Набор для выявления антител классов M и G к нуклеокапсиду (Nc) и рецепторсвязывающему домену спайк белка коронавируса SARS-CoV-2

Изобретение относится к области биотехнологии. Описан набор для выявления антител классов М и G к нуклеокапсиду (Nc) и рецепторсвязывающему домену спайк белка коронавируса SARS-CoV-2, в образце биологической жидкости человека. Набор содержит впитывающую мембрану для нанесения образца и мембрану для нанесения конъюгата с нанесенными и высушенными конъюгатами рекомбинантного антигена коронавируса SARS-CoV-2, где мембрану для образца пропитывают буферным раствором, представляющим собой водный раствор, приготовленный из компонентов в следующем их соотношении, мас. %: трис-оксиметил аминометана 1%, трис-оксиметил аминометан гидрохлорида 0,1%, казеинат натриевая соль 1%, поливинилпирролидон 0,1%, азид натрия 2%, твин-20 1%, мышиные антитела к эритроцитам человека 0,02%, мембрану для конъюгата пропитывают водным раствором, приготовленным из компонентов в следующем их соотношении, мас. %: натрий гидрофосфат безводный 1,5%, поливиниловый спирт 0,5%, альбумин бычий сывороточный 1%, тритон-Х-100 0,1% ...

Способ одновременного определения генотипа человека по полиморфизмам в трех генах, участвующих в регуляции поведения

Изобретение относится к области молекулярной генетики. Сущность способа заключается в проведении анализа с помощью мультиплексной полимеразной цепной реакции с последующей детекцией размера фрагментов методом капиллярного электрофореза для 4 полиморфных маркеров 3 генов. Изобретение позволяет одновременно установить генотипы по нескольким генам и провести детекцию результатов в автоматизированном режиме. 2 ил.

РЕАКЦИОННЫЙ СОСУД И РЕАКЦИОННОЕ УСТРОЙСТВО, ПРЕДНАЗНАЧЕННЫЕ ДЛЯ ПРОВЕДЕНИЯ ПОЛИМЕРАЗНОЙ ЦЕПНОЙ РЕАКЦИИ

Группа изобретений относится к области биотехнологии. Предложен реакционный сосуд и реакционное устройство для проведения полимеразной цепной реакции. Реакционный сосуд содержит подложку, канал для перемещения образца, отверстие для введения образца внутрь канала, пару воздушных коммуникационных отверстий на концах канала и область термического цикла между парой воздушных коммуникационных отверстий. Причем канал содержит множество каналов ответвления между областью термического цикла и воздушным коммуникационным отверстием, а область термического цикла содержит первую температурную область и вторую температурную область. Реакционное устройство содержит указанный реакционный сосуд, температурный регулятор и систему подачи жидкости. Изобретения обеспечивают надлежащее перемещение образца для проведения устойчивого ПЦР. 2 н. и 2 з.п. ф-лы, 7 ил.

СПОСОБ, КОМПОЗИЦИЯ И НАБОР ДЛЯ СТАБИЛИЗАЦИИ ДЕЗОКСИРИБОНУКЛЕИНОВЫХ КИСЛОТ В БИОЛОГИЧЕСКИХ ОБРАЗЦАХ

Группа изобретений относится к биотехнологии, в частности к области стабилизации дезоксирибонуклеиновой кислоты (ДНК) человека и микроорганизмов, присутствующей в сложных биологических образцах, таких как фекалии. Предложены способ, водная композиция и набор для стабилизации ДНК, содержащейся в фекалиях или образце, загрязненном фекалиями, при температуре окружающей среды. Указанный биологический образец приводят в контакт с водной композицией, содержащей хелатирующее средство, выбранное из этилендиаминтетрауксусной кислоты (EDTA) или 1,2-циклогександиаминтетрауксусной кислоты (CDTA), в концентрации от приблизительно 150 мМ до приблизительно 600 мМ и имеющей рН от 9,5 до 11,5. Полученную смесь гомогенизируют и хранят при температуре окружающей среды. Группа изобретений обеспечивает быстрый и эффективный захват и стабилизацию ДНК и «мгновенную фиксацию» профилей суммарной ДНК в биологических образцах при температуре окружающей среды в течение длительных периодов времени. 3 н. и 47 з.п. ф-лы ...

КОМПОЗИЦИИ И СПОСОБЫ ХИМИЧЕСКОГО РАСЩЕПЛЕНИЯ И СНЯТИЯ ЗАЩИТЫ ДЛЯ СВЯЗАННЫХ С ПОВЕРХНОСТЬЮ ОЛИГОНУКЛЕОТИДОВ

Изобретение относится к области биотехнологии. Описана группа изобретений, включающая твердую подложку, пригодную для химической лианеризации двухцепочечных полинуклеотидов, и способ линеаризации иммобилизованных двухцепочечных полинуклеотидов. В одном из вариантов реализации твердая подложка содержит двухцепочечные полинуклеотиды, где каждый двухцепочечный полинуклеотид содержит первую цепь и вторую иммобилизованную на ней цепь, причем каждая первая цепь содержит первый сайт расщепления, способный подвергаться химическому расщеплению комплексом палладия (0) или комплексом никеля (0), и где первая цепь и вторая цепь иммобилизованы на твердой подложке своими 5’-концами. Изобретение расширяет арсенал средств лианеризации двухцепочечных олигонуклеотидов. 2 н. и 9 з.п. ф-лы, 8 ил., 2 табл., 11 пр.

Способ амплификации нуклеиновых кислот тяжелой и легкой цепи человеческих иммуноглобулинов для создания рекомбинантных антител, композиции праймеров (варианты)

Изобретение относится к области биотехнологии, в частности к способу амплификации нуклеиновых кислот тяжелой и легкой цепи человеческих иммуноглобулинов. Изобретение позволяет снижать вероятность ложноотрицательной амплификации, повышая вероятность успешной амплификации кДНК антител с редко встречающимися аллелями V генных сегментов. 16 ил., 6 пр.

ТАГМЕНТАЦИЯ С ПРИМЕНЕНИЕМ ИММОБИЛИЗОВАННЫХ ТРАНСПОСОМ С ЛИНКЕРАМИ

Изобретение относится к области биотехнологии. Описана группа изобретений, включающая комплекс транспосомы для тагментации, композицию для тагментации, модифицированный олигонуклеотид для тагментации, способ получения библиотеки меченых фрагментов нуклеиновых кислот из двухцепочечной целевой нуклеиновой кислоты, способ получения связанного с твердой подложкой комплекса транспосомы, способ получения образца для секвенирования. В одном из вариантов реализации комплекс транспосомы для тагментации содержит транспозазу, первый и второй транспозоны ДНК и расщепляемый линкер. Изобретение расширяет арсенал средств для тагментации. 6 н. и 29 з.п. ф-лы, 12 ил., 7 табл., 9 пр.

Способ прогнозирования риска развития первичной открытоугольной глаукомы по данным о полиморфных вариантах гена лизилоксидазоподобного фермента 1

Изобретение относится к медицине, а именно к медицинской диагностике, и может быть использовано для прогнозирования риска развития первичной открытоугольной глаукомы (ПОУГ) у индивидуумов русской национальности, родившихся и проживающих в Центральном регионе России. Осуществляют забор периферической венозной крови, выделение ДНК и анализ гена LOXL1. При выявлении гаплотипа GG гаплоблока rs4886776 и rs893818 гена LOXL1 прогнозируют высокий риск развития ПОУГ. Способ обеспечивает получение новых критериев оценки риска развития ПОУГ у неродственных индивидуумов русской национальности, родившихся и проживающих в Центральном регионе России, на основе данных о полиморфизмах rs4886776 и rs893818 гена LOXL1. 2 ил., 4 пр.

Способ прогнозирования риска развития первичной открытоугольной глаукомы с использованием данных о полиморфизме гена CDKN2B-AS1

Изобретение относится к области медицинской диагностики и предназначено для прогнозирования риска развития первичной открытоугольной глаукомы (ПОУГ) у индивидуумов русской национальности, родившихся и проживающих в Центральном регионе России. Осуществляют забор венозной крови, выделение ДНК из периферической венозной крови, анализ гена CDKN2-AS1. В случае выявления гаплотипа АG гаплоблока rs1063192 и rs7865618 гена CDKN2-AS1 прогнозируют высокий риск развития ПОУГ. Изобретение обеспечивает получение новых критериев оценки риска развития ПОУГ у неродственных индивидуумов русской национальности, родившихся и проживающих в Центральном регионе России. 2 ил., 4 пр.

Способ прогнозирования риска развития H. pylori-позитивной язвенной болезни двенадцатиперстной кишки с использованием данных о полиморфизме гена ММР-9

Изобретение относится к медицине, а именно к медицинской диагностике, и может быть использовано для прогнозирования риска развития H. pylori–позитивной язвенной болезни двенадцатиперстной кишки у неродственных русских индивидуумов, уроженцев Центрально-Черноземного региона РФ. Осуществляют забор венозной крови, выделение ДНК из периферической венозной крови и анализ полиморфных локусов rs17576-rs3787268-rs2250889-rs17577 гена ММР-9. Высокий риск развития H. pylori–позитивной язвенной болезни двенадцатиперстной кишки прогнозируют при выявлении гаплотипа GACG полиморфных локусов rs17576-rs3787268-rs2250889-rs17577 гена ММР-9. Способ обеспечивает получение новых критериев оценки риска развития H. pylori-позитивной язвенной болезни двенадцатиперстной кишки у индивидуумов русской национальности, уроженцев Центрально-Черноземного региона РФ, на основе данных о полиморфных локусах rs17576-rs3787268-rs2250889-rs17577 гена ММР-9. 4 ил., 4 пр.

Способ прогнозирования риска развития язвенной болезни двенадцатиперстной кишки на основе молекулярно-генетического тестирования

Изобретение относится к медицине, а именно к медицинской диагностике, и может быть использовано для прогнозирования риска развития язвенной болезни двенадцатиперстной кишки у неродственных русских индивидуумов, уроженцев Центрально-Черноземного региона РФ. Осуществляют забор венозной крови, выделение ДНК из периферической венозной крови и анализ полиморфных локусов rs17576-rs3787268-rs2250889 гена ММР-9. Высокий риск развития язвенной болезни двенадцатиперстной кишки прогнозируют при выявлении гаплотипа GGC полиморфных локусов rs17576-rs3787268-rs2250889 гена ММР-9. Способ обеспечивает получение новых критериев оценки риска развития язвенной болезни двенадцатиперстной кишки у индивидуумов русской национальности, уроженцев Центрально-Черноземного региона РФ, на основе данных о полиморфных локусах rs17576-rs3787268-rs2250889 гена ММР-9. 3 ил., 4 пр.

Тест-система и способ выявления делеций длинного плеча 6 хромосомы

Изобретение относится к набору олигонуклеотидных праймеров для специфической амплификации двадцати микросателлитных локусов длинного плеча 6 хромосомы человека (6q), который может быть использован в тест-системе для определения делеций длинного плеча 6 хромосомы (6q) методом мультиплексной полимеразной цепной реакции (ПЦР), а также в способе выявления пациентов с риском неблагоприятного течения фолликулярной лимфомы по наличию значимых делеций длинного плеча 6 хромосомы (6q) с помощью вышеупомянутой тест-системы. Наличие делеций региона 6q в случае гетерозиготного наследования на основании отсутствия пиков одного из аллелей или уменьшения интенсивности его флуоресценции по отношению к пику второго аллеля соответствующего микросателлитного локуса в опухолевой ткани при сравнении с контрольным образцом позволяет выделять группу пациентов с риском неблагоприятного течения фолликулярной лимфомы. 3 н.п. ф-лы, 6 ил., 1 табл., 4 пр.

Способ прогнозирования риска развития преэклампсии на основе генетического тестирования

Изобретение относится к области медицины, в частности к медицинской диагностике, и предназначено для прогнозирования риска развития преэклампсии (ПЭ). У неродственных русских индивидуумов, уроженок Центрально-Черноземного региона РФ, выделяют ДНК из периферической венозной крови. Проводят анализ полиморфизмов гена PPP1R12C, дифференциально экспрессирующегося в плаценте. Повышенный риск развития ПЭ прогнозирует выявление гаплотипа СA гаплоблока rs2532058-rs66707428 гена PPP1R12C. Изобретение обеспечивает эффективный способ прогнозирования риска развития ПЭ у беременных русской национальности, уроженок Центрально-Черноземного региона РФ. 1 табл., 4 пр.

Способ оценки риска образования анти-HLA антител при трансфузиях компонентов крови

Изобретение относится к медицине, а именно к лабораторной диагностике, и может быть использовано для оценки риска образования анти-HLA антител при трансфузиях компонентов крови. Осуществляют комплексное исследование аллелей генов HLA локусов DRB1, DQA1, DQB1 у реципиентов. При выявлении в генотипах реципиентов гаплотипа HLA-DRB1*04-DQA1*03:01-DQB1*03:02 оценивают высокий риск образования анти-HLA антител. При выявлении в генотипах реципиентов HLA-гаплотипа DRB1*16-DQA1*01:02-DQB1*05:02 оценивают низкий риск образования анти-HLA антител. Способ обеспечивает эффективную оценку риска образования анти-HLA антител при трансфузиях компонентов крови за счет выявления предрасполагающих гаплотипов HLA-DR и DQ-генов у реципиентов. 1 табл., 2 пр.

Способ генотипирования полиморфного локуса rs117245733 (G>A) гена LOC124903162 у человека методом ПЦР в режиме «реального времени» с применением аллель-специфических флуоресцентных зондов

Изобретение относится к области биотехнологии, в частности к способу генотипирования полиморфного локуса rs117245733 (G>A) гена LOC124903162 у человека. Указанный способ осуществляют методом ПЦР в режиме «реального времени», причем способ включает идентификацию аллельных вариантов rs117245733 (G>A) гена LOC124903162 с использованием прямого и обратного праймеров rs117245733, характеризующихся последовательностями SEQ ID NO: 1 и SEQ ID NO: 2, соответственно, а также rs117245733-G-аллель-специфичного и rs117245733-A-аллель-специфичного флуоресцентно-меченых зондов с последовательностями SEQ ID NO: 3 и SEQ ID NO: 4, соответственно. Изобретение обеспечивает простой в исполнении и экономически целесообразный способ генотипирования однонуклеотидного полиморфизма rs117245733 (G>A), локализованного в позиции chr13:40149807 (GRCh38.p14) гена LOC124903162 методом полимеразной цепной реакции в режиме «реального времени». 1 ил.

