A transformant comprising MYH3 gene and use thereof

13-07-2018 дата публикации
Номер:
KR0101876488B1
Контакты:
Номер заявки: 01-16-102052252
Дата заявки: 15-11-2016

[1]

The present invention refers to MYH3 gene and methods of use relates to a transformant including, specifically the sequence numbers 1 consisting of a number of an individual human bio-sequence listing including MYH3 gene recombinant vector including improving the quality of the transformant transformed embryo to the method are disclosed.

[2]

[3]

The swine demanded number as its most basic livestock protein, about 9000 years ago of eastern part of polypyrrole and guided by a breeding animal fats, each headset and situations and people taste to been feeding. To determine the amount of meat and meat is a power supply is provided with a factor in the arthritis, even one of the meat muscle to room the level of content, the most important measure of the lampwick for evaluating the quantity of meat a cross section and, when making purchases as six red meat color value in the most favorable consumer preferentially transformed mirim also disclosed.

[4]

[5]

Under such circumstances the daily allowance for producing commercial conform to raising the productivity amount, immune capability, the operands be, breast milk amount, has an excellent quality traits as the varieties are made on we shall be having porcine glucoside, current to 200 and the number of species of U.S.dollars. However, since the breeding and obtain desired traits having twice, suffering from long time that the memory section. The, to modify the genotype animals reduces washed technology for improving quality and, as a result, meat and transformation of Pig, etc. region involved in thickness and in black evening twilight of SNP using a method such as gene traits with improved appearance corrosion disclosed (Korean Patent Registration Notification number 10 - 1457942 call) developed a vaccine against porcine number tank. However, quality of Pig still an entire method can be simply subjected to development in a state not and, in addition, using quality improving method of Pig MYH3 gene has been developed for the bar.

[6]

[7]

Under such background, the present invention improve quality traits can be lightened and the victims of the dielectric by deforming the method result example to perform research effort, determining when the quality of swine MYH3 gene traits of about identifying gene, said gene is mass- of mouse have been introduced is also used for the inside of the red meat by, a recombinant vector including said gene can improve quality and confirm, the arrears of work the present invention.

[8]

[9]

The aim of the one of the present invention consisting of a number of sequence numbers 1 bio-sequence listing MYH3 gene of an individual to a recombinant vector including a human embryo transformed including, improving the quality of the transformant number method are disclosed.

[10]

[11]

In order to achieve said purposes, one aspect of the present invention consisting of a number of sequence number 1 bio-sequence listing including MYH3 gene of an individual including a human embryo to transformed recombinant vector, a method for improving quality of the transformant number substrate.

[12]

[13]

In the present invention, the first and second degree of Pig formate determined by MYH3 gene, said gene have been introduced as compared to wild-type mouse transformant of meat is also used for the inside of the first and second by, the expression level of said gene mRNA or protein of quality measured by the present invention can be judged confirm the arrears of work.

[14]

[15]

Terms of the present invention, animal muscles "MYH3 gene" is included in the gene encoding myosin heavy chain 3 constituting arranged at and which means is provided to the passenger, such as the NCBI GenBank database of bio-sequence listing of publicly known of in can be achieved (example: GenBank Accession No. XM_013981330). In specific embodiments, said gene is gene derived from porcine handler, the one number are not disclosed. In the present invention, said gene sequence variation is to provide improved 1 number can be nucleotide sequence.

[16]

[17]

Terms of the present invention, "recombinant vector" includes a vector capable of expressing the aim or desired protein in a suitable host cell RNA as, expressed gene insert operatively connected to small water including gene regulation element integral number said substrate.

[18]

A recombinant vector of the present invention to said MYH3 gene including, specifically the map of Figure 6 may be ribbed tube, more specifically the sequence numbers 2 consisting of bio-sequence listing including the polynucleotide may be disclosed.

[19]

In addition, a recombinant vector including said CAGGS promoter (CAGGS promoter) may be and, more specifically CAGGS promoter (CAGGS promoter) operably connected MYH3 gene is to be a.

[20]

Terms of the present invention, "promoter" is a point located upstream of regions including disclosure generally transcription gene site, regulation of the expression of gene often TATA box, CAAT box site, in response to an external stimulus which affects gene expression regardless of promoting the expression of a gene enhancer (enhancer) substantially all directions and locations site and consists of the nanometer range. In addition, during such promoter (constitutive promoter) promoter in all tissues selectively expression promoter (inducible promoter) and time or location specifically expression can be ortho, specifically the present invention according to be a promoter CAGGS promoter.

