNA molecules are isolated and/or recombinant.3. The method of claim 2 , wherein the RNA molecules are recombinant.4. The method of claim 3 , wherein the skeletrophin polypeptide and the RNA molecules are in a cell containing a recombinant expression region encoding the RNA molecules.5. The method of claim 1 , wherein the RNA molecules are dystrophia myotonica protein kinase (DMPK) transcripts.6. The method of claim 1 , wherein determining whether the candidate compound disrupts or inhibits the association between the skeletrophin polypeptide and the RNA molecules involves assaying for sequestration of the skeletrophin polypeptide claim 1 , wherein a decrease in sequestration identifies the candidate compound as a candidate therapeutic agent.7. The method of claim 6 , wherein determining whether the candidate compound disrupts or inhibits the association between the skeletrophin polypeptide and the RNA molecules involves assaying Notch activity claim 6 , wherein a decrease in Notch activity identifies the candidate compound as a candidate therapeutic agent.8. The method of claim 1 , wherein determining whether the candidate compound disrupts or inhibits the association between the skeletrophin polypeptide and the RNA molecules involves assaying for binding between the skeletrophin polypeptide and the RNA molecules claim 1 , wherein a reduction or inhibition of binding identifies the candidate compound as a candidate therapeutic agent.9. The method of claim ...

COMPOSITIONS AND METHODS FOR INHIBITING REDOX-SENSITIVE GTPASES

The invention provides compositions for inhibiting a redox-sensitive GTPase protein, including a Rho or Rab family GTPase, comprising an effective amount of a redox-sensitive purine compound and an effective amount of a redox agent. The invention further provides methods of inhibiting a redox-sensitive GTPase protein, including a Rho or Rab family GTPase, by administering compositions of the invention. Methods of screening for compounds that inhibit a redox-sensitive GTPase protein, including compounds that target and inhibit Rho or Rab family GTPases, are further provided. 1. A composition for inhibiting a redox-sensitive GTPase protein comprising an effective amount of a redox-sensitive purine compound and an effective amount of a redox agent.2. The composition of claim 1 , wherein the GTPase protein comprises a GXXXXGK(S/T)C motif and the GTPase protein is selected from the group consisting of a Rho family GTPase and a Rab family GTPase.3. The composition of claim 1 , wherein the redox-sensitive purine compound is selected from the group consisting of a 6-thiopurine compound and an 8-thiopurine compound.4. The composition of claim 3 , wherein the 6-thiopurine compound is 6-thioguanine and the 8-thiopurine compound is 8-thioguanine.5. The composition of claim 1 , wherein the redox-sensitive purine compound is selected from the group consisting of 8-thioguanine (2-amino-8-mercapto-1H-purin-6(9H)-one) claim 1 , 8-methylthioguanine (2-amino-8-(mercaptomethyl)-1H-purin-6(9H)-one) claim 1 , 7-methylthioguanine (2-amino-7-(mercaptomethyl)-8 claim 1 ,9-dihydro-1H-purin-6(H)-one) claim 1 , 7-thioguanine (2-amino-7-mercapto-8 claim 1 ,9-dihydro-1H-purin-6(H)-one) claim 1 , azathioprine (AZA) claim 1 , 6-mercaptopurine (6-MP); and 6-thioguanine (6-TG).7. The composition of claim 1 , wherein the redox agent is selected from the group consisting of nitric oxide claim 1 , nitrogen dioxide claim 1 , dinitrogen trioxide claim 1 , superoxide anion radical claim 1 , hydrogen ...

PULSE DRUG NEBULIZATION SYSTEM, FORMULATIONS THEREFORE, AND METHODS OF USE

Liquid nebulizer apparatus, systems, and formulation compositions, as well as systems for the nebulized, aerosol delivery of such compositions, for the administration and insufflation of medicinal aerosols into the pulmonary system of a mammal are described. The nebulizing apparatus and system can effectively aerosolize a variety of viscosities of medicinal liquid drug carriers, including those made up of oil, water, or emulsions of oil and water. Drugs dissolved or suspended in the compositions and formulations described and adapted for use herein are not damaged or denatured by the nebulization process when the nebulizer described is used. Further, the nebulization system itself can be adapted for use with both mechanically assisted pulmonary ventilation systems as well as hand-held inhalers and nose/mouth face masks for use in pulmonary drug delivery. 1. A nebulization system comprising:a nozzle;an outer gas-delivery tube; andan inner microchannel delivery tube having a central fluid channel;wherein the outer delivery tube is concentrically configured around the inner delivery tube, such concentric configuration forming an annular intermediate space between the two tubes, andwherein the intermediate air space between the two tubes is the free air opening value, the value of which is the internal diameter of the outer gas-delivery tube minus the total inside diameter of the inner microchannel delivery tube.2. The nebulization system of claim 1 , wherein the nozzle has an air volume to nebulized droplet volume ratio less than about 60 claim 1 ,000:1.3. The nebulization system of claim 1 , wherein the value of the intermediate air space between the two tubes ranges from about 0.00000259 into about 0.001 in.4. The nebulization system of claim 1 , wherein the outer gas delivery tube has an inner diameter ranging from about 0.01 inches to about 0.05 inches.5. The nebulization system of claim 1 , wherein the inner microchannel delivery tube has an outer diameter ranging ...

Methods for Making Controlled Delivery Devices Having Zero Order Kinetics

A method of making an injectable or implantable active agent delivery device capable of delivering a diagnostic, therapeutic, and/or prophylactic agent to a desired targeted site having orifice(s) on the surface is disclosed herein providing unidirectional release of the agent at a controlled desirable rate. The agent may include, but is not limited to, drugs, proteins, peptides, biomarkers, bioanalytes, and/or genetic material. The technology of the invention is based on parallel processing to fabricate micro-holes on tubes employing photo-lithography and reactive ion etching techniques and also incorporates a simple molding method to form the micro-holes on flexible polymer tubes, including bio-degradable tubes. The parallel processing method of the instant invention is fast, economical and well suited for mass production. The developed device, due to its composite structure, has the ability to combine several release mechanisms, leading to zero-order release kinetics for most of the time. 1. A method for making a device for delivery of one or more active agents withzero-order kinetics comprising the steps of:providing a mold comprising a first surface and a second surface, wherein the first surface comprises one or more trenches, cavities or depressions, wherein each of the one or more trenches, cavities or depressions comprise one or more holes or perforations;placing a first substrate in the trenches, cavities or depressions, wherein the substrate may optionally be held in place in the trench by using an adhesive; andtransferring a shape of the holes or the perforations in the one or more trenches, cavities or depressions to the first substrate by one or more microfabrication techniques to make the device for the delivery of the one or more active agents.2. The method of claim 1 , wherein the shape of the one or more holes or perforations is selected from the group consisting of a triangle claim 1 , a polygon claim 1 , an undecagon claim 1 , a trapezium or ...

SHAPE MEMORY DEVICES AND THEIR USE IN CONTROLLING DEVICE-ENVIRONMENT INTERACTIONS

The invention is directed to shape memory polymer compositions, articles of manufacture thereof, and methods of preparation and use thereof. The invention is further directed to methods of controlling the nature of the interaction of a shape memory device with the environment in which it is operating. 1. A shape memory device , comprising a first material , able to memorize an original shape and being present in a deformed shape , and a second material , wherein the second material possesses at least one property that changes significantly upon recovery of the first material toward its memorized original shape upon application of an external stimulus.2. The shape memory device of claim 1 , wherein the external stimulus is mechanical.3. The shape memory device of claim 1 , wherein the external stimulus is a change in temperature claim 1 , pressure claim 1 , pH claim 1 , electric field claim 1 , or magnetic field.4. The shape memory device of claim 1 , wherein the second material partially or completely covers the first material.5. A shape memory device claim 1 , comprising a first material claim 1 , able to memorize an original shape and being present in a deformed shape claim 1 , and a second material claim 1 , wherein the second material possesses an ability to fix the first material in the deformed shape claim 1 , and loses its ability to fix the first material in the deformed shape upon application of an external stimulus.6. The shape memory device of claim 5 , wherein the second material upon application of an organic solvent or other chemical stimulus has a physical state selected from the group consisting of brittleness claim 5 , loss of integrity and loss of cohesion.7. The shape memory device of claim 1 , wherein the second material is susceptible to degradation by a means selected from the group consisting of hydrolytic and enzymatic means.8. The shape memory device of claim 5 , wherein the external stimulus is mechanical.9. The shape memory device of claim ...

NANOPARTICLES FOR USE IN TUMOR DIAGNOSIS AND THERAPY

The present invention relates to diagnostic and therapeutic nanoparticles. More particularly, the present invention relates to creating a copper (Cu)-based nanoparticle and a method for making the same. The Cu-based nanoparticles can further be incorporated with additional therapeutic or diagnostic compounds and used for the diagnosis and treatment of tumors. 1. A nanoparticle comprising copper sulfide , said nanoparticle having a diameter of less than about 3 nm and an absorbance peak between about 700-1100 nm.2. The nanoparticle of claim 1 , said nanoparticle further comprising at least one agent selected from the group consisting of a therapeutic agent claim 1 , a diagnostic agent claim 1 , and a contrast agent.3. The nanoparticle of claim 2 , wherein the at least one agent is embedded in a coating on the surface of the nanoparticle.4. The nanoparticle of claim 2 , wherein the at least one agent is an antibody.5. The nanoparticle of claim 2 , wherein the at least one agent is a pharmaceutical.6. The nanoparticle of claim 1 , wherein said nanoparticle is a reaction product of copper chloride and water.7. A mixture of nanoparticles as in claim 1 , said mixture capable of absorbing electromagnetic radiation claim 1 , whereby absorption of electromagnetic radiation results in at least one of: 1. thermal ablation of at least a portion of a target; 2. release of a diagnostic agent incorporated within said hybrid nanoparticles; and 3. release of a therapeutic agent incorporated within said hybrid nanoparticles.8. The nanoparticle of claim 1 , wherein the nanoparticle has the formula CuS(0≦x≦1 claim 1 , 0≦y≦1).9. The nanoparticle of claim 1 , wherein the nanoparticle has the formula CuX claim 1 , where X=S claim 1 , Se claim 1 , Te or O.10. The nanoparticle of claim 1 , wherein the nanoparticle has the formula CuX:Y claim 1 , where X=S claim 1 , Se claim 1 , Te and O; and Y=Ag claim 1 , Zn claim 1 , Fe claim 1 , Ni claim 1 , Pb claim 1 , Eu claim 1 , Yb claim 1 , Er11. ...