Способ определения ранних проявлений дорсалгии у детей среднего школьного возраста 11-15 лет, ассоциированной с контаминацией биосред свинцом

Изобретение относится к медицине, а именно к медицинской экологии, гигиенической диагностике, и может быть использовано для определения ранних проявлений дорсалгии у детей среднего школьного возраста 11-15 лет, ассоциированной с контаминацией биосред свинцом. При превышении содержания свинца в крови ребенка в 1,45 и более раз по сравнению с нормой, равной 0,0144±0,001 мг/л, превышении уровня дофамина по сравнению с верхней границей физиологической нормы, равной 44 пг/см3, не менее чем в 1,5 раза и при наличии комбинации генотипа СТ или ТТ гена DRD2 C2137T (rs1800497) и генотипа AG или GG гена MTRR A66G (rs1801394) определяют ранние проявления дорсалгии, ассоциированной с контаминацией биосред свинцом. Способ обеспечивает достоверность определения ранних проявлений дорсопатиис явлениями дорсалгии, ассоциированной с контаминацией биосред свинцом, у детей среднего школьного возраста 11-15 лет за счет одновременного определения токсикологических, лабораторных и генетических показателей. 1 табл ...

Способ прогнозирования прогрессирующей бронхиальной обструкции у пациентов с хронической обструктивной болезнью легких

Изобретение относится к медицине, а именно к пульмонологии, и может быть использовано для прогнозирования прогрессирующей бронхиальной обструкции у пациентов с хронической обструктивной болезнью легких (ХОБЛ). Генотипируют однонуклеотидный полиморфизм rs11562975 гена TRPM8. Измеряют постбронходилатационный объем форсированного выдоха за 1 секунду (ОФВ1б). Определяют частоту обострений ХОБЛ в предшествующий год (ЧО). Выполняют тестирование по опроснику COPD Assessment Test (САТ). Вычисляют значение F по формуле (1): F = -5,20318 + 0,89733 × rs11562975 + 0,05320 × ОФВ1б + 0,67048 × ЧО + 0,15464 × САТ. Рассчитывают вероятность прогрессирующей бронхиальной обструкции по формуле: P = 1 / (1 + е-F), где F – значение функции, вычисленное по формуле (1). При P≥0,71 прогнозируют высокий риск прогрессирующей бронхиальной обструкции. При P<0,71 прогнозируют низкий риск прогрессирования заболевания. Способ обеспечивает возможность прогнозирования прогрессирования бронхиальной обструкции у больных ХОБЛ ...

Способ малоинвазивной диагностики менингиом и опухолей глиального ряда с уточнением степени злокачественности

Изобретение относится к медицине, а именно к молекулярной онкологии, и может быть использовано для малоинвазивной диагностики менингиом и опухолей глиального ряда с уточнением степени злокачественности. Проводят анализ экспрессии микроРНК в образце плазмы. Используют высокоспецифичные праймеры для hsa-miR-21-5p, hsa-miR-342-3p, hsa-miR-3180-3, hsa-let-7c-5p, hsa-miR-190b-5p и cel-miR-39-5p. Вычисляют значения ΔCt hsa-miR-21-5p = Ct hsa-miR-21-5p – Ct cel-miR-39-5p, ΔCt hsa-miR-342-3p = Ct hsa-miR-342-3p – Ct cel-miR-39-5p, ΔCt hsa-miR-3180-3p = Ct hsa-miR-3180-3p – Ct cel-miR-39-5p, ΔCt hsa-let-7c-5p = Ct hsa-let-7c-5p – Ct cel-miR-39-5p, ΔCt hsa-miR-190b-5p = Ct hsa-miR-190b-5p – Ct cel-miR-39-5p, где Ct - номер порогового цикла, после которого достигается повышение сигнала относительно фоновых значений. При значении ΔCt hsa-miR-21-5p ≥ 1.7 устанавливают диагноз менингиома. При значениях ΔCt hsa-miR-21-5p < 1.7, ΔCt hsa-miR-342-3p ≥ 2.9 и ΔCt hsa-miR-3180-3p < 13 устанавливают диагноз ...

Способ прогнозирования риска развития хронической сердечной недостаточности у мужчин с сахарным диабетом 2 типа на основе генотипирования полиморфизма rs4932143 гена ANPEP

Изобретение относится к медицине, а именно к медицинской диагностике, и может быть использовано для прогнозирования риска развития хронической сердечной недостаточности у мужчин с сахарным диабетом 2 типа. Осуществляют забор образца периферической венозной крови и экстракцию ДНК. Проводят анализ полиморфного варианта гена аминопептидазы ANPEP rs4932143 (С>G). В случае выявления генотипов C/G или G/G прогнозируют повышенный риск формирования хронической сердечной недостаточности. При обнаружении генотипа C/С прогнозируют низкий риск. Способ обеспечивает получение новых критериев оценки риска формирования хронической сердечной недостаточности у мужчин Центральной России с сахарным диабетом 2 типа по данным о генетическом полиморфизме rs4932143 (C>G) гена ANPEP. 1 ил., 1 табл., 3 пр.

Способ очистки нуклеиновой кислоты

Изобретение относится к биотехнологии, а именно к композиции, содержащей высококонцентрированный ингибитор альфа-1 протеиназы (A1PI), и способу ее приготовления. Способ предусматривает использование однопроходной фильтрации в тангенциальном потоке. Изобретение эффективно для лечения состояний, связанных с лечением заболеваний, связанных с дефицитом A1PI, или заболеваний, при которых полезным является повышение уровня A1PI. 4 з.п. ф-лы, 2 ил., 6 табл., 5 пр.

СПОСОБ ОПРЕДЕЛЕНИЯ РИСКА ЗЛОКАЧЕСТВЕННОЙ ТРАНСФОРМАЦИИ КЛЕТОК ПРЕДСТАТЕЛЬНОЙ ЖЕЛЕЗЫ

Изобретение относится к медицине, а именно к медицинской диагностике, и может быть использовано для определения риска злокачественной трансформации клеток предстательной железы. Из плазмы крови выделяют простат-специфическую фракцию внеклеточных нановезикул (прВНВ). Проводят полуколичественный анализ концентраций mir-205-5p и mir-375-3р в материале выделенных прВНВ методом обратной транскрипции и полимеразной цепной реакции. Рассчитывают соотношение относительных концентраций mir-205-5p и mir-375-3р по формуле прВНВ-205/375=Ct(205)/Ct(375). При значении показателя прВНВ-205/375<1 определяют риск злокачественной трансформации клеток предстательной железы. При значении прВНВ-205/375>1 определяют отсутствие риска. Способ обеспечивает эффективное определение риска злокачественной трансформации клеток предстательной железы путем полуколичественного анализа mir-205-5p и mir-375-3р в материале прВНВ плазмы. 1 з.п. ф-лы, 3 ил., 1 табл., 3 пр.

СПОСОБ ПРОГНОЗИРОВАНИЯ РАЗВИТИЯ ТЯЖЕЛОГО ТЕЧЕНИЯ ДИСТАЛЬНОЙ НЕЙРОПАТИИ И СИНДРОМА ДИАБЕТИЧЕСКОЙ СТОПЫ У ПАЦИЕНТОВ С САХАРНЫМ ДИАБЕТОМ 1 И 2 ТИПА

Изобретение относится к медицине, а именно к эндокринологии, биохимии и генетике, и может быть использовано для прогнозирования развития тяжелого течения дистальной нейропатии (ДН) и синдрома диабетической стопы (СДС) у пациентов с сахарным диабетом (СД) 1 и 2 типа. Из периферической венозной крови выделяют ДНК. Определяют полиморфизмы -308G/A гена TNFα, G-1082A гена IL10, С-174G гена IL6, IIe105Val гена GSTP, T58C гена SOD2, G1293C(c1/с2) гена CYP2E. При выявлении по меньшей мере одного мутантного генотипа, выбранного из GG -308G/A гена TNFα, АА G-1082A гена IL10, GG С-174G гена IL6, GG IIe105Val гена GSTP, TT T58C гена SOD2 и CC G-1293C(c1/с2) гена CYP2E прогнозируют высокий риск развития тяжелого течения ДН и СДС у пациентов с СД 1 и 2 типа, а при отсутствии комбинации указанных выше мутантных генотипов прогнозируют низкий риск. Способ обеспечивает прогноз развития тяжелого течения ДН и СДС у пациентов с СД 1 и 2 типа за счет выявления мутантных генотипов полиморфизмов -308G/A гена TNFα ...

Способ прогнозирования развития остеопоретических переломов поясничного отдела позвоночника

Изобретение относится к медицине, а именно к внутренним болезням, и может быть использовано для прогнозирования риска развития остеопоретических переломов поясничного отдела позвоночника у мужчин старше 45 лет, проживающих в Волго-Уральском регионе. Из лимфоцитов периферической венозной крови выделяют ДНК. Проводят генотипирование полиморфных вариантов rs3102734 и rs2073617 гена OPG и rs1712 гена FBXO5 методом полимеразной цепной реакции. Измеряют уровень минеральной плотности костной ткани в поясничном отделе позвоночника. При выявлении полиморфных вариантов Т rs3102734, Т rs2073617 гена OPG, Т rs1712 гена FBXO5 и уровня минеральной плотности костной ткани в поясничном отделе позвоночника <2,5 согласно Т-критерию прогнозируют риск развития остеопоретических переломов поясничного отдела позвоночника. Способ обеспечивает повышение точности прогноза риска развития остеопоретических переломов поясничного отдела позвоночника за счет генотипирования полиморфных вариантов генов OPG и FBXO5 и ...

Способ прогнозирования риска развития грыжи передней брюшной стенки

Изобретение относится к медицине, а именно к хирургии, и может быть использовано для прогнозирования риска развития грыжи передней брюшной стенки. Определяют индекс аутофлюоресценции кожи (ИАФ) с помощью анализатора конечных продуктов гликирования. Определяют соотношение коллагена I и III типа (CK) в гистологических препаратах кожи пациента. Генотипируют полиморфизм гена rs2009262 EFEMP1 в венозной крови методом ПЦР в режиме реального времени. Вычисляют величину риска развития грыжи Р по формуле Р=1/(1+е-y), где е - математическая константа, равная 2,72, y=-5,419+3,715*ИАФ-0,685*CK-1,732*EFEMP1. При значении Р выше 71 % прогнозируют высокий риск развития грыжи передней брюшной стенки. Способ обеспечивает эффективное прогнозирование риска развития грыжи передней брюшной стенки за счет расчета вероятности наступления события с помощью бинарной логистической регрессии независимых переменных. 2 табл., 3 пр.

СПОСОБ ПРОГНОЗИРОВАНИЯ РИСКА РАЗВИТИЯ ОСЛОЖНЕННОЙ ЯЗВЕННОЙ БОЛЕЗНИ ДВЕНАДЦАТИПЕРСТНОЙ КИШКИ НА ОСНОВЕ ОПРЕДЕЛЕНИЯ УРОВНЯ ЭКСПРЕССИИ МИКРОРНК-155

Изобретение относится к медицине, а именно к медицинской диагностике, и может быть использовано для прогнозирования риска развития осложненной язвенной болезни двенадцатиперстной кишки. Производят биопсию двенадцатиперстной кишки с забором по одному биоптату на латеральной и медиальной стенках луковицы. Определяют уровень экспрессии микроРНК-155, вычисляют среднее арифметическое по результатам трех повторов. При значении 2.442±0.096 прогнозируют высокий риск развития осложненной язвенной болезни двенадцатиперстной кишки. Способ обеспечивает повышение точности прогнозирования высокого риска развития осложненной язвенной болезни двенадцатиперстной кишки за счет определения уровня экспрессии микроРНК-155 в биоптатах двенадцатиперстной кишки. 3 ил., 5 пр.

Способ генотипирования полиморфного локуса rs11024032 (CT) гена C11orf58 у человека методом ПЦР в режиме реального времени с применением аллель-специфических флуоресцентных зондов

Изобретение относится к области биотехнологии, в частности к способу генотипирования полиморфного локуса rs11024032 (C>T) гена C11orf58 у человека. Указанный способ осуществляется методом ПЦР в режиме реального времени с применением аллель-специфических флуоресцентных зондов. Идентификацию аллельных вариантов rs11024032 (C>T) гена C11orf58 осуществляют с использованием прямого и обратного праймеров с последовательностями SEQ ID NO: 1 и 2 соответственно, а также rs11024032-C-аллель-специфичного и rs11024032-T-аллель-специфичного флуоресцентно-меченых зондов с последовательностями SEQ ID NO: 3 и 4 соответственно. Настоящее изобретение обеспечивает простой в исполнении и экономически целесообразный способ генотипирования однонуклеотидного полиморфизма rs11024032 (С>T), локализованного в позиции 11:16751953 (GRCh38) гена C11orf58 (Gene ID: 10944). 1 ил.

Способ прогнозирования риска развития артериальной гипертензии у женщин с использованием молекулярно-генетических данных

Изобретение относится к медицине, а именно к кардиологии, биотехнологии и медицинской генетике, и может быть использовано для прогнозирования риска развития артериальной гипертензии у женщин. Из периферической венозной крови выделяют ДНК. Проводят анализ полиморфных локусов CERS5, HFE, TBX2 и RGL3. При выявлении комбинации генотипов rs7302981 AA CERS5 × rs1799945 CC HFE × rs8068318 CC TBX2 × rs167479 TG RGL3 прогнозируют высокий риск развития артериальной гипертензии у женщин. Способ обеспечивает получение новых критериев оценки риска развития артериальной гипертензии у женщин русской национальности, являющихся уроженками Центрально-Черноземного региона РФ и не имеющих родства между собой, на основе данных о полиморфных локусах CERS5, HFE, TBX2 и RGL3. 1 табл., 4 пр.