[21]

Said terms, 'operably connected' (operably linked) general functions to perform the desired protein or RNA nucleic acid expression regulatory sequences and functionally connected to the nucleic acid sequences encoding a preset S. (functional linkage). A nucleic acid sequence encoding a protein or RNA promoter and e.g. operably connected to affect the expression of a nucleic acid sequence encoding can be. With recombinant vector gene using recombinant techniques well-known in the art operatively connection number can be high pressure liquid coolant, site - specific DNA cutting and connection is generally known in the art enzyme etc..

[22]

[23]

Terms of the present invention, "subject" includes a mouse, porcine, chicken, bovine means all animals such as 2000. In specific embodiments, mammalian, avian such as livestock can be a, muscles and fat having a meat to the substrate, the one number are not disclosed. In the present invention, can be launched said mouse or the [lay it will be a [thu, C57BL/6n said mouse varieties grown in specific examples, hybrid BCF, FVB/n is provided to be used, the one number are not disclosed.

[24]

[25]

Terms of the present invention, "transgenic" DNA of a living to an pitches along given from the outside by means that the substrate. The method include various method known in the art transformed, in particular specific embodiments, microinjection method (microinjection), former asthma method (electroporation), particle spray (particle bombardment), method using sperm (sperm-a mediated gene transfer), viral infections (viral infection) method, direct muscle injection (direct muscle injection), insulator (insulator) and transposon (trnasposon) may be using techniques such as, if one skilled to conform to the purpose of the invention may be selecting appropriate method are disclosed.

[26]

[27]

Terms of the present invention, the transformation "transformant" dielectric properties by individual big changes. Specifically, mouse, porcine, chicken, cow of all animals, and still more specifically mammalian, avian such as livestock can be a, the one number are not disclosed.

[28]

[29]

Terms of the present invention, the representation of various bone number indicative of the state of "meat" CA traits 200b, transformed are specially the representation but not one number, , meat color, maintenance force, like shear force can be, more specifically or meat color can be. contained in a muscle of fat content, meat color visible to the clip meat color, moisture maintenance force sustaining , shear force is meat from tearing when tough the proportion, the higher the , representing a red meat color increases, repairing and shearing force can comprise low quality of meat increases substrate. The among other things, the most important measure of the quality level and evaluating , meat color indicating a proportion freshness it provides evaluation factors are disclosed.

[30]

[31]

In the embodiment of the present invention in one specific, a microinjection method including MYH3 gene using recombinant vector (microinjection) C57BL/6n mouse embryo to a transgenic mouse expressing porcine MYH3 gene number was transformed by a high pressure liquid coolant (also 5 to 7). In addition, a transgenic mouse as compared to said wild-type mouse to the armrests muscles is greater than red near fiber and adipose tissue exists, affecting gene mRNA and proteins of red near (slow type fibers); and fat differentiation gene mRNA expression has been confirmed (also 9 and 10) at least two types of increases.

[32]

This, including recombinant vector contains an individual by a MYH3 gene, to improve quality of the transformant may be for clinical use are disclosed.

[33]

[34]

A transformant transformed with the recombinant vector of the present invention MYH3 gene including transformed as compared to the wild-type belt is wound and red effect, said vector can be used to improve quality of the transformant.

[35]

[36]