METHODS FOR OPTOACOUSTIC GUIDANCE AND CONFIRMATION OF PLACEMENT OF NOVEL INDWELLING MEDICAL APPARATUS

Indwelling medical apparatus including one optoacoustic discernible member or a plurality of optoacoustic discernible members and methods for optoacoustic guidance and confirmation of placement of optoacoustically discernible indwelling medical apparatus. 1. An indwelling medical apparatus comprising a body and one optoacoustically discernible member or a plurality of optoacoustically discernible members attached to , affixed to or integral with the body , where the members absorb pulsed electromagnetic radiation (light) and generate spatially resolved pressure signals in response to the absorbed pulsed electromagnetic radiation.2. The apparatus of claim 1 , wherein the electromagnetic radiation comprises near-infrared light claim 1 , the optical component claim 1 , and pressure signal comprises an ultrasound signal claim 1 , the acoustic component.3. The apparatus of claim 1 , wherein the optoacoustically discernible members form a pattern.4. The apparatus of claim 3 , wherein the pattern comprises members of different widths spaced apart by different separations or gaps.5. The apparatus of claim 1 , wherein the apparatus comprises an insertable medical apparatus.6. The apparatus of claim 1 , wherein the apparatus comprises an indwelling medical apparatus7. The apparatus of claim 6 , wherein the indwelling medical apparatus comprises an endotracheal apparatus including a tube and a cuff.8. The apparatus of claim 7 , wherein the tube includes the members.9. The apparatus of claim 7 , wherein the cuff includes the members.10. The apparatus of claim 7 , wherein the tube and the cuff include the members.11. The apparatus of claim 1 , wherein the members are detachably attached or affixed to the body.12. The apparatus of claim 1 , wherein the members are non-detachably attached or affixed to the body.13. The apparatus of claim 1 , wherein the members are integral with the body.14. A method claim 1 , for placing and monitoring the placement of indwelling medical ...

TERAHERTZ QUANTUM CASCADE LASERS (QCLS)

Quantum cascade lasers (QCLs), and methods of manufacture of QCLs, comprising an active portion. In some embodiments, the active portion can comprise: a plurality of tensiley strained quantum barrier layers, each comprising GaInAs; and a plurality of compressively strained quantum well layers, each comprising GaInAs. In some embodiments, the active portion can comprise: a plurality of compressively strained quantum barrier layers, each comprising AlInAs; and a plurality of tensiley strained quantum well layers, each comprising GaInAs. The active portion can be grown on InP substrate. 1. A quantum cascade laser , comprising:a substrate; and [{'sub': y', '1-y, 'a plurality of compressively strained quantum barrier layers, each comprising AlInAs; and'}, {'sub': x', '1-x, 'a plurality of tensiley strained quantum well layers, each comprising GaInAs.'}], 'a strain-compensated active portion coupled to the substrate, the active portion comprising2. The quantum cascade laser of claim 1 , where the plurality of quantum barrier layers and the plurality of quantum barrier layers are in a sequentially alternating configuration.32. The quantum cascade laser of any of - claims 1 , where the substrate comprises InP.43. The quantum cascade laser of any of - claims 1 , where in GaInAs claims 1 , x is between about 0.50 and about 1 claims 1 , and in AlInAs claims 1 , y is selected to substantially compensate for strain in the GaInAs quantum well layers.54. The quantum cascade laser of any of - claims 1 , where a conductive layer is coupled to the active region.6. The quantum cascade laser of claim 5 , where the conductive layer comprises a metal.7. The quantum cascade laser of claim 1 , where the conduction band discontinuity between the well layers and the barrier layers is in the range of about 0 meV to 400 meV.8. The quantum cascade laser of claim 1 , where the electron effective mass in the well layers is less than the electron effective mass of GaAs.9. A quantum cascade laser ...

INFECTIVITY-ENHANCED CONDITIONALLY-REPLICATIVE ADENOVIRUS AND USES THEREOF

A modified adenovirus capable of overcoming the problem of low level of coxsackie-adenovirus receptor (CAR) expression on tumor cells and methods of using such adenovirus are provided. The fiber protein of the adenovirus is modified by insertion or replacement so as to target the adenovirus to tumor cells, and the replication of the modified adenovirus is limited to tumor cells due to specific promoter control or mutations in E1a or E1b genes. 1. An infectivity-enhanced conditionally-replicative adenovirus , wherein said adenovirus possesses enhanced infectivity towards a specific cell type due to a modification or replacement of the fiber of a wildtype adenovirus , said modification or replacement results in enhanced infectivity relative to said wildtype adenovirus , and wherein said infectivity-enhanced conditionally-replicative adenovirus has at least one conditionally regulated early gene , said early gene conditionally regulated such that replication of said infectivity-enhanced conditionally-replicative adenovirus is limited to said specific cell type.2. The infectivity-enhanced conditionally-replicative adenovirus of claim 1 , wherein said cell type is a tumor cell.3. The infectivity-enhanced conditionally-replicative adenovirus of claim 1 , wherein said modification or replacement to the fiber results in coxsackie-adenovirus receptor independent gene transfer with respect to the type 5 receptor.4. The infectivity-enhanced conditionally-replicative adenovirus of claim 1 , wherein said modification or replacement to the fiber is selected from the group consisting of introducing a ligand into the HI loop of said fiber claim 1 , replacing said fiber with a substitute protein which presents a targeting ligand claim 1 , and introducing a fiber knob domain from a different subtype of adenovirus.5. The infectivity-enhanced conditionally-replicative adenovirus of claim 4 , wherein said ligand is selected from the group consisting of physiological ligands claim 4 , ...

Automated Needle Insertion Mechanism

A device is provided for automatically inserting a catheter or other medical implement into a patient. An imaging module () identifies a selected point of insertion on the patient. A manipulator module () positions a catheter or medical implement at the desired position with respect to the selected point of insertion on the patient. A catheter insertion module () or implement insertion module () inserts the medical instrument into the patient to complete the desired tasks. 1. A device for automatically inserting a catheter into a blood vessel of a patient , comprising:an imaging module for identifying a selected point of insertion on the patient;a manipulator module for positioning the catheter in response to the imaging module at a desired position with respect to the selected point of insertion on the patient; anda catheter insertion module for inserting a needle into the blood vessel of the patient, inserting a dilator over the needle, retracting the needle, inserting a catheter over the dilator, and retracting the dilator while leaving the catheter in place in the blood vessel of the patient.2. A device as defined in claim 1 , wherein the imaging module includes an ultrasound scanner.3. A device as defined in claim 2 , wherein the imaging module includes a laser scanner.4. A device as defined in claim 1 , further comprising:the imaging module monitors the position of the patient and the position of the needle while supported on the catheter insertion module.5. A device as defined in claim 4 , wherein the imaging module comprises a linear array ultrasound imaging device.6. A device as defined in claim 1 , further comprising:a computer for receiving signals from the imaging module and outputting command signals to one of the manipulator module and the catheter insertion module.7. A device as defined in claim 1 , wherein the manipulator module comprises a dual parallelogram linkage mechanism which provides two orthogonal degrees of freedom.8. A device as defined in ...

ADAPTIVE AUTOMATIC EXPOSURE APPARATUS AND METHOD FOR DIGITAL IMAGES

An apparatus and method for automatically adjusting an exposure for a digital imaging device by (a) receiving a current image frame using an exposure value (EV), (b) computing a current image spatial entropy (ISE) for the current image frame, and (c) whenever the current ISE is greater than a previous ISE, setting the previous ISE equal to the current ISE, increasing the EV, and repeating steps (a) and (b), and (d) whenever the current ISE is less than or equal to the previous ISE, decreasing the EV, receiving the current image frame using the EV, and displaying the current image frame. 1. An automatic exposure apparatus comprising:a shutter;a shutter controller connected to the shutter to open and close the shutter;an image sensor aligned with the shutter to detect an image through the shutter whenever the shutter is open;a memory storing a set of device parameters; anda processor connected to the shutter controller, the image sensor and the memory, wherein the processor: (a) receives a current image frame from the image sensor using an exposure value (EV) for the shutter, (b) computes a current image spatial entropy (ISE) for the current image frame (c) whenever the current ISE is greater than a previous ISE, (i) sets the current ISE equal to the previous ISE, (ii) increases the EV, and (iii) repeats steps (a) and (b), and (c) whenever the current ISE is less than or equal to the previous ISE, (i) decreases the EV, (ii) receives the current image frame using the EV, and (iii) displays the current image frame.3. The automatic exposure apparatus as recited in claim 1 , further comprising an adjustable aperture aligned with the image sensor claim 1 , wherein the adjustable aperture is controlled by the shutter controller.4. The automatic exposure apparatus as recited in claim 1 , wherein the processor also initializes the current ISE and the previous ISE.5. The automatic exposure apparatus as recited in claim 1 , wherein an amount of increase or decrease in EV is ...

COMPOSITIONS FOR TREATMENT OF INFLAMMATORY DISEASES

Inflammatory bowel diseases are represented by two idiopathic disorders, which include ulcerative colitis and Crohn's disease. Ulcerative colitis is restricted to the colon and involves uncertain and inflammation of the lining (mucosa) of the large intestine. Crohn's disease, on the other hand, can involve the mucosa of the small and/or large intestine and may involve deeper layers of the bowel wall. The present invention is a combination of 5-aminosalicylic acid and one or more antioxidants (e.g., N-acetylcysteine) for treating such inflammatory bowel diseases. 1. A pharmaceutical composition comprising: a therapeutically effective amount of 5-aminosalicylic acid or a pharmaceutically-acceptable salt thereof, and a therapeutically effective amount of N-acetylcysteine or a pharmaceutically-acceptable salt thereof, together disposed in a pharmaceutically-acceptable carrier. This application is a divisional of U.S. Ser. No. 11/023,812, filed Dec. 28, 2004, and also claims the benefit under 35 U.S.C. 119(e) of U.S. Provisional Application Ser. No. 60/537,766, filed Jan. 20, 2004, the entire disclosures of which are hereby expressly incorporated by reference herein.Inflammatory bowel diseases (IBDs) including ulcerative colitis and Crohn's disease, are complex diseases that are thought to result from over activation of the immune system directed at luminal antigens of the gastrointestinal tract (12). In the early 1940's it was observed that sulfasalazine, formed by the chemical union of the antibiotic sulfapyridine and 5-aminosalicylic acid (5-ASA; also referred to as mesalamine) by an azo bond, had a beneficial effect in patients with colitis (29). Subsequent clinical studies over the next two decades established that sulfasalazine had efficacy in the treatment of inflammatory bowel disease (30, 31). Additional studies were directed to determine the chemical kinetics of sulfasalazine when administered orally and to determine mechanisms of action (32-34). Approximate 75 ...