Способ прогнозирования развития детского ожирения в Республике Башкортостан

Изобретение относится к медицине, а именно к педиатрии, и может быть использовано для прогнозирования развития ожирения у детей, проживающих в Республике Башкортостан. Из лимфоцитов периферической венозной крови выделяют ДНК. Проводят амплификацию локуса rs3803300 гена протеинкиназы 1 AKT1 и локуса rs279845 гена рецептора гамма-аминомасляной кислоты GABRA2. При выявлении генотипов AG или AA полиморфного локуса rs3803300 гена AKT1 и генотипов АТ или АА полиморфного локуса rs279845 гена GABRA2 прогнозируют риск развития ожирения у ребенка. Способ обеспечивает повышение точности прогноза за счет выявления факторов предрасположенности к развитию заболевания. 2 табл., 5 пр.

Способ прогнозирования риска развития сахарного диабета 2 типа у жителей Центральной России на основе генотипирования полиморфизма rs11073891 гена ANPEP

Изобретение относится к медицине, а именно к медицинской диагностике, и может быть использовано для прогнозирования риска развития сахарного диабета 2 типа у жителей Центральной России. Осуществляют забор образца периферической венозной крови и экстракцию ДНК. Проводят анализ полиморфного варианта гена аминопептидазы ANPEP rs11073891 (А>С). В случае выявления генотипа rs11073891-А/А прогнозируют повышенный риск развития сахарного диабета 2 типа. При обнаружении генотипов rs11073891-А/С или rs11073891-С/С прогнозируют низкий риск развития сахарного диабета 2 типа. Способ обеспечивает получение новых критериев оценки риска развития сахарного диабета 2 типа у жителей Центральной России по данным о генетическом полиморфизме rs11073891 (A>C). 1 ил., 1 табл., 3 пр.

Тест-система для обнаружения генома вируса парагриппа 3 типа у крупного рогатого скота с помощью мультиплексной полимеразной цепной реакции с флуоресцентной детекцией в режиме реального времени

Изобретение относится к биотехнологии, а именно к средствам диагностики вируса парагриппа 3 типа у животных. Предлагается тест-система для обнаружения генома возбудителя коронавирусной инфекции у животных с помощью мультиплексной полимеразной цепной реакции с флуоресцентной детекцией в режиме реального времени. Тест-система включает буфер для проведения полимеразной цепной реакции, праймеры и флуоресцентные зонды, специфичные для коронавируса А и для внутреннего контрольного образца, смесь ферментов из ДНК полимеразы с антителами, ингибирующими активность фермента, TAQ POLYMERASE и обратной транскриптазы MMLV REVERSE TRANSCRIPTASE, буфер для разведения РНК в виде деионизованной воды, внутренний контрольный образец, отрицательный контрольный образец, положительный контрольный образец, для внутреннего контрольного образца - суспензию бактериофага MS2, а для положительного контрольного образца используют смесь рекомбинантных плазмидных ДНК, содержащих фрагмент генома вируса BPI 3 и фрагмент ...

Набор синтетических олигодезоксирибонуклеотидов и способ количественной оценки вирусной нагрузки SARS-CoV-2 в тканях различных органов методом количественной полимеразной цепной реакции в реальном времени

Изобретение относится к медицине и молекулярной биологии, а именно к методам молекулярно-генетического выявления РНК коронавируса SARS-CoV-2, а также количественной оценки вирусной нагрузки в аутопсийном, биопсийном и операционном материале при патологоанатомических исследованиях методом количественной полимеразной цепной реакции в реальном времени (кПЦР РВ). Описан набор праймеров и зондов для идентификации кДНК коронавируса. Также описан способ измерения вирусной нагрузки SARS-CoV-2 в тканях различных органов методом количественной полимеразной цепной реакции в реальном времени, который основан на выявлении числа копий кДНК SARS-CoV-2 относительно 100 копий кДНК ABL1. Технический результат - повышение достоверности количественной оценки. Серийные разведения плазмидной ДНК pGEM®)-T Easy, содержащие участки кДНК SARS-CoV-2 и ABL1, позволяют выявить с высокой корреляцией линейных разведений, равной R2≥0,99. Разработанные олигонуклеотидные праймеры и флуоресцентно-меченые зонды могут быть ...

СПОСОБ ПРОГНОЗИРОВАНИЯ РАЗВИТИЯ МЕТАСТАЗОВ В ПЕЧЕНИ У БОЛЬНЫХ РАКОМ ТОЛСТОЙ КИШКИ

Изобретение относится к области медицины, в частности к молекулярной онкологии, и предназначено для прогнозирования развития метастазов в печени у больных раком толстой кишки. Осуществляют выделение суммарной РНК из тканевых проб с помощью метода гуанидин-тиоционат-фенол-хлороформной экстракции. Проводят амплификацию в режиме реального времени генов MAGEB1, SSX2, SCP1, GAPDH и GUSB. Рассчитывают относительную экспрессию генетических локусов и среднее геометрическое референсных генов GAPDH и GUSB. Вычисляют коэффициент экспрессии генов - К, К, К. При значениях К>2,2±0,5, К>2,2±0,4 и К<2,7±0,6 прогнозируют отсутствие метастазов. При значениях К<0,4±0,2, К<0,7±0,3 и К>8,5±0,8 прогнозируют развитие метастазов. При значениях между указанными интервалами считают результат не определенным. Изобретение обеспечивает создание нового, простого в исполнении, не дорогостоящего и более точного способа прогнозирования развития метастазов в печени у больных раком толстой кишки. 1 табл., 2 пр.

Способ прогнозирования риска развития первичной открытоугольной глаукомы без синдрома эксфолиации с использованием данных о полиморфизме генов матриксных металлопротеиназ

Изобретение относится к области медицины. Предложен способ прогнозирования риска развития первичной открытоугольной глаукомы (ПОУГ) без эксфолиативного синдрома у уроженцев Центрально-Черноземного региона РФ русской национальности. Из периферической венозной крови выделяют ДНК. Проводят анализ генетических маркеров матриксных металлопротеиназ. При выявлении гаплотипа GGG по локусу rs17576, и rs3787268, и rs2250889 гена ММР9 прогнозируют высокий риск развития ПОУГ без эксфолиативного синдрома. Изобретение обеспечивает получение новых критериев оценки риска развития ПОУГ без эксфолиативного синдрома у индивидуумов русской национальности, уроженцев Центрально-Черноземного региона РФ из Белгородской, Курской, Воронежской, Тамбовской и Липецкой областей. 3 ил., 2 пр.

НАБОР СИНТЕТИЧЕСКИХ ОЛИГОНУКЛЕОТИДОВ ДЛЯ ВЫЯВЛЕНИЯ РНК КОРОНАВИРУСА

Изобретение относится к медицине и биологии. Описан набор синтетических олигонуклеотидов для выявления РНК коронавируса SARS-CoV-2 включает в себя пары праймеров: 5'-CCGGGTGTTCTTTATCAGGA-3' и 5'-GAGGGAAAACTTCTTGGGTG-3'; 5'-ACGTCTATCAGTTACGTGCC-3' и 5'-CCCCAAAATCAGCGAAATGC-3''. Из пары выбранных праймеров один олигонуклеотид может иметь флуоресцентную метку. Набор синтетических олигонуклеотидов для выявления РНК коронавируса SARS-CoV-2 может дополнительно содержать флуоресцентно меченный олигонуклеотидный зонд, комплементарный или частично комплементарный нуклеотидной последовательности, фланкированной выбранной парой праймеров. Технический результат изобретения заключается в выявлении SARS-CoV-2 на основе мультиплексной ОТ-ПЦР, позволяющей оценивать в сочетании участки вирусного генома, определяющие инфективность и степень репликации SARS-CoV-2. 2 з.п. ф-лы, 6 пр.

Способ прогнозирования риска развития 3 степени злокачественности опухолевых клеток при раке молочной железы

Изобретение относится к медицине, а именно к клинической онкологии, медицинской генетике и молекулярной диагностике, и может быть использовано для прогнозирования риска развития 3 степени злокачественности опухолевых клеток при раке молочной железы. Из периферической венозной крови выделяют ДНК. Проводят анализ генетических маркеров гена ММР-9. При выявлении гаплотипа CTAACG полиморфных локусов rs3918242-rs3918249-rs17576-rs3787268-rs2250889-rs17577 гена ММР-9 прогнозируют высокий риск развития 3 степени злокачественности опухолевых клеток при раке молочной железы. Способ обеспечивает получение новых критериев оценки риска развития 3 степени злокачественности опухолевых клеток при раке молочной железы у женщин русской национальности, уроженок Центрально-Черноземного региона РФ, на основе данных о полиморфных локусах rs3918242-rs3918249-rs17576-rs3787268-rs2250889-rs17577 гена ММР-9. 6 ил., 4 пр.

Способ прогнозирования риска развития язвенной болезни желудка и двенадцатиперстной кишки у мужчин на основе молекулярно-генетического тестирования

Изобретение относится к медицине, а именно к медицинской диагностике, и может быть использовано для прогнозирования риска развития язвенной болезни желудка и двенадцатиперстной кишки у мужчин русской национальности. Из лейкоцитов периферической венозной крови выделяют ДНК. Проводят анализ полиморфных локусов rs505922 АВО, rs8176720 ABO и rs6136 SELP. При выявлении комбинации полиморфных локусов rs505922 АВО ТС × rs8176720 АВО СС × rs6136 SELP АС прогнозируют высокий риск развития язвенной болезни желудка и двенадцатиперстной кишки. Способ обеспечивает получение новых критериев оценки риска развития язвенной болезни желудка и двенадцатиперстной кишки у мужчин русской национальности на основе данных о комбинации полиморфных локусов rs505922 АВО ТС × rs8176720 АВО СС × rs6136 SELP АС. 3 ил., 4 пр.

Способ прогнозирования риска развития светлоклеточных почечно-клеточных карцином на основе анализа сочетания полиморфных вариантов генов биогенеза микроРНК

ОСУЩЕСТВЛЯЕМЫЙ IN VITRO СПОСОБ МОНИТОРИНГА ПАТОГЕННОЙ НАГРУЗКИ В ПОПУЛЯЦИИ ЖИВОТНЫХ

СПОСОБ ПРОГНОЗИРОВАНИЯ РИСКА ПРОГРЕССИРОВАНИЯ РАКА МОЛОЧНОЙ ЖЕЛЕЗЫ НА ФОНЕ ТАМОКСИФЕНА С УЧЕТОМ ЭКСПРЕССИОННЫХ ОСОБЕННОСТЕЙ ОПУХОЛИ

Изобретение относится к медицине, а именно к онкологии, и может быть использовано для прогнозирования риска прогрессирования рака молочной железы (РМЖ) на фоне приема тамоксифена с учетом экспрессионных особенностей опухоли. В опухолевой ткани определяют транскрипционную активность гена ESR1, экспрессию белков TGF-βR2, pAkt и процентное содержание субпопуляции pAkt-/TGF-βR2+ клеток. Полученные значения подставляют в формулу расчета значения уравнения логистической регрессии, которое используют для расчета вероятности Р прогрессирования РМЖ. При Р≥0,5 прогнозируют высокий риск прогрессирования РМЖ на фоне приема тамоксифена. При Р<0,5 прогнозируют низкий риск прогрессирования. Способ обеспечивает повышение точности и информативности прогнозирования риска прогрессирования РМЖ на фоне приема тамоксифена за счет использования оригинальной формулы расчета уравнения логистической регрессии и определения вероятности развития прогрессирования РМЖ. 4 табл., 4 пр.

Набор олигонуклеотидных праймеров для выявления ДНК ортопоксвирусов методом изотермической амплификации в режиме реального времени

Изобретение относится к медицинской биотехнологии и вирусологии. Предложен набор олигонуклеотидных праймеров для выявления ДНК ортопоксвирусов, выделенных из образцов, которые содержат 5 праймеров: внешние - O-F3 и O-B3, внутренние O-FIP и O-BIP, петлевой праймер - O-LF, имеющих следующие нуклеотидные последовательности SEQ ID NO: 1-5 соответственно. Изобретение позволяет с помощью родоспецифических праймеров выявлять ортопоксвирусы в образцах нуклеиновых кислот, выделенных из содержимого кожных поражений, или образцов мазков, или образцов цельной венозной крови (ЭДТА), или аутоптатов легких, печени и селезенки человека при проведении диагностических и эпидемиологических исследований методом изотермической амплификации. 9 табл., 7 ил., 5 пр.

Способ генотипирования полиморфного локуса rs648595 (Т>G) гена GCLC у человека методом ПЦР в режиме «реального времени» с применением аллель-специфических флуоресцентных зондов

Изобретение относится к области биотехнологии, в частности к способу генотипирования полиморфного локуса rs648595 (Т>G) гена GCLC у человека. Указанный способ осуществляют методом ПЦР в режиме «реального времени». Идентификацию аллельных вариантов rs7907606 (Т>G) осуществляют с использованием прямого и обратного праймеров rs648595, характеризующихся последовательностями SEQ ID NO: 1 и SEQ ID NO: 2, а также rs648595-T-аллель-специфичного и rs648595-G-аллель-специфичного флуоресцентно-меченых зондов, характеризующихся последовательностями SEQ ID NO: 3 и SEQ ID NO: 4. Изобретение обеспечивает простой в исполнении и экономически целесообразный способ генотипирования однонуклеотидного полиморфизма rs648595 (Т>G), локализованного в позиции chr6:53513571 (GRCh38.p14) гена GCLC. 1 ил.

Способ генотипирования полиморфного локуса rs4279640 (T>С) гена HSF1 у человека методом ПЦР в режиме "реального времени" с применением аллель-специфических флуоресцентных зондов

Изобретение относится к области биотехнологии, в частности к способу генотипирования полиморфного локуса rs4279640 (T>С) гена HSF1 у человека. Способ осуществляется посредством метода полимеразно-цепной реакции в режиме "реального времени" и предусматривает использование прямого и обратного праймеров с последовательностями SEQ ID NO: 1 и 2 соответственно, а также rs4279640-T- и C-аллель-специфичных флуоресцентно-меченых зондов с последовательностями SEQ ID NO: 3 и 4 соответственно. Настоящее изобретение обеспечивает простой в исполнении и экономически целесообразный способ генотипирования однонуклеотидного полиморфизма rs4279640 (T>С). 1 ил.