Figure 1 shows a number of (a) (b) [lay pig making appearance on a native kind also land race and back functionality in the examination Image comparison are disclosed. Figure 2 gene transformed according to LDLA QTL (quantitative trait locus) of determining meat (linkage provided linkage disequilibrium analysis) results show a graph identifying region are disclosed. [Lay pig and making a number is obtained as the porcine race land progeny (LK axis group), b [lay pig and making a vaccine against porcine [tyu rock number is obtained as the progeny to (DK axis group) are disclosed. Figure 3 gene transformed in areas representing the result of determining meat QTL LALD mapping gene are disclosed. Figure 4 QTL gene mRNA expression amount in areas of comparison graph are disclosed. A lampwick is (the longest near, longissimus), the insides of the b (thigh company two muscle, quadriceps) are disclosed. Figure 5 shows a 2001 KIPO the folds also CAGGS-a EGFP provided Puro vector. Figure 6 shows a ribbed tube of said device and also recombinant MYH3 gene expression vector sequence of gene vector CAGGS provided MYH3 provided Flag's desire. Figure 7 MYH3 gene transformed by said vector MYH3 gene activity and expression of recombinant mouse at or aspect. A MYH3 gene transcription activity of the Image is shown are disclosed. P/C is positive controls (positive control), in accordance with the red number (21, 24, 26, 27, 28) is MYH3 gene transfer activity demonstrating a transgenic mouse, in accordance with the black number (19, 20, 22, 23, 25) is the transgenic should, MYH3 gene transcription of active mouse big. B is a protein expression analyses the amount representing the result of the [wey the [su it shook off blot MYH3 gene are disclosed Image. Pig MYH3 gene transgenic mouse inserted with shape of Figure 8 are disclosed. Figure 9 (a) appearance of wild-type mouse (WT) and transgenic mouse (TG) (b, c) shape of the armrests muscle and muscular tissues is shown Image are disclosed. The armrests muscular tissues myosin ATPase b is organized as chemical dyeing Image, red arrow muscle Type 1/oxidative/slow fibers being red, blue arrows have white muscle Type 2a and blue triangle is white muscle Type 2b Type 2/glycolytic/fast fibers of electromagnetic wave is electromagnetic wave is indicative of the substrate. Means 50 micro m weight mirror of automobile (Scale bar) is 2000. C is the armrests muscular tissues Oil red O dyeing Image are disclosed. Scale bar 100 micro m components, rectangular region shown below present in the signals. Figure 10 porcine MYH3 gene expression pattern confirming the result of intramuscular gene inserted with a transgenic mouse's desire. Gene mRNA is associated with a type of fiber protein expression analysis results through the [wey the [su it shook off and qRT-a PCR's desire. 4 Months (n=5) (n=3) using the air core of the wild type mouse on a transgenic mouse. The armrests of a muscle is slow a-type (left) and fast-a type b (shadow) gene mRNA expression amount of muscle associated with qRT-a PCR analysis results through's desire. 4 Months (n=4) (n=3) using the air core of the wild type mouse on a transgenic mouse. The resulting value is the ferroelectric layer obtained independent three times, have shown the same average ± SEM (* P<0. 05, ** P<0. 01). C is the [hey e [thok it was recorded and it came to the armrests muscles solution's desire result. Arrows have muscle week film (perimysium), triangle is (endomysium) muscle inside story indicating other. D fat differentiation gene expression amount of mRNA analysis results is through qRT-a PCR's desire. Figure 11 Pig MYH3 gene structure and QTN (quantitative trait nucleotide) is shown Image are disclosed. Figure 12 affecting hanhyo small HpyCH4IV number transitions cause meat cutting using a base pattern is shown Image are disclosed. (Q/q) 1/1 LANDRACE varieties derived from non-truncated, land race number making derived from fruit varieties (q/Q) 1/2 cutting type, number making varieties (Q/Q) 2/2 [lay pig derived from at or type cutting.

[37]

In the embodiment hereinafter the present invention through a corresponding business are provided as follows. In the embodiment of the present invention is generally described the present invention is to exemplify these for range and not the limited to those in the embodiment.

[38]

[39]

In the embodiment 1. Visual comparison of Pig meat transformation

[40]

Number of Pig meat ( and red meat) in order to compare a transformed making land race, from a free-form of his lampwick.

[41]

As a result, in Figure 1 the studied, but while introducing various sorts land race of mutton pale white, red and black evening twilight number making the mutton which has six, in particular excellent e [pul ring deposits has been confirmed.

[42]

The result of said, Pig compared to know capable of excellent quality for keeping things slicked land race.

[43]

[44]

In the embodiment 2. Pig meat transformation Quantitative characteristics sites(Quantitative trait locus; QTL) Analysis

[45]

In the embodiment 2 - 1. Identifying QTL gene region of meat

[46]

Pig meat for identifying modulators for determining gene traits, obtained as the number [lay pig and making a vaccine against porcine race land progeny (LK axis group), [lay pig and making a vaccine against porcine [tyu rock and number obtained as the transgenic progeny (DK axis group) where the meat for arthritis (red (a *) also, (IMF)) conducting quantitative characteristics sites (quantitative trait locus; QTL) analysis.

[47]

As a result, in the studied of Figure 2 a, vertical dashed lines is located on chromosome 12 times of LK axial army 661 kb formate, in addition, in a of Figure 2 b studied, even axial army vertical dashed lines is located on chromosome 12 times of 661 kb KD has been confirmed.

[48]

The result of said, red meat (red also) and determining the varietal Pig gene is damaged regions are positions have predetermined position, this chromosome 12 times of 661 kb know capable of existing in the data area.