DISTINGUISHING BETWEEN SENSOR AND PROCESS FAULTS IN A SENSOR NETWORK WITH MINIMAL FALSE ALARMS USING A BAYESIAN NETWORK BASED METHODOLOGY

A method, system and computer program product for distinguishing between a sensor fault and a process fault in a physical system and use the results obtained to update the model. A Bayesian network is designed to probabilistically relate sensor data in the physical system which includes multiple sensors. The sensor data from the sensors in the physical system is collected. A conditional probability table is derived based on the collected sensor data and the design of the Bayesian network. Upon identifying anomalous behavior in the physical system, it is determined whether a sensor fault or a process fault caused the anomalous behavior using belief values for the sensors and processes in the physical system, where the belief values indicate a level of trust regarding the status of its associated sensors and processes not being faulty. 1. A method for distinguishing between a sensor fault and a process fault in a physical system , the method comprising:designing a Bayesian network to probabilistically relate sensor data in said physical system, wherein said physical system comprises a plurality of sensors;collecting said sensor data from said plurality of sensors in said physical system;deriving a conditional probability table based on said collected sensor data and said design of said Bayesian network;identifying anomalous behavior in said physical system; anddetermining, by a processor, one of said sensor fault and said process fault caused said identified anomalous behavior using belief values for said plurality of sensors and a plurality of processes in said physical system, wherein said belief values indicate a level of trust regarding the status of its associated sensors and processes not being faulty.2. The method as recited in further comprising:inferring a value to be generated by one of said plurality of sensors of said physical system using one or more values sampled from one or more other sensors of said plurality of sensors and using one or more processes ...

Orthologous Phenotypes and Non-Obvious Human Disease Models

A method for the quantification of equivalence between mutational phenotypes to develop non-obvious human disease models is described herein. The present inventors discover candidate genes for diseases of interest by: first, identifying orthologous phenotypes (called phenologs) involving the phenotype of interest (the first phenotype), in which a set of genes is associated with the first phenotype in the first organism, a set of genes is associated with a second phenotype in a second organism, the first and second phenotypes not having one or more common characteristics, and the second phenotype is selected such that at least one gene belongs to both the first and second phenotype gene sets; second, selecting from the second organism one or more second phenotype genes, other than the genes known to overlap the first and second phenotypes, as candidates for also belonging to the first phenotype in the first organism. 1. A method of identifying one or more candidate genes for a trait , a phenotype , or a disease of interest comprising the steps of:identifying one or more orthologous genes involving the trait, the phenotype, or the disease of interest by:comparing a first set of genes associated with a first phenotype in a first organism with a second set of genes associated with a second phenotype in a second organism, wherein the first and second phenotypes do not have one or more common characteristics, and the second phenotype in the second organism is selected such that at least one gene belongs to both the first and the second set of genes in the first and the second organisms respectively; andselecting from the second organism one or more candidate genes from the second set of genes associated with the second phenotype other than the genes known to overlap between the first and the second phenotypes as the candidate genes for belonging to the first phenotype in the first organism.2. The method of claim 1 , further comprising the step of modifying the expression ...

FLUORINATED SILAZANE RELEASE AGENTS IN NANOIMPRINT LITHOGRAPHY

An imprint lithography release agent having general formula (1): 2. The imprint lithography resist of claim 1 , further comprising a photoinitiator claim 1 , a photoacid generator claim 1 , or a photobase generator.3. The imprint lithography resist of further comprising a solvent claim 1 , wherein the fluorinated silazane comprises about 0.1 wt % to about 30 wt % of the imprint lithography resist excluding the solvent.4. The imprint lithography resist of wherein R═H claim 1 , n=2 claim 1 , and m=5.6. The imprint lithography mold assembly of claim 5 , wherein R═H claim 5 , n=2 claim 5 , and m=5.7. The imprint lithography mold assembly of further comprising a photoinitiator claim 5 , a photoacid generator claim 5 , or a photobase generator.8. The imprint lithography mold assembly of wherein the imprint lithography resist further comprises a solvent claim 5 , and the fluorinated silazane comprises about 0.1 wt % to about 30 wt % of the imprint lithography resist excluding the solvent.9. The imprint lithography mold of wherein the imprint lithography resist is disposed on the imprint lithography substrate in the form of discrete claim 5 , spaced-apart drops.10. The imprint lithography mold assembly of wherein the imprint lithography template comprises a previously applied release layer.11. The imprint lithography mold assembly of claim 10 , wherein the previously applied release layer comprises a second fluorinated silazane having general formula (1).13. The imprint lithography method of claim 12 , wherein the imprint lithography resist further comprises a photoinitiator claim 12 , a photoacid generator claim 12 , or a photobase generator.14. The imprint lithography method of wherein the imprint lithography resist further comprises a solvent claim 12 , and the fluorinated silazane comprises between about 0.1 wt % and about 30 wt % of the imprint lithography resist excluding the solvent.15. The imprint lithography method of further comprising applying a release layer to ...

DIAGNOSIS AND TREATMENT OF EHRLICHIOSIS

The present invention provides an isolated peptide and therapeutic and diagnostic uses therefor. 1Ehrlichia. An isolated peptide having a sequence at least 80% identical to the amino acid sequence of SEQ ID NOS: 2 , 3 , or 4.2. The peptide of claim 1 , wherein said peptide is at least 90% identical to the amino acid sequence of SEQ ID NOS: 2 claim 1 , 3 claim 1 , or 4.3. The peptide of claim 1 , wherein said peptide is at least 95% identical to the amino acid sequence of SEQ ID NOS: 2 claim 1 , 3 claim 1 , or 4.4. The peptide of claim 1 , further comprising a label.5. The peptide of claim 4 , wherein said peptide is conjugated to said carrier.6. The peptide of claim 5 , wherein said peptide and carrier are conjugated by glutaraldehyde claim 5 , m-maleimidobenzoyl-N-hydroxy-succinimide ester claim 5 , carbo-diimide or bis-biazotized benzidine.7. The peptide of claim 5 , wherein said carrier is keyhole limpet hemocyanin claim 5 , human serum albumin claim 5 , a lymphokine claim 5 , or an adjuvant.8. The peptide of claim 7 , wherein the adjuvant is IL2 claim 7 , IL4 claim 7 , IL8 claim 7 , BCG claim 7 , Detox claim 7 , RIBI claim 7 , ISCOMS claim 7 , or aluminum hydroxide.9. A pharmaceutical composition comprising the peptide of .10. An isolated antibody that specifically binds the peptide of .11Ehrlichia. A method of detecting claim 1 , comprising the steps of:contacting a sample with (i) an antibody that specifically binds a peptide having at least 80% amino acid identity to SEQ ID NOs: 2, 3, or 4, or (ii) a peptide comprising an amino acid sequence that is at least 80% identical to SEQ ID NOs: 2, 3, or 4; and{'i': 'Ehrlichia.', 'detecting an antibody/peptide complex, wherein detection of a complex indicates the presence of'}12. The method of claim 11 , wherein said subject is a canine.13. The method of claim 11 , wherein said sample is serum.14Ehrlichia. A diagnostic kit for detecting claim 11 , said kit comprising:(a) an antibody that binds an amino acid sequence ...

COMPOSITIONS AND METHODS FOR SCREENING PEPTOID LIBRARIES

Certain embodiments are directed to methods for screening synthetic libraries and characterizing the resultant hits that combines many of the attractive features of bead library screening and microarray-based analysis in a seamless fashion. 1. A method for selecting a peptoid comprising:contacting a peptoid library with a target, the peptoid library comprising a plurality of beads with each bead being coupled to a specific peptoid via a cleavable linker;selecting a target-bound peptoid by coupling the target with a magnetic particle forming a magnetic particle complex; andisolating the magnetic particle complex containing the target-bound peptoid.2. The method of claim 1 , further comprising separating individual magnetic particle complexes into separate wells or containers.3. The method of claim 2 , further comprising cleaving the link between the bead and the selected peptoid and attaching the selected peptoid to a substrate forming a selected peptoid array.4. The method of claim 3 , wherein cleaving the link between the bead and the selected peptoid is by exposure to cyanogen bromide or trifluoro-acetic acid (TFA).5. The method of claim 3 , wherein the selected peptoid array is formed by microarray spotting.6. The method of claim 3 , wherein the cleaved peptoid comprises a furan group for coupling to the substrate.7. The method of claim 3 , wherein the substrate is glass.8. The method of claim 7 , wherein the glass is maleimide-modified glass.9. The method of claim 1 , wherein the target is a polypeptide.10. The method of claim 9 , wherein the polypeptide is on the surface of a cell or particle.11. The method of claim 10 , wherein the cell is a eukaryotic cell claim 10 , a prokaryotic cell claim 10 , or a phage particle.12. The method of claim 3 , further comprising contacting the array with varying concentrations of the target and assessing binding of the target to the selected peptoid array at the various concentrations. This application claims benefit of ...

Computerized Amino Acid Composition Enumeration

A computerized method and apparatus for enumerating one or more amino acid compositions is disclosed that provides one or more processors, a data storage communicably coupled to the one or more processors and a user interface communicably coupled to the one or more processors. The three or more user-specified characteristics are received from the data storage or the user interface. The one or more amino acid compositions are enumerated for all the peptides having a length less than or equal to the maximum length and a mass less than or equal to the mass limit using the one or more processors. The enumerated amino acid compositions are filtered based on the one or more other user-specified characteristics using the one or more processors. The filtered amino acid compositions and the mass of the filtered amino acid compositions are stored in the data storage. 1. A computerized method of enumerating one or more amino acid compositions of all theoretically possible peptides having three or more user-specified characteristics , the method comprising the steps of:providing one or more processors, a data storage communicably coupled to the one or more processors and a user interface communicably coupled to the one or more processors;receiving the three or more user-specified characteristics from the data storage or the user interface, wherein the three or more user-specified characteristics comprise a mass limit for the amino acid compositions, a maximum length for the amino acid compositions, and one or more other user-specified characteristics;enumerating the one or more amino acid compositions for all the peptides having a length less than or equal to the maximum length and a mass less than or equal to the mass limit using the one or more processors;filtering the enumerated amino acid compositions based on the one or more other user-specified characteristics using the one or more processors; andstoring the filtered amino acid compositions and the mass of the filtered ...