СПОСОБ ОБНАРУЖЕНИЯ И ОПРЕДЕЛЕНИЯ ДНК С ЗАДАННОЙ ПОСЛЕДОВАТЕЛЬНОСТЬЮ МЕТОДОМ СПЕКТРОСКОПИИ ГИГАНТСКОГО КОМБИНАЦИОННОГО РАССЕЯНИЯ

Способ определения ДНК в биологических жидкостях, который заключается в подготовке наночастиц благородных металлов, выступающих в роли ГКР-усилителя; гибридизации мишени с направленно выбранным ковалентно ГКР-меченным комплементарным олигонуклеотидом; нанесении пробы с исследуемым соединением на поверхность наночастиц жидкой пробы с исследуемым соединением с образованием направленно упорядоченной за счет нековалентных взаимодействий структуры, включающей определяемую ДНК, ГКР-метку и олигонуклеотид; детектировании полученного гибридизированного ГКР-меченного дуплекса методом спектроскопии гигантского комбинационного рассеяния. О качественном и количественном содержании ДНК судят по положению и интенсивности полос на регистрируемых спектрах. Способ применим для определения малых количеств ДНК на фоне большого количества посторонних компонентов анализируемых биологических жидкостей. Технический результат - повышение чувствительности, селективности и экспрессности. 13 з.п. ф-лы, 22 ил., 2 ...

Тест-система и способ для выявления РНК коронавируса SARS-COV-2, вируса-возбудителя коронавирусного заболевания 2019 COVID-19, методом полимеразной цепной реакции в режиме реального времени (Варианты)

Изобретение относится к молекулярной биологии, вирусологии и биотехнологии, в частности к генетической инженерии. Описана тест-система для обнаружения РНК вируса SARS-CoV-2, включающая праймер SBT0017 5'-GCTGGCACAGACTTAGAAGGT-3', праймер SBT0018 5'-AGCAGCGTACAACCAAGCTAA-3', зонд SBT0019 5'-GTTGACAGGCAAACAGCACAAGCAGCTG-3', для положительного контроля специфичные к гену GAPDH праймер SBT0014 5'-TCCAAAATCAAGTGGGGCGA-3', праймер SBT0015 5'-TGATGACCCTTTTGGCTCCC-3', зонд SBT0016 5'-CGTCTTCACCACCATGGAGAAGGCTG-3', или специфичные к гену ACTB праймер SBT0011 5'-CGTCTTCCCCTCCATCGTG-3', праймер SBT0012 5'-AGGGTGAGGATGCCTCTCTT-3', зонд SBT0013 5'-GATGGTGGGCATGGGTCAGAAGGATTC-3'. Также описана тест-система для обнаружения РНК вируса SARS-CoV-2, включающая праймер SBT003 5'-GTTCGCATTCAACCAGGACAG-3', праймер SBT004 5'-ACCTTCTAAGTCTGTGCCAGC-3' и зонд SBT0026 5'- CTGGTGTTTACCAATGTGCTATGAGGCCC-3', для положительного контроля специфичные к гену GAPDH праймер SBT0014 5'-TCCAAAATCAAGTGGGGCGA-3', праймер SBT0015 ...

Способ выявления кДНК коронавируса SARS-CoV-2 с помощью синтетических олигонуклеотидных праймеров в полимеразной цепной реакции

Изобретение относится к биотехнологии. Описан способ выявления кДНК вируса SARS-CoV-2. Использование специфичных праймеров позволяет выявлять генетический материал вируса SARS-CoV-2 в исследуемых образцах методом полимеразной цепной реакции (ПЦР). Одна пара праймеров подобрана к гену orf1ab. Их последовательности: SEQ ID NO: 1-5' cagtctgtaccgtctgcgg 3', SEQ ID NO: 2-5' cagtactagtgcctgtgccg 3'. Длина ампликона составляет 158 п.н. Две пары праймеров подобраны к гену N. Их последовательности и длина ампликонов: SEQ ID NO: 3-5' ggtggaccctcagattcaactgg 3', SEQ ID NO: 4-5' ttttaccgtcaccaccacgaa 3', длина ПЦР-продукта 250 п.н.; SEQ ID NO: 5-5' cgcattggcatggaagtcac 3', SEQ ID NO: 6-5' tgtctctgcggtaaggcttg 3', длина ПЦР-продукта 203 п.н. После проведения ПЦР продукты реакции разделяют в электрофорезе с маркером длины. По наличию и длине ампликонов способ позволяет выявлять и идентифицировать наличие вируса SARS-CoV-2 в биологическом материале. Изобретение может найти применение в медицине при лабораторной ...

СПОСОБ КОЛИЧЕСТВЕННОГО ОПРЕДЕЛЕНИЯ ВИРУСНОГО ИНФИЦИРОВАНИЯ СПЕРМАТОЗОИДОВ

Изобретение относится к области медицины, в частности к вирусологии и репрудоктологии, и предназначено для количественного определения вирусного инфицирования сперматозоидов. Проводят выделение ДНК из образца спермы. Проводят количественную полимеразную цепную реакцию с регистрацией в реальном времени и нормализацию полученных данных с помощью праймеров NOG и BMP4 с получением значения среднего содержания вирусной ДНК на сперматозоид. Определяют долю инфицированных сперматозоидов с помощью электронно-микроскопического исследования сперматозоидов с получением значения доли инфицированных сперматозоидов. Вычисляют вирусную нагрузку на инфицированный сперматозоид L по формуле L=100×N/E. Изобретение обеспечивает упрощение и ускорение подготовки образцов ДНК из образца спермы; упрощение и удешевление процедуры ПЦР; повышение точности количественной оценки вирусной нагрузки; применимость к любому ДНК-содержащему вирусу; количественное определение вирусной нагрузки во всех сперматозоидах вне зависимости ...

Система мониторинга патогенного потенциала энтеробактерий методом полимеразной цепной реакции

Изобретение относится к биотехнологии. Изобретение предназначено для выявления и идентификации в пробах ДНК, выделенных из чистых культур, клинических образцов, проб пищевых продуктов и элюатов, полученных в результате концентрирования из воды, генетических детерминант пяти факторов патогенности бактерий группы кишечной палочки методом ПЦР с помощью набора маркерных детерминант 25 затравочных пар. Преимуществом заявляемого изобретения является выявление маркеров патогенности, что позволяет усовершенствовать технику ПЦР-анализа для диагностики микроорганизмов с выраженным патогенным потенциалом, который определяет возникновение инфекционного заболевания и его тяжесть, а также факторами персистенции, обуславливающими вероятность хронизации процесса и формирование бактерионосительства. Изобретение может иметь применение в эпидемиологических службах для мониторинга эпидемиологической обстановки. 2 н.п. ф-лы, 1 ил., 1 пр.

Набор синтетических олигонуклеотидов для выявления ДНК вируса папилломы человека 52 типа высокого канцерогенного риска в слизистой оболочке цервикального канала

Изобретение относится к области биотехнологии. Изобретение представляет собой набор синтетических олигонуклеотидов для выявления ДНК вируса папилломы человека 52 типа высокого канцерогенного риска следующих последовательностей Seq.N1 и Seq.N2, также использования зонда с флуоресцентной меткой, интенсивность флуоресценции которой свидетельствует о количестве образующегося продукта, Seq.N3: GGCTGCAGTGTGTGCAGTG Seq.N1, AAGCGTAGGCACATAATACACACG Seq.N2, TGGACAAGCAGAACAAGC Seq.N3. Изобретение позволяет расширить арсенал средств выявления ДНК вируса папилломы человека 52 типа высокого канцерогенного риска в биологическом материале. 3 пр.

АНАЛИЗ МНОЖЕСТВА АНАЛИТОВ С ИСПОЛЬЗОВАНИЕМ ОДНОГО АНАЛИЗА

СПОСОБЫ ИНКАПСУЛИРОВАНИЯ ОДИНОЧНЫХ КЛЕТОК, ИНКАПСУЛИРОВАННЫЕ КЛЕТКИ И СПОСОБЫ ИХ ПРИМЕНЕНИЯ

КОМПОЗИЦИЯ ДЛЯ РАСЩЕПЛЕНИЯ БИОТИНОМ-СТРЕПТАВИДИНОМ И РАСЩЕПЛЕНИЕ ФРАГМЕНТОВ БИБЛИОТЕКИ

НАБОРЫ ДЛЯ ГЕНОТИПИРОВАНИЯ

Способ прогнозирования риска развития рака молочной железы у женщин, не имеющих высокопенетрантных мутаций в генах BRCA1 и CHEK2

Способ прогнозирования риска развития рака молочной железы у женщин без отягощенного семейного анамнеза

Способ прогнозирования риска развития миомы матки у женщин с нормальной массой тела

Изобретение относится к медицине, а именно к клинической гинекологии, медицинской генетике и молекулярной диагностике, и может быть использовано для прогнозирования риска развития миомы матки у женщин русской национальности, являющихся уроженками Центрального Черноземья РФ, с нормальной массой тела. Из периферической венозной крови выделяют ДНК. Проводят анализ полиморфных маркеров rs440837 гена ZBTB10, rs3779195 гена BAIAP2L1, rs780093 гена GCKR, rs17496332 гена PRMT6. При выявлении комбинации генотипов rs440837-AG гена ZBTB10, rs3779195-TA гена BAIAP2L1, rs780093-CT гена GCKR, rs17496332-AA гена PRMT6 прогнозируют высокий риск развития миомы матки у женщин с нормальной массой тела. Способ обеспечивает получение новых критериев оценки повышенного риска развития миомы матки у женщин с нормальной массой тела русской национальности, уроженок Центрально-Черноземного региона РФ, не имеющих родства между собой, на основе данных о полиморфных маркерах rs440837 гена ZBTB10, rs3779195 гена BAIAP2L1 ...

Способ прогнозирования риска развития гиперплазии эндометрия у женщин с избыточной массой тела или ожирением

Изобретение относится к медицине, а именно к клинической гинекологии, медицинской генетике и молекулярной диагностике, и может быть использовано для прогнозирования риска развития гиперплазии эндометрия у женщин русской национальности, являющихся уроженками Центрального Черноземья РФ с избыточной массой тела или ожирением. Из периферической венозной крови выделяют ДНК. Проводят анализ полиморфных маркеров rs11031002 и rs11031005 гена FSHB, rs117585797 гена ANO2 и rs148982377 гена ZNF789. При выявлении комбинации генотипов rs11031002-TT гена FSHB × rs117585797-CC гена ANO2 × rs11031005-TT гена FSHB × rs148982377-TC гена ZNF789 прогнозируют высокий риск развития гиперплазии эндометрия у женщин с избыточной массой тела или ожирением. Способ обеспечивает получение новых критериев оценки повышенного риска развития гиперплазии эндометрия у женщин с избыточной массой тела или ожирением русской национальности, уроженок Центрально-Черноземного региона РФ и не имеющих родства между собой на основе ...

Способ оценки риска развития винкристиновой полиневропатии у детей с острым лимфобластным лейкозом

ТРЕХМЕРНЫЕ ПОЛИМЕРНЫЕ СТРУКТУРЫ НА ПРОТОЧНЫХ КЮВЕТАХ

Изобретение относится к области методов секвенирования, а именно к способу проведения секвенирования на трехмерных полимерных структурах в кювете и способу получения такой кюветы. Способ изготовления трехмерных полимерных структур на проточных кюветах включает несколько этапов. В начале загружают раствор предшественника полимера в проточную кювету, подходящую для использования в секвенировании. Раствор предшественника полимера включает мономер, поперечносшивающий агент и фотоинициатор. Причем раствор предшественника полимера включает полиэтиленгликоль (ПЭГ)-тиол, ПЭГ-акрилат, акриламид, N,N'-бис(акрилоил)цистамин (BACy), ПЭГ, полипропиленоксид (ППО), полиакриловую кислоту, поли(гидроксиэтилметакрилат) (PHEMA), поли(метилметакрилат) (PMMA), поли(N-изопропилакриламид) (PNIPAAm), поли(молочную кислоту) (PLA), сополимер молочной и гликолевой кислот (PLGA), поликапролактон (PCL), поли(винилсульфоновую кислоту) (PVSA), поли(L-аспарагиновую кислоту), поли(L-глутаминовую кислоту), полилизин, агар ...

Способ прогнозирования риска развития преэклампсии тяжелого течения

Изобретение относится к медицине, а именно к акушерству и гинекологии, биотехнологии и медицинской генетике, и может быть использовано для прогнозирования риска развития преэклампсии тяжелого течения. Из лейкоцитов периферической венозной крови выделяют ДНК. Исследуют полиморфные локусы генов TBX2, OBFC1, RGL3, BAG6, AC026703.1. В случае выявления комбинации полиморфных локусов rs8068318 СС TBX2 × rs4387287 AA OBFC1 × rs167479 GG RGL3 × rs805303 AA BAG6 × rs1173771 GG AC026703.1 прогнозируют высокий риск развития преэклампсии тяжелого течения. Способ обеспечивает получение новых критериев оценки риска развития преэклампсии тяжелого течения у женщин русской национальности на основе данных о межлокусном взаимодействии полиморфных локусов rs8068318 гена ТВХ2, rs4387287 гена OBFC1, rs167479 гена RGL3, rs805303 гена BAG6, rs1173771 гена АС026703.1. 5 ил., 6 пр.

Способ синтеза библиотек олигонуклеотидов и система автоматического синтеза

Изобретение относится к устройствам для молекулярной биологии, генной инженерии, медицины и биотехнологии и предназначено для синтеза библиотек олигонуклеотидов плотностью до 2500 спотов/см2 в автоматическом режиме. Система автоматического синтеза олигонуклеотидов состоит из принтера с герметичной камерой; стойки управления с блоком управления принтером, шприцевой станцией и емкостями с реагентами и управляющего компьютера с программным обеспечением для управления системой. Внутри герметичной камеры принтера расположена печатающая каретка с подсоединенными трубками подачи реагентов и расположенными на печатающей каретке игольчатыми и пьезоэлектрическими дозаторами и обзорной камерой. На столе координатографа в герметичной камере принтера расположены модули для размещения подложек, стробоскопическая камера, модуль промывки дозаторов и модуль просушки дозаторов. Перед синтезом библиотек выполняют калибровку. Осуществляют циклическую подачу реагентов из емкостей шприцевой станции по трубкам ...