[49]

[50]

In the embodiment 2 - 2. Pig meat identifying transformed gene

[51]

Pig meat once 661 kb of chromosome gene traits is determining said in the embodiment 2 - 1 through 12 is also used for by existing in the data area, said gene has been confirmed through a LALD mapping the existing in the data area.

[52]

As a result, in Figure 3 the studied, MYH3, MYH1, MYH2, MYH13, ADPRM, SCO1, TMEM220, ENSSSCG 00000029441, ENSSSCG 00000018006 9 gene is transformed by said gene has been confirmed that the meat of two existing in the data area.

[53]

[54]

In the embodiment 2 - 3. Pig meat and selecting transformed related gene

[55]

Periodically determining said in the embodiment 2 - 2 through 9 according to two meat traits gene, said gene to be among the most relevant gene was transformed aujesky determination of high quality.

[56]

(KNP) on land race (LANDRACE) (longest near, longissimus) and insides of the lampwick of Pig in (thigh company two muscle, quadriceps), two relative mRNA expression analyses the amount said 9 gene was.

[57]

Specifically, one race to the lampwick and insides of the Pig (LANDRACE) have a muscular tissues harvested on land, RNA (Ambion) was separating using Trizol reagent. Each organization TOPscript cDNA synthesis kit (Enzynomics) after 5 micro g such that the same RNA concentration by using cDNA (complement DNA) and copiers. After each organization qRT-a PCR using cDNA by conducting experiments. 95 °C qRT-a PCR experiments in 20 seconds, 20 seconds in 60 °C, in processing a 40 20 72 °C QuatiTect SYBR Green PCR kit (Qiagen) qRT-a PCR experiment for the implementation of a periodical repetition when the deflection, (Qiagen) equipment between embodiment was analyzed Roter provided Gene Q thermal cycler. Gene analysis of total 9 listed in table 1 was used for primer represented.

[58]

GeneClassificationDirectionBio-sequence listing (5 '→3')
PMYH3Sequence number 3ForwardAAAAGCTCAGCATGAGCTCGA
Sequence number 4ReverseAGGGTCAGGAACCATGAAAAT
PMYH1Sequence number 5ForwardGTTCTGAAGAGGGTGGTAC
Sequence number 6ReverseAGATGCGGATGCCCTCCA
PMYH2Sequence number 7ForwardGGGCTCAAACTGGTGAAGC
Sequence number 8ReverseAGATGCGGATGCCCTCCA
PMYH13Sequence number 9ForwardCACAGGGCTCTGGCCGACAT
Sequence number 10ReverseCGTGCGCACAGGGGTGTAGT
PADPRMSequence number 11ForwardCATCCTGAGACCGTGCCTTCA
Sequence number 12ReverseTTCCGCATTTGGGTTGTGCT
PSCO1Sequence number 13ForwardTCCTCACGGACTCGGGGTTT
Sequence number 14ReverseGTGGGGTCTCTGCTGCCCTT
PTMEM 220Sequence number 15ForwardCCCAGACGCAGAACTGTGGG
Sequence number 16ReverseGTTGTATGCCAAGCCGGCAG
PENSSSCG 00000029441Sequence number 17ForwardTCGTGCTGGAGCAGGAGGAG
Sequence number 18ReverseAGGTGTCTGTGGCCTTGGGG
PENSSSCG 00000018006Sequence number 19ForwardAGAACCAGCCCTTCGATGCC
Sequence number 20ReverseTGGCATACACATCCTCCGGC
PGAPDHSequence number 21ForwardGGGCATGAACCATGAGAAGT
Sequence number 22ReverseGGGCATGAACCATGAGAAGT

[59]

[60]

As a result, in a and b of Figure 4 a studied, compared to land race, and insides of the lampwick of MYH3 gene mRNA expression has been confirmed in Pig of highly crystalline.

[61]

The result of said, in particular transformed MYH3 gene among quality of swine, major gene determining red degree about his car.

[62]

[63]

In the embodiment 3. Pig MYH3 gene inserted with small number of transgenic mouse

[64]

In particular transformed through quality of swine MYH3 gene among said in the embodiment 2, by actually determining character that would yield a red gene, said gene activity in vivo (in vivo) in order to identify, a small 3 - 1 to 3 - 2 according to method for consecutively inserted with same number MYH3 gene transgenic mouse by using the air.