Methods for Treating COPD

Embodiments of the invention include methods and compositions involving aldose reductase inhibitors for treating COPD. 1. A method of treating COPD in a subject comprising administering to a subject diagnosed with , exhibiting symptoms of , or at risk of developing COPD comprising administering a therapeutically effective amount of an aldose reductase inhibitor to said subject.2. The method of claim 1 , wherein the subject currently smokes or previously smoked tobacco.3. The method of claim 1 , wherein the aldose reductase inhibitor is administered as a prodrug.4. The method of claim 1 , wherein the aldose reductase inhibitor is administered by inhalation or instillation.5. The method of claim 1 , wherein the aldose reductase inhibitor is administered orally.6. The method of claim 1 , wherein the aldose reductase inhibitor is a specific inhibitor.7. The method of claim 6 , wherein the aldose reductase inhibitor is a carboxylic acid claim 6 , a hydantoin claim 6 , a pyridazinone claim 6 , or a pharmaceutically acceptable derivative thereof.8. The method of claim 7 , wherein the aldose reductase inhibitor is fidarestat claim 7 , sorbinil claim 7 , epalrestat claim 7 , ponalrestat claim 7 , methosorbinil claim 7 , risarestat claim 7 , imirestat claim 7 , ALO-1567 claim 7 , quercetin claim 7 , zopolrestat claim 7 , AD-5467 claim 7 , NZ-314 claim 7 , M-16209 claim 7 , minalrestat claim 7 , AS-3201 claim 7 , WP-921 claim 7 , luteolin claim 7 , tolrestat claim 7 , EBPC claim 7 , or a pharmaceutically acceptable derivative thereof.9. The method of claim 8 , wherein the aldose reductase inhibitor is fidarestat.10.11. The method of claim 10 , wherein the aldose reductase inhibitor is administered at a dose of 1 to 800 mg/day.12. A method of treating a health risk associated with smoking comprising administering a therapeutically effective amount of an aldose reductase inhibitor to a subject that currently smokes or previously smoked. This application claims priority to U.S. ...

TUNABLE OPTICAL FILTER UTILIZING A LONG-RANGE SURFACE PLASMON POLARITON WAVEGUIDE TO ACHIEVE A WIDE TUNING RANGE

An optical filter and a method for fabricating an optical filter with a wide tuning range and a structure subject to miniaturization. The optical filter includes a bottom and a top dielectric layer with a stripe or film of metal between the dielectric layers which have dissimilar refractive index dispersion. The stripe of metal functions as a waveguide supporting a long-range surface plasmon polariton mode which will be achieved at wavelengths for which the refractive indices of the dielectric layers are the same thereby providing a bandpass filter. Furthermore, one of the dielectric layers is made of a material that allows its refractive index to be tuned, such as by changing its applied voltage or temperature. By tuning the refractive index of the dielectric layer, the wavelength at which the refractive indices of the dielectric layers match changes thereby effectively tuning the optical filter. 1. An optical filter , comprising:a first dielectric layer;a stripe of metal on said first dielectric layer; anda second dielectric layer on said stripe of metal;wherein said first and said second dielectric layers have dissimilar optical dispersions for transverse magnetic polarized light, wherein one of said first and said second dielectric layers is configured to vary its refractive index based on one of the following: voltage and temperature, wherein said stripe of metal functions as a waveguide supporting a long-range surface plasmon polariton mode, wherein a transmission of surface plasmon polariton waves is highest when said first and said second dielectric layers have a same index of refraction.2. The optical filter as recited in claim 1 , wherein said stripe of metal has a thickness between 10 and 30 nanometers.3. The optical filter as recited in claim 1 , wherein losses in said waveguide are greater when said first and said second dielectric layers do not have the same index of refraction than when said first and said second dielectric layers have the same index ...

Compositions And Methods For Separating Tissue

In one aspect, methods for separating biological tissue are described herein. In some embodiments, a method for separating tissue comprises providing a first composition comprising a polymerizable material, providing a second composition comprising a polymerization initiator, disposing the first composition at a first site beneath a first tissue layer, disposing the second composition at the first site, polymerizing the polymerizable material at the first site, and separating the first tissue layer from a second tissue layer. 1. A method for separating tissue comprising:providing a first composition comprising a polymerizable material;providing a second composition comprising a polymerization initiator;disposing the first composition at a first site beneath a first tissue layer;disposing the second composition at the first site;polymerizing the polymerizable material at the first site; andseparating the first tissue layer from a second tissue layer.2. The method of claim 1 , wherein the separation of the first and second tissue layers is at least partially caused by the polymerization of the polymerizable material at the first site.5. The method of claim 1 , wherein the first composition further comprises a cross linker.6. The method of claim 5 , wherein the cross linker comprises an acrylate or polyacrylate.7. The method of claim 1 , wherein the first composition further comprises a drug.8. The method of claim 1 , wherein the polymerization initiator comprises a free radical initiator or redox initiator.9. The method of claim 1 , wherein the second composition further comprises a gas foaming agent.10. The method of claim 9 , wherein the gas foaming agent comprises bicarbonate.11. The method of claim 1 , wherein polymerizing the polymerizable material comprises forming a gel.12. The method of claim 1 , wherein separating the first tissue layer from the second tissue layer comprises providing a gas between the first and second tissue layers.13. The method of claim 1 ...

PERTUSSIS ANTIBODIES AND USES THEREOF

Compositions and methods are provided that are useful to treat respiratory diseases such as whooping cough. Further, compositions and methods of immunizing are provided. 1. A humanized antibody capable of binding a pertussis toxin protein , the humanized antibody comprising a humanized heavy chain and a humanized light chain.2. The humanized antibody of claim 1 , wherein the humanized heavy chain comprises a serine at a position corresponding to Kabat position 97.3. The humanized antibody of claim 2 , wherein the humanized light chain comprises a tryptophan at a position corresponding to Kabat position 91.4. The humanized antibody of claim 3 , wherein the humanized light chain further comprises a histidine at a position corresponding to Kabat position 94.5. The humanized antibody of claim 4 , wherein the humanized heavy chain further comprises an asparagine at a position corresponding to Kabat position 58.6. The humanized antibody of claim 5 , wherein the humanized heavy chain further comprises a tryptophan at a position corresponding to Kabat position 33.7. The humanized antibody of claim 6 , wherein the humanized light chain further comprises a phenylalanine at a position corresponding to Kabat position 31.8. The humanized antibody of claim 7 , wherein the humanized light chain further comprises a cysteine at a position corresponding to Kabat position 23.9. The humanized antibody of claim 8 , wherein the humanized light chain further comprises a phenylalanine at a position corresponding to Kabat position 65.10. The humanized antibody of claim 9 , wherein the humanized light chain further comprises a tyrosine at a position corresponding to Kabat position 71.11. The humanized antibody of claim 10 , wherein the humanized heavy chain further comprises a glycine at a position corresponding to Kabat position 49.12. The humanized antibody of claim 11 , wherein the humanized heavy chain further comprises a serine at a position corresponding to Kabat position 65.13. The ...

RAPID DETECTION AND QUANTIFICATION OF MODIFICATION OF MEDICINAL COMPOUNDS AND DRUG RESISTANCE ACTIVITY

The present disclosure in general relates to methods, systems, and apparatus for identifying modification of a medicinal compound exposed to a sample for use in determining which treatment to provide to a subject in need thereof. 1. A method of identifying a drug resistance profile of a sample comprising:exposing a sample to at least one drug;conducting mass spectrometry on at least one drug after exposure to the sample and analyzing mass to charge ratio of ions from the at least one drug; anddetecting the presence of one or more ions indicative of the drug and/or a metabolite of the drug.2. The method of claim 1 , wherein the mass spectrometry is electrospray mass spectrometry.3. The method of claim 1 , wherein the mass spectrometry is selected reaction monitoring.4. The method of claim 1 , wherein the sample comprises at least one antibiotic resistant bacterium.5. The method of claim 1 , wherein the sample comprises tumor cells.6. The method of claim 1 , wherein the sample is exposed to more than one drug.7. The method of claim 1 , wherein ions from more than one drug are detected.8. The method of claim 1 , wherein the drug is an antibiotic.9. The method of claim 8 , wherein the antibiotic is a member of the penicillin or cephalosporin family of antibiotics.10. The method of claim 9 , wherein a penicillin is selected from ampicillin claim 9 , amoxicillin claim 9 , azlocillin claim 9 , bacampicillin claim 9 , cefixime claim 9 , carbenicillin claim 9 , methicillin claim 9 , cloxacillin claim 9 , 6-APA claim 9 , piperacillin claim 9 , pivmecillinam claim 9 , penicillin V claim 9 , monolactam claim 9 , aztreonam claim 9 , mecillinam claim 9 , imipenem claim 9 , or meropenem.11. The method of claim 9 , wherein a cephalosporin is selected from cefoperazone claim 9 , latamoxef claim 9 , cephapirin claim 9 , cefazolin claim 9 , cefaclor claim 9 , ceftibuten claim 9 , ceftizoxime claim 9 , cefotetan claim 9 , cefuroxime claim 9 , cefprozil claim 9 , ceftazidime claim 9 , ...

MODULATION OF CELLULAR PROTEIN FUNCTION BY ARTIFICIAL SUMO LIGASES

A development of an Artificial SUMO Ligase (ASUL) to increase the ability of Ubc9 to interact with the SUMO target protein, therefore increasing the rate of SUMOylation of the target and a net increase in the total amount of SUMOylated target protein in the cell is described herein. The method of the present invention involves the creation of a protein fusion between a protein domain known to interact with the target protein to be SUMOylated (ID) and the SUMO conjugating enzyme Ubc9. Compositions and methods involving an ASUL comprising a fusion of the N-terminal domain of influenza A virus non-structural protein (NS1) and Ubc9 is also described. 1. A fusion protein for increasing a rate , a specificity , or both of Small Ubiquitin-like Modifier attachment (SUMOylation) to a target protein comprising:an interaction domain (ID) comprising a protein, a protein fragment, a peptide or combinations and modifications thereof, wherein the ID capable of interacting or binding to the target protein, a region or a site of the target protein undergoing the SUMOylation;one or more conjugating enzymes or enzyme complexes, wherein the conjugating enzymes catalyze, modulate, or promote the SUMOylation in the target protein;a Small Ubiquitin-like Modifier (SUMO) attached to the enzyme or the enzyme complex; anda spacer, a linker, or a hinge region connecting the ID with the one or more enzymes or enzyme complexes.2. The fusion protein of claim 1 , wherein the target protein is a bacterial protein claim 1 , a viral protein claim 1 , a plant protein claim 1 , an animal protein claim 1 , a human protein claim 1 , or combinations thereof.3. The fusion protein of claim 1 , wherein the conjugating enzyme comprises an ubiquitin-conjugating enzyme.4. The fusion protein of claim 3 , wherein the ubiquitin-conjugating enzyme is Ubc9.5. The fusion protein of claim 1 , wherein the fusion protein is activated by one or more SUMO activating enzymes.6. The fusion protein of claim 5 , wherein the ...