Способ прогнозирования ответа на периоперационную химиотерапию при раке желудка II-III стадий

Изобретение относится к медицине, а именно к онкологии, и может быть использовано для прогнозирования ответа на периоперационную химиотерапию при раке желудка II-III стадий. Из лейкоцитов венозной крови пациента выделяют ДНК. Проводят определение полиморфного варианта гена CHEK2 Ile157Thr с помощью полимеразной цепной реакции с последующей детекцией продуктов амплификации методом электрофореза в агарозном геле. При определении носительства гетерозиготного генотипа Ile/Thr прогнозируют благоприятный ответ на периоперационную химиотерапию при раке желудка II-III стадий. Способ обеспечивает возможность прогнозирования ответа на проводимую периоперационную химиотерапию по схеме FLOT или XELOX за счет определения носительства гетерозиготного генотипа Ile/Thr полиморфного варианта Ile157Thr гена CHEK2. 1 табл.

Технология создания библиотеки ДНК, содержащей уникальные молекулярные идентификаторы, для высокопроизводительного секвенирования наноболлами

Изобретение относится к области биотехнологии. Предложен способ создания библиотеки ДНК, содержащей уникальные молекулярные идентификаторы (UMI). Способ включает фрагментацию геномной ДНК, проведение реакции ERAT, лигирование с UMI-адаптерами, проведение ПЦР-амплификации с баркодированными праймерами. При этом для лигирования используют двухцепочечные UMI-адаптеры, полученные в результате проведения реакции гибридизации смеси из трех олигонуклеотидов. При проведении ПЦР-амплификации используют оригинальные праймеры. Изобретение позволяет уменьшить длину технических последовательностей и, таким образом, увеличить длину прочтений ДНК образца, оптимизировать синтез олигонуклеотидов, поскольку баркодирование происходит на этапе ПЦР, а адаптеры содержат случайные последовательности UMI, универсальные для всех образцов, расширить возможности кастомизации протокола, выбора наборов для пробоподготовки библиотек ДНК. 5 ил., 2 табл., 1 пр.

FREIGABE VON INTRAZELLULÄREM MATERIAL

Vorrichtung, Verfahren und Einrichtung zur Isolierung von Nukleinsäuren

ELEKTRODE-EINFANG VON NUKLEINSÄUREN

Verfahren zum Nachweis von Nukleinsäuren

VEFAHREN ZUR ANALYSE DER GENETISCHEN PRÄDISPOSITION EINES PATIENTEN FÜR INSULINABHÄNGIGE DIABETES, TESTSATZ UND PRIMERSETS

Probentransferwerkzeug

Die Erfindung betrifft ein mit Wirkstoffen beschichtetes, stabförmiges Probentransferwerkzeug, dessen Herstellung und dessen Verwendung zum Transfer von Nukleinsäure-haltigem Probenmaterial in Reaktionsgemische von enzymatischen Nachweisreaktionen.

ISOLIERUNG VON EINZELSTRÄNGIGEN NUKLEINSÄUREN

Method

A method for selecting polynucleotides comprising: allowing a nucleic acid handling enzyme (e.g. polymerase, exonuclease, translocase, helicase) to move along multiple polynucleotides in a sample for a defined time period, wherein the enzyme is loaded onto each of the multiple polynucleotides in the same manner and wherein one or more molecule of the enzyme moves along each of the multiple polynucleotides; and selecting polynucleotides based on whether or not the enzyme reaches the end of and/or unbinds from the polynucleotides in the defined time period. Also claimed is a polymer adaptor which has bound thereto a first nucleic acid handling enzyme, a second nucleic acid handling enzyme which is bound such that its movement along the polymer is hindered until it is brought into contact with a transmembrane pore and optionally a membrane anchor or pore anchor. Further claimed is a kit for separating polynucleotides comprising an adaptor comprising a polynucleotide and an end signal and/or ...

Tagging nucleic acid molecules from single cells for phased sequencing

The present disclosure provides methods for long-read sequencing from single cells. The method can comprise constructing a nucleic acid library and reconstructing longer nucleic acid sequences by clustering and assembling a plurality of shorter nucleic acid sequences.

Compositions and methods for nucleic acid quality determination

Provided herein are compositions and methods for determining the quality of nucleic acids in a sample that includes a first set of primers and a second set of primers. Additionally, provided herein are compositions and methods for determining nucleic the acid quality in a sample including sets of primers for amplification of repetitive nucleic acid sequences.

Methylation markers and targeted methylation probe panels

The present description provides a cancer assay panel for targeted detection of cancer-specific methylation patterns. Further provided herein includes methods of designing, making, and using the cancer assay panel for diagnosis of cancer. In particular, the assay panel is suitable for for enriching cell-free DNA (cfDNA) molecules and comprises at least 1,000 polynucleotide probes, each configured to hybridize to a modified polynucleotide obtained from processing (e.g. bisulfite treatment to convert unmethylated cytosine to uracil) of the cfDNA molecules, wherein each of the cfDNA molecules corresponds to or is derived from, one or more genomic regions, and wherein each of the one or more genomic regions comprises at least five methylation sites, and has an anomalous methylation pattern in cancer samples. The polynucleotide probes may comprise at least 500 different pairs of probes, wherein each pair of probes comprises two different probes configured to overlap with each other by an overlapping ...

VERFAHREN ZUR IDENTIFIZIERUNG, ISOLIERUNG UND HERSTELLUNG VON ANTIGENEN GEGEN EIN SPEZIFISCHES PATHOGEN

SCHNELL-BLOT VERFAHREN ZUM NACHWEIS VIRALER SEQUENZEN SOWIE AMPLIFIZIERTER GENSEQUENZEN IN MENSCHLICHEN ZELLEN

The invention relates to an improved method for the direct detection of intracellular viral gene sequences and for detecting and quantifying gene amplification, where a molecular blot hybridization method for the first time permits the analysis to be carried out with only a hundred to a thousand cells as starting material (within 1-2 days). In this method, the cells to be investigated are washed twice in a suitable buffer (i.e. one which does not interfere with DNA binding to the membrane), and about one hundred to one thousand cells are then suspended in the same buffer. The DNA extraction is carried out using an already established method (proteinase K/SDS and phenol/chloroform), followed by alkaline denaturation and blotting onto a GeneScreen plus membrane (NEN) in alkaline medium and suitable salt concentration.

PROCEDURE FOR IN VIVO QUANTIFICATION OF NUCLEUS-SOUR

MICRO-FLUID EXTRAKTIONSVERFAHREN

METHOD FOR THE ISOLATION OF DNA FROM BIOLOGICAL MATERIALS

METHOD FOR THE PROOF OF BIOLOGICAL FACTORS IN THE EPIDERMIS

PROTECTION PROBES

GEFASS TO THE WITHDRAWAL OF BLOOD

VERFAHREN ZUR DETEKTION UND QUANTIFIZIERUNG VON NUKLEINSÄUREN IN EINER PROBE

VERFAHREN ZUR TRENNUNG VON NUKLEINSÄUREN

MICRO-FLUID EXTRAKTIONSVERFAHREN

PROCEDURE FOR CATCHING AND SELECTIVE ONE SETTING FREE NUCLEIC ACIDS USING A WEAKLY BASIC POLYMER AND AMPLIFICATION OF THESE NUCLEIC ACIDS

UNIVERSAL METHOD AND COMPOSITION TO SNAPPING LYSIERUNG FROM CELLS TO THE RELEASE OF NUCLEIC ACIDS AND YOUR DETECTION

POLYKATIONI CARRIERS FOR THE CLEANING, SEPARATION AND HYBRIDIZING OF NUCLEIC ACID.

VEFAHREN FOR THE ANALYSIS OF THE GENETIC ONES PRÄDISPOSITION A PATIENT FOR INSULIN-DEPENDENT DIABETES, TEST RECORD AND PRIMER SET

PROCEDURE FOR THE IDENTIFICATION, ISOLATION AND PRODUCTION OF ANTIGENS OF A SPECIFIC ONE PATHOGENS

ELECTRODE CAPTURE OF NUCLEIC ACIDS

NUCLEIC ACID COLLECTION

PROCEDURE FOR CATCHING AND SELECTIVE ONE SETTING FREE NUCLEIC ACID

COMPOSITIONS AND PROCEDURES FOR THE CLEANING OF NUCLEIC ACIDS

PROCEDURE FOR THE RECOGNITION AND MEASUREMENT OF GESPLEISTEN NUCLEIC ACIDS

ISOLATION OF NUCLEIC ACIDS

A New Method for the Study of Differential Expression of Plant Genes-cDNA-SCoT

Abstract Based on the new molecular marker SCoT, the present invention provides a method for differential expression analysis of cDNA-SCoT. Its characteristics are based on the principle that the conservative region flanking the ATG start codon is commonly found in plants. Primer amplification is mainly by extracting RNA and then synthesizing double-stranded cDNA by LD-PCR and then purifying it, using the purified double-stranded cDNA as a template for amplification. The basic principle of primer-design is as below: each codon-ATG codons (+1, +2, +3), G(+4), A, C, C (+7, +8, +9)-has its respectively fixed position. Each primer is composed of 18 bases in length, and the GC content is between 50-72%; the amplification annealing temperature is 50°C; the separation and recovery of differential fragments are mainly based on agarose gel and 6 % Non-denatured acrylamide. The conserved sequence of cDNA SCoT comes from the results of previous studies. It's relatively simple for design. A little ...

Nucleic acid hybridization methods

Nucleic acid hybridization buffer formulations and uses thereof are described that yield improvements in hybridization specificity, rate, and efficiency. The buffer formulation composition includes a target nucleic acid; at least one polar, aprotic, organic solvent, and a pH buffer system, wherein the target nucleic acid is attached to the surface via hybridization to a surface bound nucleic acid tethered to the surface, and wherein the hybridization of the target nucleic acid and surface bound nucleic acid has a high stringency and annealing rate.

Methods for nucleic acid detection, sequencing, and cloning using exonuclease

Method for purifying or isolating viral nucleic acids

Genomewide unbiased identification of dsbs evaluated by sequencing (guide-seq)

Abstract Unbiased, genomewide and highly sensitive methods for detecting mutations, e.g., off-target mutations, induced by engineered nucleases.

Instrument for cassette for sample preparation

A parallel processing system for processing samples is described. In one embodiment, the parallel processing system includes an instrument interface parallel controller to control a tray motor driving system, a close-loop heater control and detection system, a magnetic particle transfer system, a reagent release system, a reagent pre-mix pumping system and a wash buffer pumping system.

Magnetic lysis method and device

A method for lysing cells is disclosed. The method includes stirring cells with a magnetic stir element in the presence of a plurality of cell lysis beads at a speed sufficient to lyse the cells. Also disclosed is a device for lysing cells. The device includes a container having a magnetic stir element and a plurality of cell lysis beads disposed therein. The container is dimensioned to allow rotation of the magnetic stir element inside the container.

Isolation of Biomolecules from Biological Samples

Nanoparticles for use in the collection, concentration, isolation and storage of biomolecules from biological samples are provided. More specifically, nanoparticles used to isolate biomolecules, including nucleic acids and proteins, cells, cell fragments, bacteria, and viruses from biological samples such as urine, cerebrospinal fluid (CSF), mouthwash samples, and amniotic fluid are provided. Kits for using nanoparticles for the isolation of biomolecules are also provided.

Method of immobilizing and stretching a nucleic acid on a substrate

The present invention relates to a method of immobilizing and stretching a nucleic acid on a silicon substrate, to nucleic acids and substrates prepared according to this method, to uses of the method and to uses of the nucleic acid and the substrate.

Methods and Devices for Rapid Urine Concentration

The present invention provides a device for the concentration of one or more target analytes contained in a urine sample. The device comprises a tube comprising an upper portion defining an opening for receiving the urine sample and a lower tapered portion terminating in collection reservoir. The tube contains a predetermined amount of a particulate binding agent which specifically binds the one or more target analytes and of a predetermined amount of a binding buffer. The device comprises means for seating the opening of the tube. The present invention further provides methods and kits for concentrating one or more target analytes in murine sample.

Synthetic siRNA Detection Method

A method for accurately and easily detecting a synthetic siRNA, for example, a siRNA in which the 3′ end is DNA, and a kit used for the method are provided. The present invention relates to a method for detecting a siRNA in which the 3′ end is DNA, comprising: (a) adding polydeoxyadenosine to the 3′ DNA end of at least one strand of the siRNA to be detected to produce a polydeoxyadenosine-added RNA; (b) annealing a polydeoxythymidine primer having a tag sequence at its 5′ side to the polydeoxyadenosine-added RNA and synthesizing DNA from the primer by a reverse transcription; and (c) detecting the DNA synthesized in (b).

Generic Buffer For Amplification

The present invention relates to a method of amplifying a first and a second target nucleic acid in separate reaction receptacles, wherein said reaction receptacles comprise a solution comprising amplification reagents and oligonucleotides specific for said first or said second target nucleic acid, wherein said solution is the same for amplifying said first target nucleic acid and said second target nucleic acid.

Alkaline shock-based method of processing a biological sample

Method of processing a biological sample to yield nucleic acid appropriate for use in a subsequent in vitro nucleic acid amplification reaction. The method involves a rapid, transient exposure to alkaline conditions which can be achieved by mixing an alkaline solution with a pH-buffered solution that includes a detergent and the biological sample to be tested for the presence of particular nucleic acid species using in vitro amplification. The invented method advantageously can improve detection of some target nucleic acids without substantially compromising detectability of others. The method is particularly useful for simultaneously preparing RNA and DNA templates that can be used in multiplex amplification reactions.

Compositions And Methods For Cancer Testing

Methods and compositions which provide a gene expression-based prognostic signature of cancer relapse and prediction of metastatic cancer are described, and in particular methods to predict colorectal cancer (CRC) recurrence and chemosensitivity.

Method for Concentrating Sample Constituents and Amplifying Nucleic Acids

A method is disclosed for concentrating sample constituents and for multiplying nucleic acids from a biological sample which are containing in the sample constituents. The nucleic acids are amplified on the same filter on which the sample constituents are also separated off.

Generic Matrix for Control Nucleic Acids

The present invention belongs to the field of in-vitro diagnostics. Within this field, it particularly concerns the amplification of at least a first target nucleic acid that may be present in at least one fluid sample using an internal control nucleic acid for qualitative and/or quantitative purposes and at least one external control nucleic acid in an aqueous buffer. It further provides an analytical system comprising an internal control nucleic acid for qualitative and/or quantitative purposes and at least one external control nucleic acid in an aqueous buffer.