[65]

[66]

In the embodiment 3 - 1. Small number of vector

[67]

First, porcine MYH3 gene is inserted transgenic mouse number boil last summer, MYH3 gene expression vector inserted with CAGGS provided MYH3 provided Flag number was high pressure liquid coolant.

[68]

Specifically, overexpression of porcine MYH3 number for small, after confirming the entire bio-sequence listing of porcine MYH3 gene mRNA, DNA fragments is divided into a total 4 each artificially copiers. 1, 417Bp BglII enzyme XbaI site to both sites in cross-section and a first fragment thereof is in addition to the artificial copiers. A transparent conductive layer on the second fragment thereof is to synthesize 1, 745bp BglII SalI, SacII SalI synthesizing 1, 777bp on third fragment thereof is to have, on the second to last you 944bp SacII EcoRI-configurated. 4 DNA fragments bound to the enzyme site of finished end artificially using a porcine MYH3 gene mRNA including gene fragments (Ligation) coupled to finally complete the entire queue.

[69]

Also shown after overexpression vector for introducing 5 such as EcoRI XbaI cut CAGGS-a EGFP provided Puro vector and after, the number of the fragments prior work grudge porcine MYH3 gene mRNA transformed vector insert number was finally Pig MYH3 less complete (6 also).

[70]

The structure of the precursor to 6 said vector, vector nucleotide sequence sequence number 2 which have been designated.

[71]

[72]

In the embodiment 3 - 2. Small number of transgenic mouse

[73]

In the embodiment 3 - 2 - 1. Small number of transgenic mouse method

[74]

Said in the embodiment 3 - 1 transgenic mouse work grudge vector number through a small number-gate.

[75]

Specifically, C57BL/6n mouse fertilized egg (microinjection) after obtaining the microinjection technique using said transformed vector was introduced into it became work number to the nuclear embryo.

[76]

As a result, total 47 of F0 founder embryo therefrom.

[77]

[78]

In the embodiment 3 - 2 - 2. Through introducing foreign gene mRNA expression analysis for checking

[79]

Number through work grudge MYH3 gene have been introduced for whether said in the embodiment 3 - 2 - 1 transgenic mouse, mRNA expression of said gene was minisequencing.

[80]

Specifically, PCR experiment conditions in 30 seconds 95 °C, 60 °C in 30 seconds, when the periodical repetition in processing a 40 30 72 °C, represented using primer was listed in table 2.

[81]

GeneClassificationDirectionBio-sequence listing (5 '→3')
PMYH3Sequence number 23ForwardCCGAGAGCTGGAGTTTGA
Seq ID 24ReverseCTCCCATATGTCCTTCCGAGT

[82]

[83]

As a result, studied in of Figure 7 a, is inserted in a transgenic mouse expressing MYH3 gene mRNA (21, 24, 26, 27, 28 times) were confirmed.

[84]

[85]

In the embodiment 3 - 2 - 3. Protein expression analysis for checking introduced foreign gene

[86]

Number through work grudge MYH3 gene have been introduced for whether said in the embodiment 3 - 2 - 1 transgenic mouse, his minisequencing protein expression of said gene.

[87]

Specifically, a transgenic mouse (TG) of insides of the wild-type mouse (WT) on muscle tissue after taking, RIPA buffer was added by spray-decomposing protein degradation billion number number ultrasound tissue. Then, through low temperature and protein in supernatant was harvesting the tissue are separated from each other. Protein assay reagent (bio-a rad) quantifying protein is BSA recovery after using, 4x protein loading buffer (1x) was about 10 minutes heating to 100 °C. In order to perform the [wey the [su it shook off using prepared protein, said protein SDS-a PAGE gel electrophoretic-gate about 2 hours. Then, moved from PVDF membrane after electrophoretic-protein, using 5% skim milk 1 have time blocking, stores an experiment first antibody (Anti-a Flag M2 (F1804, Sigma provided Aldrich) and b a-actin (#4970, Cell signaling)) has been added in reacting stored at 4 °C. Next TBST solution after 2 hours after washing the secondary antibodies reacting, ECL reagents have processing, (Fujifilm) LAS-a 300 luminescent image analyzer system using proteins of an antibody signal therefrom. Experiments used secondary antibodies as well as pace to the first antibody.

[88]

As a result, studied in of Figure 7 b, 24 times among the highest amount of protein expression in a transgenic mouse MYH3 gene were confirm it. The, highest degree protein expression after gene transformed mouse once it has been fruit 24 utilizing wave or vibrations, its appearance is also shown to 8.