PAVEMENT CRACK CLEANER

Devices for cleaning and preparing pavement cracks for sealing are disclosed. An example device comprises a wire brush assembly for removal of mid and large-sized debris, an air blaster for removal of fine-grained particulate, a heat lance, and a vacuum for controlled removal of debris and particulates. The example device would also have means for attachment to an air compressor. 1. A device for cleaning pavement cracks comprising a wire brush assembly and an air blaster.2. The device of claim 1 , further comprising a heat lance.3. The device of claim 2 , wherein said heat lance is electrically powered.4. The device of claim 1 , further comprising a single router bit capable of being interchanged with the wire brush assembly.5. The device of claim 1 , further comprising a vacuum component.6. The device of claim 1 , further comprising a pneumatic motor.7. The device of claim 1 , further comprising a means of attachment to an external pneumatic power source.8. A device for cleaning pavement cracks comprising a single router bit and an air blaster.9. The device of claim 8 , further comprising a heat lance.10. The device of claim 9 , wherein said heat lance is electrically powered.11. The device of further comprising a wire brush assembly capable of being interchanged with the single router bit.12. The device of claim 8 , further comprising a vacuum component.13. The device of claim 8 , further comprising a pneumatic motor.14. The device of claim 8 , further comprising a means of attachment to an external pneumatic power source. This application claims priority to U.S. Provisional Application No. 61/470,547 entitled “Pavement crack cleaner for sealing,” filed Apr. 1, 2011, which is incorporated herein by reference in its entirety for all purposes.This invention was made with government support under National Academy of Sciences grant number NCHRP-159. The government has certain rights in the invention.The present disclosure relates generally to cleaning and preparing ...

COMPOSITIONS AND METHODS FOR PREVENTING OR TREATING BURKHOLDERIA INFECTION

The present invention provides a protein or a fragment or a variant of said protein, wherein the protein, fragment, or variant is capable of producing a protective immune response in an animal, wherein the immune response is protective against infection by species. Also provided is a method of preventing or treating infection in an animal caused by species which comprises administering an effective amount of the pharmaceutical composition of the present invention to the animal infected with species. 1. An immunogenic composition comprising at least one isolated peptide selected from those having an amino acid sequence that is 95% identical to SEQ ID NO:1 , SEQ ID NO:2 , and SEQ ID NO:3.2. The composition of claim 1 , further comprising a first isolated peptide having an amino acid sequence that is 95% identical to SEQ ID NO:1 and a second isolated peptide having an amino acid sequence that is 95% identical to SEQ ID NO:2 or 95% identical to SEQ ID NO:3.3. The composition of claim 1 , comprising isolated peptides having an amino acid sequence that is 95% identical to each of SEQ ID NO:1 claim 1 , SEQ ID NO:2 claim 1 , and SEQ ID NO:3.4Burkholderia. A method of inducing an immune response in an animal to species comprises administering a composition of to the animal.5. The method of claim 4 , wherein the animal is equine.6. The method of claim 4 , wherein the animal is human.7BurkholderiaB. mallei, B. pseudomallei,B. cepacia.. The method of claim 4 , wherein the is or8BurkholderiaBurkholderia.. A method of treating a infection by administering an effective amount of the composition of to an animal infected with9BurkholderiaB. mallei, B. pseudomallei,B. cepacia.. The method of claim 8 , wherein the is or10B. pseudomallei, B. mallei,B. cepaciaB. pseudomallei, B. mallei,B. cepaciaBurkholderia. A method for detecting the presence of or comprising contacting a sample from a subject suspected of having a or infection with a peptide having the amino acid sequence of SEQ ID ...

SILK FIBROIN-DECORIN SCAFFOLDS

Disclosed are silk fibroin scaffolds that are fabricated with decorin proteoglycan, and methods of using these scaffolds in the repair of tissue defects in subjects. The scaffolds have biomechanical properties which makes them suitable for patient-specific design for defects where strong tensile strength is required, such as musculofascia reconstruction. 1. A biocompatible scaffold , comprising a silk fibroin polypeptide and a decorin proteoglycan in contact with the silk fibroin polypeptide.2. The scaffold of claim 1 , wherein the ratio of decorin proteoglycan:silk fibroin polypeptide in the scaffold ranges from about 1:100 (w/w) to about 1:1×108 (w/w).3. The scaffold of claim 2 , wherein the ratio of decorin proteoglycan:silk fibroin polypeptide in the scaffold ranges from about 1:100 (w/w) to about 1:1×106 (w/w).4. The scaffold of claim 3 , wherein the ratio of decorin proteoglycan:silk fibroin polypeptide in the scaffold ranges from about 1:100 (w/w) to about 1:1×104 (w/w).5. The scaffold of claim 4 , wherein the ratio of decorin proteoglycan:silk fibroin polypeptide in the scaffold ranges from about 1:100 (w/w) to about 1:1000 (w/w).6. The scaffold of claim 1 , further comprising a therapeutic agent.7. The scaffold of claim 6 , wherein the therapeutic agent is selected from the group consisting of an antimicrobial agent claim 6 , an anti-inflammatory agent claim 6 , an immunosuppressant claim 6 , or a growth factor.8. The scaffold of claim 1 , wherein the silk fibroin polypeptide comprises 20 amino acids of SEQ ID NO:1.9. The scaffold of claim 8 , wherein the silk fibroin polypeptide comprises 50 amino acids of SEQ ID NO:1.10. The scaffold of claim 9 , wherein the silk fibroin polypeptide comprises 100 amino acids of SEQ ID NO:1.11. The scaffold of claim 10 , wherein the silk fibroin polypeptide comprises SEQ ID NO:1.12. The scaffold of claim 1 , wherein the scaffold has a thickness of between about 0.1 mm and about 5 mm.13. A method of making a biocompatible ...

EMULSION TEMPLATE METHOD TO FORM SMALL PARTICLES OF HYDROPHOBIC AGENTS WITH SURFACE ENRICHED HYDROPHILICITY BY ULTRA RAPID FREEZING

The present invention relates to methods and compositions to prepare small size particles of poorly water soluble agents or drugs with surface enriched hydrophilicity. 1. A method of making particles with surface enriched hydrophilicity by template emulsion comprising:dissolving or dispersing one or more hydrophobic agents in an effective amount of an organic solvent and an emulsifying agent, wherein the one or more agents and the solvent form an organic phase mixture;homogenizing the organic phase mixture with an aqueous phase mixture, to form a template emulsion; andcryogenically processing droplets of the template emulsion by ultra rapid freezing under conditions that do not trigger a Liedenfrost effect during the freezing process to produce frozen emulsion particles.2. The method of claim 1 , wherein the template emulsion droplets are frozen in less than about 10 seconds claim 1 , about 5 seconds claim 1 , about 1 second or about 0.5 seconds claim 1 , when contacting the cryogenic surface.3. (canceled)4. (canceled)5. The method of claim 1 , further comprising the step of drying the frozen emulsion particles claim 1 , wherein the resulting dry powder is surface enriched for the hydrophilic excipient over the agent.6. (canceled)7. The method of claim 1 , wherein the organic solvent in the organic phase mixture comprises one or more organic compounds and one or more emulsifying agents.8. The method of claim 7 , wherein the one or more organic compounds are defined further as organic solvents that are not miscible with a continuous external phase of emulsion.9. The method of claim 8 , wherein the one or more organic compounds comprise chloroform in the organic phase mixture at about 20% v/v.10. The method of claim 7 , wherein the one or more emulsifying agents in the organic phase mixture comprises lecithin.11. The method of claim 1 , wherein the aqueous phase mixture comprises one or more polar solvents and one or more excipients.12. The method of claim 11 , ...

Bipolar Flyback Power Supply

A device, system and method for treating biological cells includes a voltage source, a half-controlled bridge connected to the voltage source, and a load connected across the half-controlled bridge. The half-controlled bridge includes a first switch, a second switch, a first diode and a second diode. The load includes an inductor connected in parallel with a cell or chamber. A controller is connected to the first and second switches and operates the first switch and the second switch to selectively generate one or more bipolar pulses, wherein each bipolar pulse comprises a positive polarity voltage pulse and a negative polarity voltage pulse with a negligible delay between the positive polarity voltage pulse and the negative polarity voltage pulse. 1. A bipolar pulse generator comprising:a voltage source;a half-controlled bridge connected to the voltage source, wherein the half-controlled bridge comprises a first switch, a second switch, a first diode and a second diode;a load connected across the half-controlled bridge, wherein the load comprises an inductor connected in parallel with a cell or chamber; anda controller connected to the first switch and second switch, wherein the controller operates the first and second switches to selectively generate one or more bipolar pulses, wherein each bipolar pulse comprises a positive polarity voltage pulse and a negative polarity voltage pulse with a negligible delay between the positive polarity voltage pulse and the negative polarity voltage pulse.2. The bipolar pulse generator of claim 1 , further comprising an energy recovery circuit connected in series with the cell or chamber such that the cell or chamber and the energy recovery circuit are connected in parallel with the inductor.3. The bipolar pulse generator of claim 2 , wherein the energy recovery circuit comprises a third diode connected in parallel with a third switch claim 2 , and the controller operates the third switch to recover an energy stored in the ...