Rna analytics method

The present invention relates to a method of ordering nucleic acid molecule fragment sequences derived from a pool of potentially diverse RNA molecules comprising optionally reverse transcribing the RNA molecules to provide a pool of cDNA molecules, segregating nucleic acids from said template RNA or cDNA pool, selecting for potentially different templates with a distinctive nucleic acid feature shared by the segregated templates, thereby providing at least a first subpool of nucleic acids, optionally once or more further segregating nucleic acids from said template RNA or cDNA, selectively segregating nucleic acids with a different distinctive nucleic acid feature, thereby providing one or more further subpool(s) of nucleic acids, generating fragments of said segregated nucleic acid molecules by fragmenting or obtaining fragment copies of said segregated nucleic acid molecules, wherein the fragments of each subpool or combined subpools remain separable from fragments of other subpools or other combined subpools by physically separating the subpools or by attaching a label to the fragments of the subpools, with the label identifying a subpool, or determining a partial sequence of said segregated nucleic acid molecule and preferably aligning at least two sequences or partial sequences to a joined sequence.

Methods and devices for nucleic acid purification

The invention provides pipette tip columns and automated methods for the purification of nucleic acids such as plasmids from unclarified cell lysates containing cell debris as well as methods for making and using such columns. The columns typically include a bed of medium positioned in the pipette tip column, above a bottom frit and with an optional top frit.

Methods for maintaining the integrity and identification of a nucleic acid template in a multiplex sequencing reaction

The invention generally relates to methods for maintaining the integrity and identification of a nucleic acid template in a multiplex sequencing reaction. In certain embodiments, methods of the invention involve obtaining a solution including a template nucleic acid, introducing an identifier nucleic acid to the solution, incorporating the same barcode sequence into the template and the identifier nucleic acids, and sequencing the template and the identifier nucleic acids.

Method and apparatus for fragmenting dna sequences

A method of fragmenting a DNA sequence having a starting size of at least 10000 base pair into fragments having a mean size smaller than or equal to 1300 bp, wherein the DNA sequence is put in a solution, the solution comprising the DNA sequence is put in a container and the container is placed in a liquid bath which is subjected to the action of ultrasound waves such that the ultrasound waves travel through the liquid bath to excite the container and the solution so as to shear the DNA sequence, and wherein the ultrasound waves have a frequency falling in the range between 28 kHz and 80 kHz.

Method for sample analysis of aneuploidies in maternal samples

The invention provides methods for determining aneuploidy and/or fetal fraction in maternal samples comprising fetal and maternal cfDNA by massively parallel sequencing. The method comprises a novel protocol for preparing sequencing libraries that unexpectedly improves the quality of library DNA while expediting the process of analysis of samples for prenatal diagnoses. The novel protocol can be performed in solution or on a solid surface.

Nucleic acid elution

This invention relates to the storage on a solid matrix of genetic material, in particular DNA that has been purified prior to the application to the solid matrix. More specifically, the invention relates to a solid matrix for the storage of purified DNA, which matrix has been treated with a solution comprising plant polysaccharide inulin. One advantage of the invention is that an increased amount of DNA can be stored in the solid matrix of the present invention.”

Microchip for nucleic acid amplification reaction and a method of manufacturing the same

To provide a microchip for a nucleic acid amplification reaction which allows high-precision analysis by a simple method. There is provided a microchip A for a nucleic acid amplification reaction including an entrance through which a liquid enters from the outside, a plurality of wells configured to function as reaction sites of nucleic acid amplification reaction, and flow channels through which the liquid entered from the entrance is fed into each of the wells, in which a plurality of reagents needed for the reaction are laminated and anchored in a prescribed order in each well.

Means and methods for non-invasive diagnosis of chromosomal aneuploidy

The invention relates to a prenatal diagnostic method for the determination of a fetal chromosomal aneuploidy in a biological sample obtained from a pregnant woman, which method comprises enrichment and quantification of selected cell-free deoxyribonucleic acid sequences showing consensus nucleosome binding regions.

Biological Specimen Collection and Transport System and Method of Use

Disclosed are compositions for isolating populations of nucleic acids from biological, forensic, and environmental samples. Also disclosed are methods for using these compositions as one-step formulations for killing pathogens, inactivating nucleases, and releasing polynucleotides from other cellular components within the sample, and stabilizing the nucleic acids prior to further processing or assay. The disclosed compositions safely facilitate rapid sample collection, and provide extended storage and transport of the samples at ambient or elevated temperature without contamination of the sample or degradation of the nucleic acids contained therein. This process particularly facilitates the collection of specimens from remote locations, and under conditions previously considered hostile for preserving the integrity of nucleic acids released from lysed biological samples without the need of refrigeration or freezing prior to molecular analysis.

Library characterization by digital assay

Methods of characterizing a nucleic acid library by digital assay.

Vessel for blood sampling

The present invention relates to a vessel for withdrawing blood, the vessel containing a solution which comprises a guanidinium salt, a buffer substance, a reducing agent, and/or a detergent as components. The vessel is particularly suited for withdrawing blood which is to be analyzed with respect to nucleic acids.

RAPID METHOD FOR IDENTIFYING DRUG-RESISTANT GENE USING ARTIFICIAL CHROMOSOME OF PLASMODIUM, AND METHOD FOR PREPARING RECOMBINANT PLASMODIUM

The present invention relates to a rapid method for identifying a drug-resistant gene using an artificial chromosome of a protozoa. Specifically, it relates to a method for screening for a drug-resistant gene, which involves preparing a recombinant using an artificial chromosome of a , either inoculating the recombinant into a non-human mammal or using the in vitro culture system of the at the blood stage in the red blood cells, and using the survival of the recombinant in the presence of a drug as an index. The present invention also relates to a method for preparing a recombinant by directly introducing an exogenous gene into a at a high efficiency. 4. The method according to claim 1 , wherein the non-human mammal is a rodent or a primate.5PlasmodiumPlasmodium berghei.. The method according to claim 2 , wherein the artificial chromosome of a parasite is one containing a centromere region derived from6Plasmodium. The method according to claim 3 , wherein the artificial chromosome of a parasite is a circular artificial chromosome.7Plasmodium. The method according to claim 2 , wherein the artificial chromosome of a parasite is a linear artificial chromosome.8Plasmodium. The method according to claim 2 , wherein the candidate gene fragments are gene fragments derived from a drug-resistant parasite.9. (canceled)10. The method according to claim 1 , wherein the candidate gene fragments have an average length of 4.0 to 10 kb.11. The method according to claim 1 , wherein the candidate gene fragments have an average length of 10 to 50 kb.12. The method according to claim 1 , wherein the drug is a therapeutic drug for malaria.13. The method according to claim 12 , wherein the therapeutic drug for malaria is a drug selected from the group consisting of chloroquine claim 12 , quinine claim 12 , pyrimethamine claim 12 , mefloquine claim 12 , primaquine claim 12 , and artemisinin.15. (canceled)17. (canceled)18PlasmodiumPlasmodium falciparumPlasmodium vivax.. The method ...

SAMPLE PROCESSING METHOD AND DEVICE

The present invention provides a method and device for treating and analyzing a biological specimen. The biological specimen is introduced into a processing device and treated thermally, mechanically, chemically or any combination thereof within the processing device to alter at least one constitutive characteristic of the biological specimen and to release or create one or more biological indicators from the biological specimen. The biological specimen is further contacted with a treated polymeric material so that at least a portion of the polymeric material binds to the one or more biological indicators. 1: A method for preparing a biological specimen comprising:introducing a biological specimen into a processing device;contacting the biological specimen with a lysis buffer to promote the release of one or more biological indicators;treating the biological specimen mechanically within the processing device to cause sufficient turbulence to contact the one or more biological indicators within the biological specimen to a removable polystyrene adherent strip located within the processing device;2. (canceled)3. The method of claim 1 , polymeric material is formed as a rectangle claim 1 , or cylinder.4. The method of claim 1 , wherein the polystyrene adherent strip is located within the processing device while the biological specimen is treated.5. (canceled)6. The method of claim 1 , wherein the lysis buffer includes Tris[2-carboxyethyl]phosphine.7. The method of claim 1 , wherein the polystyrene adherent strip is structurally pre-treated to improve the adhesion characteristics prior to contact with the biological specimen.8. The method of claim 1 , wherein the polystyrene adherent strip is transferred to a PCR cuvette after binding to one or more biological indicators.9Clostridium difficile. The method of claim 1 , wherein the polystyrene adherent strip binds to biological indicators associated with infection.10Clostridium difficileClostridium difficile. The method ...

Substantially non-self complementary primers

The present invention regards a variety of methods and compositions for whole genome amplification and whole transcriptome amplification. In a particular aspect of the present invention, there is a method of amplifying a genome comprising a library generation step followed by a library amplification step. In specific embodiments, the library generating step utilizes specific primer mixtures and a DNA polymerase, wherein the specific primer mixtures are designed to eliminate ability to self-hybridize and/or hybridize to other primers within a mixture but efficiently and frequently prime nucleic acid templates.

METHOD FOR DETERMINATION OF TARGET CELLS OR TISSUE FOR EXTRACTION OF BIOMOLECULES FROM FIXED BIOLOGICAL SAMPLES

The present invention relates to a method for determination of target cells or tissue for isolating or extracting biomolecules from fixed biological samples, the preparation of a sample in a method for extracting, isolating and/or purifying biomolecules from a fixed biological sample as well as to a kit for visualizing target cells or tissue in a fixed biological sample for extracting, isolating and/or purifying biomolecules from said target cells or tissue. 114.-. (canceled)15. A method for determining target cells or tissue for isolation , extraction or purification of biomolecules from a fixed biological sample , comprising:(1) mounting at least one part of the fixed biological sample on at least one support,(2) optionally treating the at least one part of the sample with a sample treatment agent, wherein said treatment can be carried out at any stage of the procedure before step (6),(3) staining the at least one part of the fixed biological sample mounted on the at least one support,(4) considering the at least one part stained in step (3) to determine target cells or tissue comprising biomolecules of interest,(5) separating target cells or tissue comprising biomolecules of interest from the remainder of the fixed sample mounted on the at least one support, and(6) isolating the biomolecules from the separated target cells or tissue.16. The method according to claim 15 , wherein the biomolecules comprise RNA.1714. The method according to claim claim 15 , wherein the fixed biological sample is a wax embedded sample claim 15 , and wherein the sample treatment agent is a de-waxing agent.18. The method according to claim 17 , wherein the fixed biological sample is a paraffin embedded sample.19. The method according to claim 17 , wherein the fixed biological sample is non-formalin-fixed paraffin-embedded sample (non-FFPE-sample).20. The method according to claim 17 , wherein the de-waxing agent is a de-paraffinizing agent selected from the group consisting of toluene ...

INHIBITOR LEACHING RESISTANT NUCLEIC ACID STORAGE REAGENT

The invention provides compositions and methods related to a nucleic acid storage reagent. 1. A composition , comprising Tris , ethylenediaminetetraacetic acid (EDTA) , and sodium azide (NaN) , wherein the composition has been previously exposed to an artificial source of ultraviolet irradiation.2. The composition of claim 1 , wherein the composition is a liquid.3. The composition of claim 1 , wherein the composition is dry.4. The composition of claim 1 , wherein the composition is lyophilized.5. The composition of claim 1 , wherein the composition is a solution and wherein Tris is present in an amount of 1.0 mM to 50 mM claim 1 , EDTA is present in an amount of 0.05 mM to 2.0 mM claim 1 , and NaNis present in an amount of 0.01 to 0.3%.6. The composition of claim 5 , wherein the exposure to ultraviolet irradiation is for at least 15 minutes.7. The composition of claim 6 , wherein the exposure to ultraviolet irradiation is for 1 to 4 hours.8. The composition of claim 1 , wherein the ultraviolet irradiation is at a wavelength range from 250 to 320 nm.9. A container claim 1 , comprising:{'sub': '3', '(a) a composition comprising Tris, EDTA, and NaN, wherein the composition has been previously exposed to an artificial source of ultraviolet irradiation; and'}(b) a nucleic acid.10. The container of claim 9 , wherein (a) and (b) are frozen.11. The container of claim 9 , wherein the container is plastic.12. The container of claim 11 , wherein the plastic comprises a polypropylene claim 11 , a polystyrene claim 11 , a polycarbonate claim 11 , a cyclo-olefin claim 11 , or a mixture thereof.13. The container of claim 9 , wherein the nucleic acid has not been previously exposed to an artificial source of ultraviolet irradiation.14. The container of claim 9 , wherein the nucleic acid is a DNA or cDNA.15. The container of claim 9 , wherein (a) and (b) are in a solution and wherein Tris is present in an amount of 1.0 mM to 50 mM claim 9 , EDTA is present in an amount of 0.05 mM to ...

Procedure for the specific isolation of total dna content of bacterial germs and a kit for this purpose

Procedure for the specific isolation of total DNA content of bacterial germs of different samples, in the course of which the cells are lysated, the DNA content of the lysate is bound selectively, it is washed and then the desalinated linear polymer nucleic acid is eluted from the binding surface in an aqueous solution. Before cell lysis the nonviable bacterial cells are separated from the viable cells on the basis of their different cell surface physical-chemical characteristics, the viable cells of the sample are kept and then lysated using a mechanical and/or enzymatic, favourably lysozyme enzymatic method. After this exclusively double-stranded DNA deriving from the lysate of viable cells is bound on a —SiO 2 —TiO 2- matrix containing chemically activated —OH and dodecylamine groups, and after washing it, the desalinated linear polymer nucleic acid is eluted in an aqueous solution.

CELL DISRUPTION

A process for the disruption of a biological cell comprising freezing, boiling or perhaps alternately freezing and boiling the material containing the biological cell using a thermoelectric cell a base face whereof is contiguous with a heat sink/source held at a substantially constant temperature and a working face . Apparatus for carrying out the disruption process comprises a peltier cell a base face of which is flexibly attached to a heat sink arranged to be kept at a constant temperature of around 50° C. and a working face of which is contiguous with a reaction vessel or a reaction vessel holder. Reversal of the voltage in the peltier cell enables the working face alternately to reach below freezing and above boiling temperatures, and/or with use of a resistive wire on the vessel holder for heating with the TEC used purely for cooling The peltier cell base face is constructed of materials which tend to inhibit disintegration of the peltier cell brought about by expansion and contraction under heat. 142-. (canceled)43. A process for the disruption of a biological cell to release contained material , comprising placing a target biological cell in a vessel , the vessel being in close proximity to a working surface of a thermoelectric cell the base face of which is in close proximity to a heat source/sink at a substantially constant temperature between the freezing and boiling temperatures of water , and applying an electric current to the thermoelectric cell to substantially change the temperature of the target biological cell.44. A process as claimed in and comprising reducing the temperature at the working face of the thermoelectric cell to freezing thus forming ice crystals in the target cells claim 43 , and then causing the ice to thaw.45. A process as claimed in and comprising heating the target cells to the boiling temperature thereof claim 43 , the sample then being allowed to cool.46. A process as claimed in and employing a thermal cycle comprising ...