[89]

[90]

In the embodiment 3 - 3. Identifying a transgenic mouse in the form of muscle

[91]

In order to identify the function of a crystal MYH3 gene transformed meat, meat of said in the embodiment 3 - 2 transgenic mouse number through work grudge traits visit from the police.

[92]

First, in a of Figure 9 a studied, porcine MYH3 gene is transformed in a wild type mouse (left; WT) mouse (shadow; TG) of muscle to the armrests of confirming capable of more than artificial pearl with red.

[93]

Then, in order to identify more particularly an muscle form, ATPase conducting dyeing. The wild type and a transgenic mouse (sucrose) 30% sucrose solution after processing to the armrests of muscles by recovering all night, OCT compound 10 using micro m in size then -25 °C tissue (tissue-a section), 4% PEA 1 was fixed during the time. After 10 minutes have flowing water cleaning, using 60% isopropanol (isopropanol) after washing, dyeing kit (ATPase stain lyopilized powder for histoenzymatic reaction kit, Bio optica yarn) ATPase in conducting method using irradiation number according to timing number database.

[94]

As a result, in a of Figure 9 b studied, as compared to wild-type mouse (left; WT), said gene transgenic mouse (shadow; TG) is inserted with the armrests muscles more red muscle relaxant is also used for distributed queue.

[95]

[96]

Additionally, in order to identify Oil Red O conducting dyeing of fat distribution in muscle tissue. Specifically, 0 said tissue fragments. 3% Oil Red O solution 1 with respect to the reaction time.

[97]

As a result, studied in of Figure 9 c, as compared to wild-type mouse (left; WT), is also used for dyeing a transgenic mouse (shadow; TG) degree by stronger, more muscle to the armrests of the fat content of a transgenic mouse were confirm it.

[98]

The same classifies, MYH3 gene is red and red muscle improve accumulate, gene cause that accumulates about his car.

[99]

[100]

In the embodiment 3 - 4. Of transgenic mouse intramuscular gene expression pattern checking

[101]

In the embodiment 3 - 4 - 1. Expression of gene formed near red/white muscle pattern checking

[102]

In order to identify the function of crystal quality MYH3 gene expressed in a transgenic plant, a transgenic mouse work grudge number through said in the embodiment 3 - 2 gene patterns of expression of red/white muscle of formed near visit from the police.

[103]

Specifically, a transgenic mouse (TG) on wild-type mouse (WT) collection of insides of the muscular tissues have, in conducting said in the embodiment 2 - 3 according to method qRT-a PCR. Selecting inner primer represented was listed in table 3.

[104]

GeneClassificationDirectionBio-sequence listing (5 '→3')
Myh7Sequence number 25ForwardAGTCCCAGGTCAACAAGCTG
Sequence number 26ReverseTTCCACCTAAAGGGCTGTTG
Myh2Sequence number 27ForwardAGTCCCAGGTCAACAAGCTG
The sequence numbers 28ReverseGCATGACCAAAGGTTTCACA
Myh1Sequence number 29ForwardAGTCCCAGGTCAACAAGCTG
Sequence number 30ReverseCACATTTTGCTCATCTCTTTG
Myh4Sequence number 31ForwardAGTCCCAGGTCAACAAGCTG
Sequence number 32ReverseTTTCTCCTGTCACCTCTCAACA
MyoglobinSequence number 33ForwardGCAAGGCCCTGGAGCTCTTC
Sequence number 34ReverseGCTTGGTGGGCTGGACAGTG
Tnnt1The sequence numbers 35ForwardCCCCCGAAGATTCCAGAAGG
Sequence number 36ReverseTGCGGTCTTTTAGTGCAATGAG
Tnni1Sequence number 37ForwardATGCCGGAAGTTGAGAGGAAA
Sequence number 38ReverseTCCGAGAGGTAACGCACCTT
Tnnc1Sequence number 39ForwardGCGGTAGAACAGTTGACAGAG
Sequence number 40ReverseCCAGCTCCTTGGTGCTGAT
AldoaSequence number 41ForwardACTCTCTGCTGACCGGGCTCT
Sequence number 42ReverseAATGCTTCCGGTGGACTCAT
PvalbSequence number 43ForwardATCAAGAAGGCGATAGGAGCC
The sequence numbers 44ReverseGGCCAGAAGCGTCTTTGTT
Tnnt3Seq ID 45ForwardGGAACGCCAGAACAGATTGG
Sequence number 46ReverseTGGAGGACAGAGCCTTTTTCTT
Tnni2Seq ID no 47ForwardAGAGTGTGATGCTCCAGATAGC
Seq ID no 48ReverseAGCAACGTCGATCTTCGCA
Tnnc2Seq ID no 49ForwardATGGCAGCGGTACTATCGACT
Sequence number 50ReverseCCTTCGCATCCTCTTTCATCTG
GAPDHSequence number 51ForwardGAAGGGCATCTTGGGCTACAC
The sequence numbers 52ReverseGCAGCGAACTTTATTGATGGTATT