Table-Board-Partition

A transforming project table, white erase board, and office partition all-in-one powered by a drive system is disclosed herein. 1. An adjustable work surface capable of movement along a vertical axis , capable of a 360-degree rotation around a pivot or both comprising:a generally planar tabletop defining a plane, wherein the table top comprises a work (top) surface, a bottom surface, a front edge, a back edge, a left edge, and a right edge;a generally vertical support member disposed for a movement in a generally vertical direction, wherein a top portion of the vertical support member is attached to the right edge and the left edge of the tabletop by one or more pivot joints, wherein the vertical support member further comprises one or more supporting bars extending along a length of the support member and attached to a bottom portion of the support member, wherein the bars are substantially parallel to each other and are capable of movement along the vertical direction concomitantly with a vertical movement of the support member;a drive system or mechanism for moving the vertical support member in the vertical direction;a generally vertical frame structure for receiving the vertical support member, wherein the frame structure further comprises;a first stationary support bar attached to a top portion of the frame structure and extending along the length of the frame structure, wherein the bar comprises a ridge or a groove for receiving the front edge or the back edge of the planar tabletop, wherein the bar is substantially parallel to the one or more bars of the support member, wherein the bar is parallel to the tabletop when the tabletop is horizontal at a 0° angle and is perpendicular to the tabletop when the tabletop is vertical at a 90° angle; anda second stationary support bar attached to a bottom portion of the frame structure, wherein the bar is substantially parallel to the first stationary support bar and to the one or more bars of the support member; ...

DIFFERENTIAL MICROPHONE WITH SEALED BACKSIDE CAVITIES AND DIAPHRAGMS COUPLED TO A ROCKING STRUCTURE THEREBY PROVIDING RESISTANCE TO DEFLECTION UNDER ATMOSPHERIC PRESSURE AND PROVIDING A DIRECTIONAL RESPONSE TO SOUND PRESSURE

A vacuum sealed directional microphone and methods for fabricating said vacuum sealed directional microphone. A vacuum sealed directional microphone includes a rocking structure coupled to two vacuum sealed diaphragms which are responsible for collecting incoming sound and deforming under sound pressure. The rocking structure's resistance to bending aids in reducing the deflection of each diaphragm under large atmospheric pressure. Furthermore, the rocking structure exhibits little resistance about its pivot thereby enabling it to freely rotate in response to small pressure gradients characteristic of sound. The backside cavities of such a device can be fabricated without the use of the deep reactive ion etch step thereby allowing such a microphone to be fabricated with a CMOS compatible process. 1. A microphone comprising:a first and a second diaphragm, wherein said first and second diaphragms form a top layer of a first and a second backside sealed cavity; anda rocking structure coupled to said first and second diaphragms, wherein said rocking structure rotates on a pivot, wherein said rocking structure is placed external to said first and second backside sealed cavities.2. The microphone as recited in claim 1 , wherein said first and second backside sealed cavities comprise a first and a second electrode claim 1 , respectively.3. The microphone as recited in claim 2 , wherein said first and second diaphragms are electrically conductive claim 2 , wherein parallel plate capacitors are formed between said first and second diaphragms and said first and second electrodes claim 2 , respectively.4. The microphone as recited in claim 2 , wherein an electrostatic charge is placed on said first and second diaphragms and an electrostatic charge of a same type is placed on said first and second electrodes.5. The microphone as recited in claim 1 , wherein said first and second backside sealed cavities comprise a plurality of electrodes thereby forming a plurality of ...

PROBIOTIC BACTERIAL STRAINS AND METHOD OF USE TO DECREASE MORTALITY IN FISH DUE TO BACTERIAL DISEASE

Two novel strains of bacteria, C6-6 and C6-8, deposited in accordance with the Budapest Treaty, protect fish, such as by reducing mortality, against disease caused by bacteria, such as coldwater disease caused by 1. An isolated bacterial strain selected from the group consisting of C6-6 , which has been designated Accession No. B-50481 , and C6-8 , which has been designated Accession No. B-50482.2. The isolated bacterial strain of which is C6-6.3. The isolated bacterial strain of which is C6-8.4. A method for reducing mortality in fish due to disease caused by a bacterium comprising administering to said fish either or both of strain C6-6 claim 1 , which has been designated Accession No. B-50481 claim 1 , and C6-8 claim 1 , which has been designated Accession No. B-50482 claim 1 , in an amount effective to reduce mortality due to disease caused by the bacterium.5. The method of wherein the administration is by feed supplementation.6Flavobacterium psychrophilum.. The method of wherein the bacterium is7. The method of wherein the strain is C6-6.8. The method of wherein the strain is C6-8.9. A feed for fish comprising either or both of bacterial strain C6-6 claim 4 , which has been designated Accession No. B-50481 claim 4 , and C6-8 claim 4 , which has been designated Accession No. B-50482.10. The fish feed of which comprises bacterial strain C6-6.11. The fish feed of which comprises bacterial strain C6-8.12. The fish feed of which comprises bacterial strain C6-6 and bacterial strain C6-8. This application claims priority from pending U.S. Provisional Patent Application Ser. No. 61/516,626, filed on Apr. 5, 2011, which application is incorporated herein in its entirety.It is hereby acknowledged that the U.S. Government has certain rights in the invention described herein, which was supported in part by United States Department of Agriculture contract numbers: 103306G0017310; 113389G0025555; 111033G002502.This invention pertains to the field of protection of fish from ...

INOSITOL HEXAKISPHOSPHATE ANALOGS AND USES THEREOF

Provided herein are analog and derivative compounds of inositol hexakisphosphate effective to treat a infection and to neutralize the bacterial toxins produced by the same. In addition, methods of treating the infection and for neutralizing its toxins with the compounds are provided.

Single Stranded DNA Aptamers Binding NF-kB/RelA

DNA aptamers are high affinity ligands selected by genetic enrichment techniques to bind to specific protein targets. Because these represent chemically stable and reproducible molecules, they have application as affinity reagents and/or therapeutic drugs to affect the target protein's actions. NF-kB is an important mediator of the innate immune response and mediator of tissue inflammation. Although RNA and double stranded DNA aptamers have been identified to bind to the NF-kB family of proteins, the present invention represents the first identification of single stranded DNA aptamers that recognize NFkB RelA. The aptamers disclosed herein bind to several distinct regions of RelA and may be useful to antagonize the DNA binding of RelA as an inhibitor of cellular inflammation, visualize the location or amount of RelA in tissues from pathological conditions, or to quantitatively measure the activated state of RelA by affinity binding. 1. One or more single stranded oligonucleotide sequences for binding to an activated Nuclear Factor-κB (NF-κB)/RelA complex , wherein the oligonucleotide sequence is selected from the group consisting of SEQ ID NO: 9 , SEQ ID NO: 10 , SEQ ID NO: 11 , SEQ ID NO: 12 , SEQ ID NO: 13 , SEQ ID NO: 14 , SEQ ID NO: 15 , SEQ ID NO: 16 , SEQ ID NO: 17 and SEQ ID NO: 21.2. The one or more oligonucleotide sequences of claim 1 , wherein the target is an activated Nuclear Factor-κB (NF-κB)/RelA complex.3. The one or more oligonucleotide sequences of claim 1 , wherein the oligonucleotide sequence is at least 100% claim 1 , 97% claim 1 , 94% claim 1 , 91% claim 1 , or 90% homologous to a sequence of SEQ ID NO: 21.4. The one or more oligonucleotide sequences of wherein the oligonucleotide sequence is at least 100% claim 1 , 97% claim 1 , 94% claim 1 , 91% claim 1 , or 90% homologous to a sequence comprising SEQ ID NO: 9.5. A method for quantification of activated RelA in a cellular extract comprising the steps of:providing the cellular extract ...

Pre-Transplant Accommodated Organs Resistant To Anti-Donor Immunity

This invention includes the composition of organ grafts accommodated prior to transplantation and therefore resistant to rejection by preformed antibodies. Accommodation is achieved within the donor animal by administration of sub-lethal levels of accommodation inducing factors derived from animals sensitized to the donor. 2. The xenograft of claim 1 , wherein the bone marrow is from a mammal which is of the same species as the sensitized recipient.3. The xenograft of claim 1 , wherein the sensitized recipient mammal is a human.4. The xenograft of claim 1 , wherein the bone marrow is from the sensitized recipient mammal.5. The xenograft of claim 1 , wherein the xenograft is an organ and the organ is selected from the group consisting of heart claim 1 , kidney claim 1 , liver claim 1 , lung claim 1 , pancreas claim 1 , intestine claim 1 , spleen claim 1 , and thymus.6. The xenograft of claim 1 , wherein the xenograft is a tissue and the tissue is selected from the group consisting of bone claim 1 , skin claim 1 , neural tissue claim 1 , skeletal muscle myocytes claim 1 , smooth muscle myocytes claim 1 , cardiac muscle myocytes claim 1 , pancreatic islets claim 1 , hepatocytes claim 1 , stem cells claim 1 , progenitor cells claim 1 , and hematopoietic cells.7. The xenograft of claim 1 , wherein the step of determining occurs prior to the step of harvesting. This application a continuation of Ser. No. 12/897,297, filed Oct. 4, 2010, pending, which is a continuation of Ser. No. 10/181,896 filed Nov. 7, 2002, which issued Oct. 5, 2010 as U.S. Pat. No. 7,807,463, which is a national phase of PCT/US01/02342, filed Jan. 25, 2001, which claims priority to U.S. Provisional Application No. 60/178,347, now expired, filed Jan. 25, 2000. Each of these applications is incorporated herein by reference in its entirety.This invention was made with government support under Research Grant No.R43 DK50737 awarded by the U.S. government. The government has certain rights in the invention. ...

ASSAY FOR MUTATIONS IN STEM CELLS AND THEIR DERIVATIVES

The present invention provides methods to assess the genetic safety of stem cells, whether endogenous embryonic stem cells, somatic or adult stem cells, or artificially induced stem cells from non-pluripotent cells, and their differentiated derivatives for use in human medicine, and the applications of modified stem cells to testing environmental or potential genetic or epigenetic modulators such as culture media formulations, substrates or scaffolds, additives, reagents, processes, and processing materials used to prepare stem cells for use. 129-. (canceled)30. A method of monitoring mutations in a stem cell or a differentiated derivative of a stem cell comprising:(a) introducing a transgene and a selectable marker into a stem cell line;(b) selecting one or more stem cells comprising one or more transgenes;(c) expanding the one or more transgenic stem cell lines;(d) culturing each transgenic stem cell line to allow one or more spontaneous mutations to accrue;(e) selectively packaging the transgene DNA of the transgenic stem cell line into phage particles and analyzing the resulting phage for mutations; and(f) determining a frequency of mutations and a spectrum of mutations in each mutagenized stem cell line by analyzing the mutant phage.31. The method of claim 30 , wherein the stem cell line is an embryonic stem (ES) cell line claim 30 , a somatic claim 30 , tissue-specific or adult stem cell line claim 30 , or an induced pluripotent stem (iPS) cell line derived from differentiated somatic cells.32. The method of claim 30 , wherein the mutation is a point mutation.33. The method of claim 32 , wherein the point mutation is a base substitution claim 32 , or a small deletion claim 32 , addition claim 32 , or inversion.34. The method of claim 30 , wherein the expression vector is a lambda shuttle vector comprising a mutation reporter transgene.35. The method of claim 30 , wherein the stem cell line is a human cell line.36. The method of claim 30 , wherein the stem cell ...