POST PROTEIN HYDROLYSIS REMOVAL OF A POTENT RIBONUCLEASE INHIBITOR AND THE ENZYMATIC CAPTURE OF DNA

The present invention concerns compositions and methods of extracting infectious pathogens from a volume of blood. In one embodiment, the method includes the steps of creating a fibrin aggregate confining the pathogens and introducing a fibrin lysis reagent to expose the pathogens for analysis. The present invention also concerns materials and methods for removing aurintricarboxylic acid (ATA) from a sample. 1. A container comprising a biological sample and a fibrin lysis reagent , wherein the fibrin lysis reagent comprises a nuclease , a plasminogen and a plasminogen activator.2. The container of claim 1 , wherein the biological sample comprises a bacterium.3. The container of claim 1 , wherein the biological sample comprises a fungus.4. The container of claim 1 , wherein the nuclease is a DNase.5. The container of claim 4 , wherein the DNase is an endonuclease.6. The container of claim 1 , wherein the container further comprises an enzyme that will break down a nuclear membrane.7. The container of claim 6 , wherein the enzyme that will break down a nuclear membrane is phospholipase A.8. The container of claim 1 , wherein the container further comprises a detergent.9. The container of claim 1 , wherein the container further comprises a lipase.10. The container of claim 1 , wherein the plasminogen activator is streptokinase.11. The container of claim 1 , wherein the biological sample is blood.12. The container of claim 1 , wherein the biological sample is a fibrin aggregate.13. A reagent composition claim 1 , comprising a plasminogen activator claim 1 , plasminogen claim 1 , and a nuclease.14. The reagent composition of claim 13 , wherein the nuclease is a DNase.15. The reagent composition of claim 14 , wherein the DNase is an endonuclease.16. The reagent composition of claim 13 , wherein the reagent further comprises an enzyme that will break down a nuclear membrane.17. The reagent composition of claim 16 , wherein the enzyme that will break down a nuclear membrane ...

STORAGE OF NUCLEIC ACID

Processes are disclosed for storing nucleic acid in a stable form. A solution comprising nucleic acid is applied to an unmodified, silica-based substrate whereby at least a portion of the nucleic acid binds to a surface of the substrate, the bound nucleic acid is washed and dried, and the resulting dried nucleic acid on the substrate is stored at from 5° C. to 60° C. for a period of at least one week. 1. A process for storing nucleic acid in a stable form , comprising:applying a solution comprising nucleic acid to an unmodified, silica-based substrate whereby at least a portion of the nucleic acid binds to a surface of the substrate to produce bound nucleic acid;washing the bound nucleic acid with a wash solution to produce substrate-bound, washed nucleic acid;drying the substrate-bound, washed nucleic acid to produce dried nucleic acid; andstoring the dried nucleic acid on the substrate at a temperature of from 5° C. to 60° C. for a period of at least one week.2. The process of wherein the nucleic acid is DNA.3. The process of wherein the nucleic acid is RNA.4. The process of wherein the solution further comprises a chaotropic salt.5. The process of wherein the wash solution comprises an aliphatic C1 to C4 alcohol.6. The process of wherein the alcohol is ethanol.7. The process of wherein the alcohol is methanol.8. The process of wherein the washing step comprises washing the bound nucleic acid with a first wash solution and a final wash solution claim 1 , wherein the final wash solution does not comprise a mineral salt.9. The process of wherein the silica substrate is glass.10. The process of wherein the glass is smooth glass.11. The process of wherein the smooth glass is a portion of an inner surface of a device claim 10 , the device comprising the inner surface claim 10 , an outer surface claim 10 , a first port claim 10 , and a second port claim 10 , wherein the inner surface defines a binding chamber providing fluid communication between the first port and the ...

METHODS FOR DETECTION AND QUANTITATION OF SMALL RNAs

Improved methods that increase the specificity and sensitivity of detection of small RNAs, including miRNAs, using oligonucleotide primers and nucleic acid amplification, are provided. Reaction conditions that result in preferential decrease in cDNA synthesis of RNAs other than the small RNA molecules targeted for detection during miRNA tailing and reverse transcription reactions are described. Using these reaction conditions greater sensitivity and specificity of amplification of small RNAs including miRNAs is achieved. 114.-. (canceled)15. A method for preparing a cDNA copy of a small RNA molecule , comprising:(a) providing a small RNA from a biological sample, wherein said RNA is from 18 to 28 nucleotides in length;(b) incubating the small RNA with an enzyme capable of catalyzing the addition of nucleotides at the 3′ end of the small RNA in the presence of a single ribonucleotide triphosphate selected from the group consisting of ATP, GTP, UTP, and CTP and at a final concentration of divalent magnesium cation between 20 millimolar and 80 millimolar in a reaction to add nucleotides to the small RNA to generate a tailed small RNA;(c) annealing a DNA primer to the tailed small RNA whereby the DNA template extends from the 3′ end of the tailed small RNA, thereby providing a single stranded region of DNA that may be used to direct polymerization of deoxyribonucleotide triphosphates; and(d) incubating the annealed tailed small RNA and DNA primer in the presence of reverse transcriptase and deoxyribonucleotide triphosphates and at a final concentration of divalent magnesium cation between 20 millimolar and 80 millimolar under conditions allowing reverse transcription into cDNA and amplification of the annealed tailed small RNA to produce an amplification product.16Escherichia coli. The method of claim 15 , wherein the enzyme used in step (b) is Poly(A) polymerase.17. The method of claim 15 , wherein polymerization in step (c) is catalyzed by is MMLV reverse ...

RNA Interactome Analysis

A method of sample analysis is provided. In certain cases, the method comprises: a) cross-linking the contents of a cell using a heat stable crosslinking agent to produce cross-linked ribonucleotide complexes; b) fragmenting the cross-linked ribonucleotide complexes to produce complexes comprising protein, RNA fragments and, optionally, genomic DNA fragments; c) contacting the complexes with a plurality of non-overlapping oligonucleotides comprise an affinity tag and that are complementary to a specific target RNA of the cell under high stringency conditions that include high temperature; d) isolating complexes that contain the oligonucleotides using the affinity tag to produce isolated complexes; e) enzymatically releasing the protein, RNA fragments and/or the genomic DNA fragments from the isolated complexes to produce a released component, without reversing the crosslinking; and f) analyzing the released component.

POST PROTEIN HYDROLYSIS REMOVAL OF A POTENT RIBONUCLEASE INHIBITOR AND THE ENZYMATIC CAPTURE OF DNA

The present invention concerns compositions and methods of extracting infectious pathogens from a volume of blood. In one embodiment, the method includes the steps of creating a fibrin aggregate confining the pathogens and introducing a fibrin lysis reagent to expose the pathogens for analysis. The present invention also concerns materials and methods for removing aurintricarboxylic acid (ATA) from a sample. 2. The method of claim 1 , wherein the biological sample is contacted with a plasminogen.3. The method of claim 2 , wherein the method further comprises contacting the biological sample with a plasminogen activator.4. The method of claim 3 , wherein the plasminogen activator is a tissue type plasminogen activator.5. The method of claim 3 , wherein the plasminogen activator is streptokinase.6. The method of claim 1 , wherein the particle is a bacterium.7. The method of claim 1 , wherein the particle is a fungus.8. The method of claim 1 , wherein the method further comprises contacting the biological sample with a nuclease.9. The method of claim 8 , wherein the nuclease is a DNase.10. The method of claim 9 , wherein the DNase is an endonuclease.11. The method of claim 1 , wherein the method further comprises contacting the biological sample with an enzyme that will break down a nuclear membrane.12. The method of claim 11 , wherein enzyme that will break down a nuclear membrane is phospholipase A.13. The method of claim 1 , wherein the method further comprises contacting the biological sample with a nuclease and an enzyme that will break down a nuclear membrane.14. The method of claim 13 , wherein the nuclease is a DNase and the enzyme that will break down a nuclear membrane is phospholipase A.15. The method of claim 1 , wherein the method further comprises contacting the biological sample with a detergent.16. The method of claim 1 , wherein the method further comprises contacting the biological sample with a lipase.17. The method of claim 1 , wherein the ...

METHODS AND DEVICES FOR OBTAINING AND ANALYZING CELLS

A method for concentrating and isolating nucleated cells, such as maternal and fetal nucleated red blood cells (nRBCs), in a maternal whole blood sample. The invention also provides methods and apparatus for preparing to analyze and analyzing the sample for identification of fetal genetic material as part of prenatal genetic testing. The invention also pertains to methods and apparatus for discriminating fetal nucleated red blood cells from maternal nucleated red blood cells obtained from a blood sample taken from a pregnant woman. 1. A method for removing a cell , comprising:providing a cell attached to a portion of a flexible surface;apposing at least the portion of the flexible surface to a resilient substrate;surrounding the cell with a hollow shaft; andapplying a force between the hollow shaft and the flexible surface wherein the force is opposed by the resilient substrate, to thereby separate the portion of the flexible surface and the cell attached thereto from the rest of the flexible surface.2. The method of wherein providing a cell comprises providing a cell separated from any other cells on the flexible surface.3. The method of wherein providing a cell comprises providing a cell attached to biaxially-oriented polyethylene terephthalate (mylar).4. The method of further comprising analyzing a characteristic of the cell attached to the surface before the surrounding step and determining the cell is in need of removal.5. The method of wherein analyzing a characteristic of the cell comprises performing at least one of a DNA analysis claim 4 , an RNA analysis claim 4 , a protein analysis claim 4 , and an optical analysis prior to the surrounding step to thereby determine that the cell is in need of removal.6. The method of further comprising connecting the hollow shaft with a microscope turret prior to the surrounding step.7. The method of further comprising calibrating a location of the hollow shaft relative to the flexible membrane.8. The method of further ...

DEVICES

A method of analysis, instrument for analysis and device for use in such an instrument are provided, which perform a number of processes need to reach a useful result in the context of a wide variety of samples. The sequence of those processes being optimised. A device, instrument using the device and method of use are also provided which offer reliable performance of a heating based process, with minimal condensation and/or sample loss issues. 1. A device , for processing a sample , the device including:one or more sample processors, wherein the sample processors include a sample preparation step, sample extraction step, sample retention step, elution step, amplification step, denaturing step, detection step and results output step.2. A device according to in which the device is a cartridge.3. A device according to in which the device includes a sample processor for one or more of a sample receiving step claim 1 , purification step claim 1 , washing step claim 1 , PCR step claim 1 , investigation step claim 1 , analysis step.4. A device according to in which the sample receiving step includes the transfer of a sample from outside the device to inside the device claim 1 , the sample receiving step receiving the sample from a collection device or from a storage device.5. A device according to in which the sample preparation step includes contacting the sample with one or more reagents.6. A device according to the sample retention step includes contacting the sample with one or more reagents and/or components which retain the sample component(s) relative to one or more waste components in the sample.7. A device according to in which the sample component(s) are retained on one or more magnetic beads.8. A device according to in which the waste component(s) are removed from the retained sample components by being washed away from the retention step using one or more further reagents and/or components.9. A device according to in which the retained and/or selected sample ...

Long-Range Barcode Labeling-Sequencing

Methods for sequencing single large DNA molecules by clonal multiple displacement amplification using barcoded primers. Sequences are binned based on barcode sequences and sequenced using a microdroplet-based method for sequencing large polynucleotide templates to enable assembly of haplotype-resolved complex genomes and metagenomes.

Rapid nucleic acid purification

Provided is a method for rapid nucleic acid purification, and the method for rapid nucleic acid isolation according to the present invention is very useful in diagnosing causes of disease or detecting a target gene; can be used in molecular diagnosis of causes of disease more rapidly and conveniently, as compared with the existing nucleic acid isolation method requiring complicated and special equipment; does not require skills therefor, thereby allowing an ordinary person to personally conduct isolation of nucleic acid for analyzing causes of disease and further solving the existing inconvenience caused by directly going to the hospitals or health clinical centers; and can analyze causes of disease more promptly.

Methods for nucleic acid manipulation

A method for replicating and amplifying a target nucleic acid sequence is described. A method of the invention involves the formation of a recombination intermediate without the prior denaturing of a nucleic acid duplex through the use of a recombination factor. The recombination intermediate is treated with a high fidelity polymerase to permit the replication and amplification of the target nucleic acid sequence. In preferred embodiments, the polymerase comprises a polymerase holoenzyme. In further preferred embodiments, the recombination factor is bacteriophage T4 UvsX protein or homologs from other species, and the polymerase holoenzyme comprises a polymerase enzyme, a clamp protein and a clamp loader protein, derived from viral, bacteriophage, prokaryotic, archaebacterial, or eukaryotic systems.

STABILIZATION OF NUCLEIC ACIDS IN CELL MATERIAL-CONTAINING BIOLOGICAL SAMPLES

The present invention relates to the use of an aqueous system for stabilizing cell material-containing biological samples while preserving the cell morphology of the cell material and to a method for stabilizing nucleic acids in cell material-containing biological samples while preserving the cell morphology of the cell material. 114.-. (canceled)15. A method for stabilizing nucleic acids in a cell material-containing biological sample while preserving the cell morphology of the cell material , comprising:admixing the biological sample with an aqueous system that comprises one or more substances selected from the group consisting of 3-(N-morpholino)propanesulfonic acid (MOPS), 1,2-dimethoxyethane, sodium salicylate, hexaammonium heptamolybdate, glucosamine hydrochloride, indole, 2-(4-hydroxyphenyl)ethanol, and tetrahexylammonium chloride.16. The method of claim 15 , wherein the aqueous system comprises MOPS or a mixture of MOPS and at least one further substance selected from the group consisting of 1 claim 15 ,2-dimethoxyethane claim 15 , sodium salicylate claim 15 , hexaammonium heptamolybdate claim 15 , glucosamine hydrochloride claim 15 , indole claim 15 , 2-(4-hydroxyphenyl)ethanol claim 15 , and tetrahexylammonium chloride.17. The method of claim 16 , wherein the aqueous system comprises MOPS or a mixture of MOPS with sodium salicylate and/or glucosamine hydrochloride.18. The method of claim 16 , wherein the aqueous system comprises at least one further substance selected from the group consisting of anticoagulants and organic solvents.19. The method of claim 15 , wherein the substances present in the aqueous system are present in a concentration range of from 1 to 3000 mg/ml.20. The method of claim 19 , wherein the substances present in the aqueous system are present in a concentration range of from 25 to 2000 mg/ml.21. The method of claim 20 , wherein the substances present in the aqueous system are present in a concentration range of from 50 to 1500 mg/ml. ...