[105]

[106]

In addition, the [wey the [su it shook off when the to perform said in the embodiment 3 - 2 - 3 according to method, selecting inner primary antibodies as follows: Anti-a Flag M2 (F1804, Sigma non-Aldrich), MYH7 (SC-a 53089, Santa cruz biotechnology), MYH4 (H00004622 - B01P, Abnova) and b a-actin (#4970, Cell signaling).

[107]

As a result, in a of Figure 10 a studied, as compared to wild-type mouse, a transgenic mouse of the same is slow type gene and protein expression of mRNA in red muscle in MYH7 gene has been confirmed by rapidly increased.

[108]

In addition, in a of Figure 10 b studied, as compared to wild-type mouse, electromagnetic wave is white muscle fast type gene in a transgenic mouse (Aldoa, Pvalb, Tnnf3, Tnnl2, Tnnc2) is a significant amount difference cannot be expression, red muscle slow type electromagnetic wave is affecting gene expression amount increases (Myoglobin, Tnnt1, Tnnl1, Tnnc1) are both mRNA has been confirmed.

[109]

[110]

In the embodiment 3 - 4 - 2. Fat accumulation pattern and related gene expression pattern checking

[111]

In addition, in order to identify the function of crystal quality MYH3 gene expressed in a transgenic plant, a transgenic mouse work grudge number through said in the embodiment 3 - 2 of fat accumulation pattern and related gene patterns of expression of visit from the police.

[112]

First, fat accumulation pattern form on tissue in order to identify whether numbers have, to this end H&E (Hematoxylin and eosin) conducting dyeing. Wild-type mouse (WT) and transgenic mouse (TG) using paraffin (Paraffin embedding) of muscular tissues after m hemp cloth [ting, a thickness of tissue fragment 4 micro m-gate. (Xylene) number using a stand-alone after xylene and paraffin, 100%, 95%, 75%, 50% alcohol in this order after the dehydration, washing water was flowing 5 minutes. Then, the [hey e [thok it was recorded Myyer's 1 minutes 20 minutes after processing (hematoxylin) solution flowing water washed and, it came to 1 minutes (esoin) after processing to carry out dehydration and clearing (clearing) have, on microscope after tissue dyeing state therefrom.

[113]

In addition, in order to identify patterns of expression of muscle tissue fat accumulation gene transgenic mouse, said in the embodiment 2 - 3 according to method qRT-a PCR is conducting. Selecting inner primer represented was listed in table 4.

[114]

GeneClassificationDirectionBio-sequence listing (5 '→3')
CD36Sequence number 53ForwardAATGGCACAGACGCAGCCT
The sequence numbers 54ReverseGGTTGTCTGGATTCTGGA
LPLSeq ID no 55ForwardGTACCTGAAGACTCGCTCTC
The sequence numbers 56ReverseAGGGTGAAGGGAATGTTCTC
Fabp4Sequence number 57ForwardGATGCCTTTGTGGGAACCTG
The sequence numbers 58ReverseTCCTGTCGTCTGCGGTGATT
FtoSequence number 59ForwardGTCAGAGAGAAGGCCAATGA
Sequence number 60ReverseTAGCAGTCTCCCTGGTGAAG
Pgc1 αSequence number 61ForwardCCCTGCCATTGTTAAGACC
Sequence number 62ReverseTGCTGCTGTTCCTGTTTTC
AdiponectinThe sequence numbers 63ForwardAATGGCACACCAGGCCGTGAT
Seq ID no 64ReverseTCTCCAGGCTCTCCTTTCCTG

[115]

[116]

As a result, studied in of Figure 10 c and d, as compared to wild-type mouse, intervals between which results in its purification of stem cell in a transgenic mouse, which deposited fat therebetween, in addition has been confirmed that the expression of fat differentiation gene significantly increases.

[117]

The result of said, red near related gene MYH3 gene is expressed in the hepatitis c viral replicon which improve gene as well as intramuscular fat formation causes about his car.