SYSTEM FOR STRATEGIC MEMORY AND REASONING (SMART)

A cognitive strategy instruction program focusing specifically on the ability to reason, abstract, and generalize information for more efficient learning is described herein. The combination of the strategies in tandem with the intensive presentation and process-related (rather than content-related) approach are unique to the SMART program of the present invention. The SMART approach encompasses various cognitive processes in succession, such as working memory, attention, and synthesis of pre-existing knowledge with new information in contrast to most current cognitive interventions focus on specific aspects of cognition such as working memory in isolation. The SMART program of the present invention can be extended with slight modifications if necessary to adults, particularly in senior citizens to enhance one or more cognitive processes. 18-. (canceled)9. A system for enhancing one or more cognitive processes in a subject , comprising:a delivery device that provides or displays a reading segment having known information, wherein the delivery device is selected from the group consisting of a data processor, a display, a computer, a phone, a smartphone, a television, a video, a DVD, a CD, a Blu-ray disc, a media storage device, a photograph, a web-based system, and combinations and modifications thereof; andone or more electronic worksheets for documenting the subject's responses to one or more of the following tasks:inhibit/select or delete/inhibit unimportant details and prioritize important information from the reading segment and documenting the subject's prioritization response;organize important information from the reading segment into a hierarchical listing and documenting the subject's organization response;generate an inference to extract a deeper/abstract meaning of information in the reading segment and documenting the subject's inference response;paraphrase in their own words the subject matter disclosed in the reading segment and documenting the subject ...

Plants With Useful Traits and Related Methods

The present invention provides methods for obtaining plants that exhibit useful traits by transient suppression of the MSH1 gene of the plants. Methods for identifying genetic loci that provide for useful traits in plants and plants produced with those loci are also provided. In addition, plants that exhibit the useful traits, parts of the plants including seeds, and products of the plants are provided as well as methods of using the plants. 1. A method for producing a plant exhibiting a useful trait comprising the steps of:a. suppressing expression of MSH1 gene(s) in a first parental plant or plant cell;b. outcrossing the parental plant of step (a), progeny of said parental plant of step (a), a plant obtained from said plant cell of step (a), or progeny of a plant obtained from said plant cell of step (a) to a second plant wherein MSH1 had not been suppressed;c. screening a population of progeny plants obtained from said outcross of step (b) for at least one useful trait, wherein a portion of said population of progeny plants express MSH1; and,d. selecting a progeny plant comprising said trait that expresses MSH1, wherein said trait is heritable and reversible.2. The method of claim 1 , wherein said trait is associated with one or more altered chromosomal loci.3. The method of claim 1 , wherein said trait is associated with one or more mutated chromosomal loci.4. The method of claim 1 , wherein said method further comprises the step of producing seed from: i) a selfed progeny plant of step (d) claim 1 , ii) an out-crossed progeny plant of step (d) claim 1 , or claim 1 , iii) from both of a selfed and an out-crossed progeny plant of step (d).5. The method of claim 4 , wherein said method further comprises the step of assaying said seed or plants grown from said seed for the presence of said trait.6. The method of claim 1 , wherein said first parental plant or plant cell comprises a transgene that can suppress expression of MSH1.7. (canceled)8. The method of claim 1 ...

EFFICIENTLY INJECTING SPIN-POLARIZED CURRENT INTO SEMICONDUCTORS BY INTERFACING CRYSTALLINE FERROMAGNETIC OXIDES DIRECTLY ON THE SEMICONDUCTOR MATERIAL

A spintronic device and a method for making said spintronic device. The spintronic device includes an epitaxial crystalline ferromagnetic oxide formed directly on the semiconductor material thereby allowing spin-polarized current to be efficiently injected from the ferromagnetic oxide into the semiconductor material. A host crystal lattice includes multiple sets of stacked oxide layers of material A and B of a perovskite structure with a formula of ABO. After an oxide layer of B is grown, magnetic ions are introduced to intermix with the B material, which may replace some of the ions of the B material. The process of growing additional stacked oxide layers of material A and B and introducing further magnetic ions after the deposition of the oxide layer of B continues until enough magnetic ions are sufficiently close to one another that they align in the same direction thereby forming a ferromagnetic oxide on the semiconductor material. 1. A method for forming a ferromagnetic oxide material on a semiconductor , the method comprising:{'sub': '3', 'introducing magnetic ions into a host crystal lattice, wherein said host crystal is in contact with a semiconductor material, wherein said host crystal lattice is a perovskite oxide structure with a formula of ABO, wherein said A comprises one of an alkaline earth metal and a group IIIA metal, wherein said B comprises one of the metals from groups IVA, VIIIA and IIIB, wherein said host crystal lattice comprises a first oxide layer of A and a first oxide layer of B, wherein said first oxide layer of B is grown after said first oxide layer of A, wherein said magnetic ions are introduced after said first oxide layer of B is grown in said host crystal lattice; and'}introducing further magnetic ions into said host crystal lattice after adding each set of additional oxide layers of A and B in said host crystal lattice until a number of magnetic ions align in a same direction thereby forming a ferromagnetic oxide on said ...

Noninvasive, Accurate Glucose Monitoring with OCT By Using Tissue Warming and Temperature Control

A new OCT system and method are disclosed, where the system includes a probe equipped with a heating element and a high heat conductive member to warm a tissue site to be scanned to an elevated and/or to maintain the elevated tissue temperature with a temperature variation of less than or equal to 1° C. to improve an accuracy and reliability of an OCT glucose concentration value other long measurement durations. The new OCT system and method can also be equipped with pressure components to reduce a pressure exerted on the tissue site to a minimal constant pressure.

Compounds With Modifying Activity Enhanced Under Hypoxic Conditions

Compositions and methods for modifying one or more biologic targets are provided. Suitable targets include cells, DNA, proteins, enzymes, and/or a subject in need thereof. The compositions may exist as a monomer or multimer and are active in a biologic environment with enhanced activity in hypoxic environments and, thus, exhibit improved specificity for hypoxic biologic targets (e.g., tumorigenic cells and those undergoing uncontrolled cell growth). A composition typically comprises a complex with an overall charge of 2+ or greater having at least one ruthenium atom attached to a redox active ligand. The redox active ligand helps maintain separation of more than one ruthenium atom. Suitable compositions may further include a terminal ligand comprising a heterocyclic aromatic compound. When provided to a biologic target, the composition modifies the biologic target and no additional compounds need be provided. Suitable compositions are typically catalytic and regenerative in the presence of a reducing agent. 1. A method for modifying a biologic target comprising the steps of:providing a complex to the biologic target, the complex having at least one ruthenium atom attached to a redox active ligand; andmodifying the biologic target with the complex, wherein no additional compounds need be provided and wherein the biologic target is a cell undergoing uncontrolled cell growth.2. The method of claim 1 , wherein the complex modifies in the presence of a reducing agent.3. The method of claim 1 , wherein modifying occurs in an hypoxic environment.4. The method of further comprising including a pharmaceutical carrier with the complex.5. The method of claim 1 , wherein the complex further comprises a terminal ligand that is a heterocyclic aromatic compound.6. The method of claim 1 , wherein modifying further comprises breaking one strand of DNA claim 1 , breaking two strands of DNA in close proximity claim 1 , inhibiting topoisomerase I claim 1 , inhibiting topoisomerase II ...

VISION SYSTEM FOR IMAGING AND MEASURING RAIL DEFLECTION

Devices, systems, and methods for imaging and measuring deflections in structures such as railroad rail are disclosed. An example vision system comprises a high-speed, visible-light imaging camera and an evaluation unit configured for analyzing images from the camera to detect geometric variations in the structure. In analyzing structures such as railroad track rail, the imaging camera can be coupled to a moving rail vehicle and configured for generating images of the rail as the vehicle moves along the track. 1. A vision system for imaging geometric variations along a length of a railroad track rail , the system comprising:at least one visible-light imaging camera adapted for coupling to a moving rail vehicle located on the rail, the imaging camera having a field of view along a line of sight substantially parallel to a longitudinal axis of the rail and configured for generating images of the continuous shape of the rail during vehicle movement along the rail; andan evaluation unit including an image processor configured for analyzing the images from the imaging camera and detecting one or more geometric variations of the rail along the length of the rail.2. The system of claim 1 , wherein the imaging camera is coupled to a sideframe of the rail vehicle and is substantially rigid with respect to a contact point of a wheel to the rail.3. The system of claim 1 , further comprising:a location identifier configured for acquiring global location data corresponding to a global location of the rail vehicle; anda recording unit configured for storing data from the evaluation unit and the location identifier.4. The system of claim 1 , further comprising a transceiver configured for communicating data between the evaluation unit and a remote device.5. The system of claim 1 , further comprising a measurement light source configured for projecting structured light onto a surface of the rail.6. The system of claim 4 , wherein the measurement light source comprises a plurality ...

Restricted Access Media and Methods for Making Restricted Access Media

The present invention is directed to restricted access media (RAM), methods for preparing restricted access media, and kits for preparing restricted access media that contain protected ligand binding agents or protected enzymes. Certain RAM provided contain a plurality of protected regions of the support that contain ligand binding agents that are protected by blocking agents. Certain RAM provided contain a plurality of protected regions of the support that contain unbound ligand binding agents or enzymes that are retained in the protected regions by a capping agent. Methods of making the RAM of the invention and associated kits are also provided 1. A restricted access media comprising a support wherein a plurality of protected regions of said support contain one or more covalently linked ligand binding agent molecule(s) and wherein a plurality of unprotected regions of said support contain one or more covalently linked blocking agent molecule(s).2. The restricted access media of claim 1 , wherein said support comprises an inorganic material claim 1 , a biological material claim 1 , an organic material claim 1 , an organic polymer claim 1 , a composite support claim 1 , or a modified support.3. The restricted access media of claim 1 , wherein said ligand binding agent molecule comprises a protein claim 1 , a glycoprotein claim 1 , a DNA claim 1 , a RNA claim 1 , a nucleoprotein claim 1 , or a carbohydrate containing agent.4. The restricted access media of claim 3 , wherein the protein comprises an antibody or ligand binding fragment thereof.5. The restricted access media of claim 1 , wherein said blocking agent molecule comprises a sub-fragment of said ligand binding agent molecule wherein ligand binding activity is reduced or eliminated.6. A method for preparing a restricted access media comprising:a) incubating an activated support with a solution comprising a plurality of ligand binding agent molecules to form a ligand bound support wherein said ligand binding ...