[118]

[119]

In the embodiment 4. MYH3 gene genotype analysis

[120]

MYH3 gene for analyzing the genotype, as starting point (transcription start site; TSS) from porcine MYH3 gene transcription of 5 '- UTR 3 kb, and from a stop codon (stop codon) 3' - UTR 1 kb bio-sequence listing was to decrypt.

[121]

As a result, in Figure 11 the studied, in meat QTN MYH3 gene affecting (i. E. , MYH3 provided _ 1805 provided 1810delGGACTG) has been confirmed (red point display). In addition, race number making [lay pig (KNP) on land (LANDLACE) between base mutation being regulated, this exon (exon) 3 (ATG) codon disclosure from the 5' - UTR located has been confirmed. When the number of the regions to identify defective becoming, - 1810 bp - 1805 bp making when, this has been confirmed by muscle style-modulators (myogenesis regulatory factor; MRF) binding sites.

[122]

[123]

In the embodiment 5. MYH3 gene of porcine password through the varietal determine genotype

[124]

Base mutation is present between said in the embodiment 3 MYH3 gene number making through land race and the identifying, using said base mutation was determines quality of Pig.

[125]

Specifically, primer (forward: 5 '- TGG TCT TTC CTA ATT GGT GAC AT-a 3' (seq ID no 65), reverse: 5 '- AGT TTT GAG CAA GGC TTT TGT T-a 3' (seq ID no 66)) was amplified using a base mutation of said portion. Pig DNA isolated from blood of 100 ng/micro l IIS facia, 10 × reaction buffer, 20 mm dNTP, 200 mm of each forward and reverse primer, 1. 5 Units Taq DNA polymerase (TaKaRa, Japan) 25 micro l capacity by adding sterile deionized water to conducting PCR reaction. PCR amplification is performed using PTC-a 200 (MJ Research, USA) have total 30 cycle, 60 °C the annealing temperature of the primer in the matter. Amplification product is 2% agarose gel containing EtBr (ethidium bromide) after electrophoresis on bitter cold, UV therefrom whether in gene amplification.

[126]

Then, cause bio-sequence listing of the variation in said base using HpyCH4IV number hanhyo small 'A▼CGT' his cutting portion. Said PCR amplification product (HpyCH4IV) have a number hanhyo small cutting using a, number hanhyo small reaction conditions according to the instruction of a provider of PCR product of 3 micro l 10X buffer 1 PCR on micro l, hanhyo small number 0. 3 Micro l, DW 5. 7 Micro l stored at 37 °C by mixing in his response. On 2% agarose gel containing EtBr (ethidium bromide) by electrophoretic, number by number making hanhyo small land race and cutting aspect [lay pig MYH3 gene has been confirmed.

[127]

As a result, in Figure 12 the studied, poor quality land race cut swine (LANDLACE) gene have not received in 250 bp band is also used for presented (1/1; non-truncated), [lay pig number making chopped meat is excellent (KNP) gene has been confirmed that the two band as indicated by 77 bp and 167 (2/2; truncated). In addition, the land race number has been confirmed that the two band as indicated by 250 and 167 bp making fruit varieties (1/2; truncated).

[128]

The result of said, MYH3 gene traits of Pig meat in determining the possibility of foreign of Pigs and health by porcine it may be as well as, through Pig has been confirmed that the quality can be determined.

[129]

[130]

Description of or more from, the present invention of the present invention is provided to the one skilled technical idea or essential characteristics thereof without changing other specific embodiment can form can be understand are disclosed. In this regard, in the embodiment described above are exemplary in all of which must understand not definitive provided therein. The meaning of the description of the present invention carry patent said range rather than if all of the form of the present invention derived from equivalent general outline and range and method for changing or modified range should interpreted.



[131]

The present invention relates to a transformant comprising an MYH3 gene and a use thereof, and more particularly, to a method for enhancing meat quality of a transformant comprising a step of transforming a recombinant vector including an MYH3 gene comprising a nucleotide sequence of SEQ ID NO: 1 to a fertilized egg of a subject other than a human being. Since the transformant transformed with the recombinant vector containing the MYH3 gene of the present invention has an effect of enhancing redness as compared with a wild type, the vector can be used for enhancing the meat quality of the transformant.



The sequence numbers 1 consisting of a number of an individual human bio-sequence listing including MYH3 gene transformed embryo to the recombinant vector including, method for improving red meat or of the transformant.

According to Claim 1, wherein said individual is a mammal, method.

According to Claim 2, wherein said mammal is mouse, method.

Back number