INHIBITORS OF LL-37 MEDIATED IMMUNE REACTIVITY TO SELF NUCLEIC ACIDS

Methods and compositions for treating disease are provided. More particularly, methods and compositions of inhibiting pathogenic interferon production are prevented, which may be useful in the treatment of various diseases. In other embodiments, therapeutic compounds and methods for the treatment of autoimmune diseases and chronic inflammatory diseases and/or cancer are provided. One such method is a method for inhibiting pathogenic interferon production or inhibiting activation of plasmacytoid dendritic cells or treating an autoimmune or chronic inflammatory disease, which comprises inhibiting one or more of LL-37 and hCAP18. 1. A method of treating cancer in a patient comprising the steps of testing the patient for the presence of a LL37/DNA complex , wherein the DNA comprises both dsDNA and ssDNA having CpG motifs , and administering a therapeutically effective amount of LL-37 to the patient who tested positive for the LL37/DNA complex.2. The method of treating of wherein the cancer is melanoma.3. A method of treating autoimmune disease in a patient comprising the steps of testing the patient for the presence of a LL37/DNA complex claim 1 , wherein the DNA comprises both dsDNA and ssDNA having CpG motifs claim 1 , and administering a therapeutically effective amount of a proteinase 3 inhibitor to the patient who tested positive for the LL37/DNA complex.4. A method of treating tumors in a patient comprising the steps of testing the patient for the presence of a LL37/DNA complex wherein said DNA comprises both dsDNA and ssDNA having CpG motifs claim 1 , and administering a therapeutically effective amount of a vaccine comprising LL37 and dying tumor cells wherein LL37 and the tumor cells are first combined ex-vivo and then injected into the patient. This is a continuation-in-part application of U.S. patent application Ser. No. 11/957,959 filed Dec. 17, 2007, which claims the benefit of U.S. Provisional Patent Application No. 60/870,375 filed Dec. 15, 2006. These ...

Diagnostic Methods for Assessing Risk of Chagas Disease and Heart Failure

Provided herein are methods of detecting evidence of Chagas disease in a biological sample, comprising the step of measuring the presence of at least one protein selected from the group consisting of gelsolin, myosin light chain 2, vimentin, myosin heavy chain 11, vinculin, and plasminogen in said sample, wherein significantly elevated levels of the protein is a biomarker for the presence or severity of Chagas disease. 1T. cruzi. A method of determining the presence or severity of Chagas disease comprising the step of measuring the levels of at least one protein selected from the group consisting of vimentin (VIM) , gelsolin (GSN) , myosin light chain 2 (MYL2) , myosin heavy chain 11 (MYH11) , vinculin (VCL) , and plasminogen (PLG) in a test sample from a subject , wherein an elevated level of the one or proteins compared to a control sample uninfected by indicates that the subject has Chagas disease.2. The method of claim 1 , wherein the levels of one or more of VCL claim 1 , MYL2 claim 1 , or PLG is measured.3. The method of claim 1 , wherein the subject is a human.4. The method of claim 1 , wherein the test sample is a tissue sample claim 1 , a plasma sample claim 1 , or a blood sample.5. The method of claim 1 , wherein the test sample is a plasma sample.6. The method of claim 1 , wherein the levels of protein are measured by a Western blot assay claim 1 , an ELISA assay claim 1 , an immunofluorescence assay claim 1 , an immunoprecipitation assay claim 1 , a radioimmunoassay claim 1 , or combinations thereof.7. The method of claim 1 , wherein the elevated level of a protein is greater than 40% and less that 200% relative to normal levels.8. The method of claim 1 , wherein the elevated level of a protein is greater than or equal to 200% relative to normal levels.9. A method of treating Chagas disease comprising the steps of:{'claim-ref': {'@idref': 'CLM-00001', 'claim 1'}, '(a) determining the presence or severity of Chagas disease as described in ; and'}(b) ...

COMBINATION CANCER THERAPY WITH HERV INHIBITION

Embodiments are directed to compositions and methods related combination therapy with HERV inhibition. 1. A method for treating melanoma comprising administering an effective amount of an anti-HERV therapy in combination with an effective amount of BRAF or MEK inhibitor , and a CDK4 inhibitor to a patient that has melanoma.2. The method of claim 1 , wherein the anti-HERV therapy is administered about 1 claim 1 , 2 claim 1 , 3 claim 1 , 4 claim 1 , 5 claim 1 , 6 claim 1 , 7 claim 1 , 8 claim 1 , 9 claim 1 , 10 hours or days prior to administration of the BRAF-MEK inhibitor and the CDK4 inhibitor.3. The method of claim 1 , wherein the BRAF or MEK inhibitor is PLX4032 (Plexxikon) claim 1 , BAY 43-9006 (Sorafenib) claim 1 , Raf-265 (CHIR-265) claim 1 , XL281 (Exelixis) claim 1 , dasatinib claim 1 , erlotinib hydrochloride claim 1 , gefitinib claim 1 , imatinib mesilate claim 1 , lapatinib claim 1 , sorafenib tosylate claim 1 , sunitinib malate claim 1 , PD-325901 claim 1 , XL518 claim 1 , PD-184352 claim 1 , PD-318088 claim 1 , AZD6244 claim 1 , CI-1040 claim 1 , vemurafenib claim 1 , GSK2118436 claim 1 , or combinations thereof.4. The method of claim 1 , wherein the BRAF or MEK inhibitor is PLX4032 or GSK2118436.5. The method of claim 1 , wherein the CDK4 inhibitor is P-276-00 claim 1 , GW-491619 (GlaxoSmithKine) claim 1 , AG-12275 (Pfizer) claim 1 , AG-12286 (Pfizer); PD-0166285 (Pfizer); PD-0332991 (Pfizer) or a combination thereof.6. The method of claim 1 , wherein the anti-HERV therapy is a monoclonal antibody and/or an anti-retroviral drug.7. The method of claim 6 , wherein the anti-HERV monoclonal antibody specifically binds a HERV envelope protein.8. The method of claim 6 , wherein the anti-retroviral is selected from a nucleoside reverse transcriptase inhibitors claim 6 , non-nucleoside reverse transcriptase inhibitors claim 6 , protease inhibitors claim 6 , fusion inhibitors claim 6 , or integrase inhibitors.9. The method of claim 6 , wherein the anti- ...

QUANTITATIVE RT-PCR DETECTION FOR GENES INVOLVED IN EPITHELIAL MESENCHYMAL TRANSITION IN PERIPHERAL BLOOD OF CANCER PATIENTS

An assay and associated methodologies for detection of breast cancer are described. Circulating tumor cells (“CTCs”) undergo epithelial mesenchymal transition (“EMT”) prior to entering circulation, resulting in the loss of epithelial markers. These CTCs and EMT-related gene transcripts in the peripheral blood of patients are tested by quantitative RT-PCR to detect and diagnose breast cancer. 1. An assay useful to detect breast cancer in a patient and characterized by the detection of circulating tumor cells undergoing epithelial mesenchymal transition in peripheral blood wherein CTCs which do not have an epithelial antigen and through quantitative reverse transcription polymerase chain reaction (“RT-PCR”) , the expression of three or more of EMT gene transcripts are identified , the EMT gene transcripts being selected from the group consisting of: TWIST1 , SNAIL1 , SLUG , ZEB1 and FOXC2.2. The assay of claim 1 , wherein CD45-depleted peripheral blood mononuclear cells are used to detect the expression of EMT genes in the patient.3. The assay of claim 1 , wherein the assay is used in combination with other EpCAM-based selection methods.4. An assay that detects breast cancer in the peripheral blood patient claim 1 , wherein the peripheral blood of the patient contains CTCs lacking an epithelial antigen claim 1 , gene or marker and the expression of at least three EMT gene transcripts selected from the group of TWIST1 claim 1 , SNAIL1 claim 1 , SLUG claim 1 , ZEB1 and FOXC2 are identified and breast cancer is diagnosed without a correlation to CTC count.5. A method of diagnosing breast cancer in a human or animal claim 1 , the method comprising the steps of: a) extracting CTCs from blood plasma or serum obtained from a human or animal; b) identifying CTCs without an epithelial antigen; and c) detecting the expression of at least three EMT gene transcripts using RT-PCR claim 1 , wherein a breast cancer diagnosis can be confirmed when the blood of a human or animal ...

METHOD FOR GENERATING A GENERAL ENHANCED OIL RECOVERY AND WATERFLOOD FORECASTING MODEL

In accordance with one or more embodiments of the present disclosure a method for forecasting an advanced recovery process for a reservoir comprises determining a displacement Koval factor associated with a displacement agent associated with an advanced recovery process. The displacement Koval factor is based on heterogeneity of porosity of the reservoir and mobility of the displacement agent. The method further comprises determining a final average oil saturation of the reservoir associated with the advanced recovery process being finished. The method additionally comprises determining an average oil saturation of the reservoir as a function of time for the advanced recovery process based on the displacement Koval factor and the final average oil saturation. 1. A method for forecasting an advanced recovery process for a reservoir comprising:determining a displacement Koval factor associated with a displacement agent associated with an advanced recovery process, the displacement Koval factor based on heterogeneity of porosity the reservoir and mobility of the displacement agent;determining a final average oil saturation of the reservoir associated with the advanced recovery process being finished; anddetermining an average oil saturation of the reservoir as a function of time for the advanced recovery process based on the displacement Koval factor and the final average oil saturation.2. The method of claim 1 , wherein the displacement agent comprises at least one of water claim 1 , a gas claim 1 , a polymer claim 1 , and an alkaline surfactant polymer.3. The method of claim 1 , further comprising determining the displacement Koval factor based on at least one of a distribution of permeability of the reservoir claim 1 , a mobility ratio between the displacement agent and oil associated with the reservoir claim 1 , and an arrangement of heterogeneity of porosity of the reservoir.4. The method of claim 1 , further comprising determining the final average oil saturation ...