Sequence tag directed subassembly of short sequencing reads into long sequencing reads

The invention provides compositions and methods for preparing DNA sequencing libraries. In particular, the method relates to preparing DNA sequencing libraries from kilobase scale nucleic acids. The invention also provides methods for assembling short read sequencing data into longer contiguous sequences. The method is useful for various applications in genomics, including genome assembly, full length cDNA sequencing, metagenomics, and the analysis of repetitive sequences of assembled genomes.

SOLUTION FOR EXTRACTION OF RNA

A solution for extracting substantially pure RNA from a biological sample is disclosed. The solution for extracting RNA from a biological sample containing RNA and at least DNA comprises: 1. A solution for extracting RNA from a biological sample containing RNA and at least DNA , said solution comprising:(a) phenol in an amount of more than 50% by volume based on the total amount of said solution;(b) a polyol in an amount of 3 to 10% by volume based on the total amount of said solution;(c) a guanidinium salt at a concentration of 0.5 to 2.0 M based on the total amount of said solution;(d) a thiocyanate at a concentration of 0.1 to 0.5 M based on the total amount of said solution; and(e) a buffer for maintaining the pH of said solution at 4 to 6.2. The solution according to claim 1 , wherein the phenol concentration is 55 to 65% by volume based on the total amount of said solution.3. The solution according to claim 1 , further comprising an organic solvent for separating an aqueous layer.4. The solution according to claim 1 , wherein said biological sample is a culture liquid of cultured cells.5. The solution according to claim 1 , wherein said biological sample is a body fluid component of an organism.6. The solution according to claim 1 , wherein said biological sample is a blood component of an organism.7. A method for extracting RNA from a biological sample containing RNA and at least DNA claim 1 , said method comprising the steps of: (a) phenol in an amount of more than 50% by volume based on the total amount of said solution;', '(b) a polyol in an amount of 3 to 10% by volume based on the total amount of said solution;', '(c) a guanidinium salt at a concentration of 0.5 to 2.0 M based on the total amount of said solution;', '(d) a thiocyanate at a concentration of 0.1 to 0.5 M based on the total amount of said solution; and', '(e) a buffer for maintaining the pH of said solution at 4 to 6;, 'homogenizing said biological sample together with a solution ...

Method for Nucleic Acid Testing

A Method for nucleic acid analysis involving the steps of receiving sample tubes which contain samples, receiving a test request for each sample (the test request specifying one or more assays to be conducted for said sample), obtaining one or more sample aliquots of each sample depending on if one or more assays are to be conducted, assigning each of the sample aliquots to one or more test classes according to the assay which is to be conducted for that sample aliquot and combining sample aliquots belonging to the same test class into the same batch, while the batch includes samples for which a first and samples for which a second assay is to be conducted. 1. A method for nucleic add analysis involving the steps ofreceiving sample tubes each containing a sample,receiving a test request for each sample, said test request specifying one or more assays to be conducted for said sample,obtaining one or more sample aliquots of each sample depending on if one or more assays are to be conducted,assigning each of the sample aliquots to one or more test classes according to the assay which is to be conducted for that sample aliquotcombining sample aliquots belonging to the same test class into the same batch, said batch comprising samples for which a first and samples for which a second assay is to be conducted,simultaneous amplification of nucleic acids contained in said batchconducting an analysis of the sample aliquots to determine the presence and/or concentration of nucleic acids in said sample aliquots.2. The method according to claim 1 , wherein said assignment step involves the check of a lookup table which shows a corresponding test class for an assay to be conducted.3. The method according to claim 1 , wherein a first and a second sample aliquot are assigned to the same test class ifa) the sample processing steps are identical, orb) the same thermal profile for nucleic acid isolation is employed, orc) the same consumables are employed for the first and second ...

Magnetic lysis method and device

A method for lysing cells is disclosed. The method includes stirring cells with a magnetic stir element in the presence of a plurality of cell lysis beads at a speed sufficient to lyse the cells. Also disclosed is a device for lysing cells. The device includes a container having a magnetic stir element and a plurality of cell lysis beads disposed therein. The container is dimensioned to allow rotation of the magnetic stir element inside the container.

Self-Contained Biological Analysis

Devices, containers, and methods are provided for performing biological analysis in a closed environment. Illustrative biological analyses include nucleic acid amplification and detection and immuno-PCR.

METHODS FOR OBTAINING A SEQUENCE

The invention generally relates to methods for obtaining a sequence, such as a consensus sequence or a haplotype sequence. In certain embodiments, methods of the invention involve determining an amount of amplifiable nucleic acid present in a sample, partitioning the nucleic acid based upon results of the determining step such that each partitioned portion includes, on average, a subset of unique sequences, sequencing the nucleic acid to obtain sequence reads, and assembling a consensus sequence from the reads. 1. A method for relating sequence components in a target polynucleotide , the method comprising:(a) providing at least one sample comprising one or more target polynucleotides each adjacent to a known nucleotide sequence at at least one end, wherein each target polynucleotide comprises one or more sequence segments with a sequence segment length, and wherein the known nucleotide sequence is capable of serving as an amplification target;(b) partitioning the sample into a finite plurality of partitions such that at least a fraction of the sequence segments in at least one partition is estimated to be present as a single copy in the at least one partition with a likelihood that is less than 99.999%;(c) subjecting the partition to polynucleotide fragmentation thereby generating a set of fragments;(d) obtaining partial or complete sequence information from at least a subset of the fragments; and(e) relating sequence information from a plurality of fragments into a subset of the one or more target polynucleotides.2. A method for relating sequence components in a target polynucleotide , the method comprising:(a) providing at least one sample comprising one or more target polynucleotides each adjacent to a known nucleotide sequence at at least one end, wherein each target polynucleotide comprises one or more sequence segments with a sequence segment length of greater than 30 bp, and wherein the known nucleotide sequence is capable of serving as an amplification ...

Systems and Methods for Detecting Antibiotic Resistance

A robust, automated computational pipeline was used to design a system comprising a microarray for the identification of microorganisms and their antibiotic resistance profiles. This system and methods will facilitate the study of the epidemiology and microbial ecology of antibiotic resistance and be an invaluable tool to rapidly and simultaneously identify organisms and their antimicrobial resistance elements in environmental, food and clinical samples. 1. (canceled)2. (canceled)3. A method for determining a disease condition of a subject , the method comprising the steps of:(a) obtaining a sample from a patient;(b) isolating nucleic acid material from said sample;(c) amplifying a target locus from said nucleic acid material;(d) contacting said target locus with a set of probes (resequencing probes), wherein said set comprising 8 probes (4 probes based on the sense strand and 4 probes based on the anti-sense strand) per nucleotide base interrogated in each target locus;(e) determining hybridization signal strengths across the set of probes;(f) determining hybridization signal strengths for a plurality of different interrogation probes, each of which is complementary to a section within said target locus;(g) determining the sequence of the target locus by analysis of the hybridization signal strengths of the resequencing probes;(h) comparing the target locus sequence with a set of known sequences to determine the presence and/or antibiotic resistance repertoire of one or more target organisms;(j) defining therapeutic strategy for said patient based on the results of step (h);(l) classifying, diagnosing, prognosing, and/or predicting an outcome of said condition based on the results of step (h).4. A method for parallel detection and strain level-identification of a panel of more than 44 organisms , in parallel with antibiotic resistance profiling of said organisms comprising the steps of:a) extraction of nucleic acids from a patient sample using a rapid optimized ...

SELECTIVE LYSIS OF CELLS

Methods and devices for the selective lysis of cells in a sample comprising micro-organisms such as bacteria are provided. The selective lysis is obtained by incubating the sample in a non-ionic detergent under alkaline conditions. 115-. (canceled)16. A method for the selective lysis of eukaryotic cells within a sample containing or suspected to contain a micro-organism , the method comprising the steps of:providing the sample containing or suspected to contain the micro-organism;adding a non-ionic detergent and a buffer to the sample to obtain a solution with a pH of around 9.5 or higher; andincubating the solution for a time period sufficiently long to lyse eukaryotic cells in the sample.17. The method according to claim 16 , wherein the sample is a mammalian blood sample.18. The method according to claim 17 , wherein the blood sample is whole blood.19. The method according to claim 16 , wherein the micro-organism is a bacterium.20. The method according to claim 16 , wherein the micro-organism is a fungus.21. The method according to claim 16 , wherein the period of time is between 30 seconds and 10 minutes.22. The method according to claim 16 , comprising adding a ratio between a volume of the non-ionic detergent and the buffer and a volume of the sample is between 2/1 and 1/10.23. The method according to claim 22 , wherein the non-ionic detergent is present in a concentration of 0.1 and 5% (w/v % or v/v %).24. The method according to claim 16 , wherein the non-ionic detergent is present in a concentration of 0.1 and 5% (w/v % or v/v %).25. The method according to claim 16 , wherein the non-ionic detergent is selected from the group consisting of Nonidet P40 claim 16 , deoxycholate claim 16 , Igepal CA 630 claim 16 , Triton-X 100 claim 16 , and any combinations thereof.26. The method according to claim 16 , further comprising the step of centrifuging the incubated solution and isolating the micro-organism.27. The method according to claim 16 , further comprising ...

DEVICE AND METHOD FOR THE AUTOMATED ISOLATION AND TRANSFER OF AT LEAST ONE MICROSCOPIC SAMPLE FROM A SAMPLE CARRIER TO A COLLECTING SYSTEM

A device for the automated isolation and transfer of at least one microscopic sample from a sample carrier to a collecting system for subsequent automatic analysis is provided. The device comprises a selection unit for selecting at least one sample located on the sample carrier, a controllable isolation unit for the automated isolation of the at least one selected sample, a controllable transfer unit, which has carrier means for the defined receiving and deposition of the at least one selected isolated sample, for an automated and defined transfer of the at least one selected isolated sample from the sample carrier to the collecting system, and a control unit, which has a data link to the selection unit, the isolation unit and the transfer unit, for an automated isolation and transfer operation. 1. A device for the automated isolation and transfer of at least one microscopic sample from a sample carrier to a collecting system for subsequent automatic analysis , comprising:a selection unit for selecting at least one sample located on the sample carrier;a controllable isolation unit for the automated isolation of the at least one selected sample;a controllable transfer unit, which has carrier means for the defined receiving and defined deposition of the at least one selected isolated sample, for the automated and defined transfer of the at least one selected isolated sample from the sample carrier to the collecting system; anda control unit, which has a data link to the selection unit, the isolation unit and the transfer unit, for an automated isolation and transfer operation.2. The device according to claim 1 , wherein the selection unit comprises a microscope unit and a display unit coupled thereto claim 1 , in particular a touchscreen claim 1 , for displaying the microscopic image of the samples which are available on the sample carrier.3. The device according to claim 2 , wherein the display unit comprises selection means for selecting the at least one sample ...

SOLID REAGENT DISSOLVING DEVICE AND METHOD OF DISSOLVING SOLID REAGENT BY USING THE SAME

A solid reagent dissolving device including a flexible layer; an upper plate disposed on the flexible layer; and a lower plate disposed under the flexible layer, wherein the upper plate comprises a plurality of minute channels, a dissolution chamber connected with the plurality of minute channels, and a protrusion for limiting a flow of a fluid flowing through one of the plurality of minute channels, the lower plate comprises a plurality of penetration holes that correspond to the protrusion and the dissolution chamber, respectively, and one side of each of the plurality of penetration holes, the plurality of minute channels, and the dissolution chamber are covered with the flexible layer, and method of using same. 1. A solid reagent dissolving device comprising:a lower plate;a flexible layer disposed on the lower plate; and a plurality of channels;', 'a dissolution chamber in fluid communication with the plurality of channels; and', 'at least one protrusion that limits flow of fluid through at least one of the plurality of channels;, 'an upper plate disposed on the flexible layer, wherein the upper plate comprises'}wherein the lower plate comprises a plurality of penetration holes in regions of the lower plate that correspond to the protrusion and the dissolution chamber of the upper plate, respectively; andwherein the flexible layer covers each of the plurality of penetration holes, the plurality of channels, and the dissolution chamber.2. The solid reagent dissolving device of claim 1 , further comprising a cover positioned on the upper plate and covering at least a portion of the dissolution chamber.3. The solid reagent dissolving device of claim 1 , wherein a portion of the upper plate corresponding to the dissolution chamber is parallel with the flexible layer.4. The solid reagent dissolving device of claim 1 , wherein each penetration hole comprises an opening in an upper side of the lower plate and an opening on a lower side of the lower plate claim 1 , ...

Nanop article-oligonucleotide hybrid structures and methods of use thereof

The invention relates to hybrid structures comprising an amphiphilic nucleic acid-block co-polymer assembly on the exterior and a nanoparticle core, and methods of use thereof.

SELECTIVE OXIDATION OF 5-METHYLCYTOSINE BY TET-FAMILY PROTEINS

The present invention provides for novel methods for regulating and detecting the cytosine methylation status of DNA. The invention is based upon identification of a novel and surprising catalytic activity for the family of TET proteins, namely TET1, TET2, TET3, and CXXC4. The novel activity is related to the enzymes being capable of converting the cytosine nucleotide 5-methylcytosine into 5-hydroxymethylcytosine by hydroxylation. 1. A kit for modulating gene transcription via hydroxylation of 5-methylcytosine to 5-hydroxymethylcytosine , the kit comprising the following separate components:(a) at least one catalytically active TET family enzyme, functional TET family derivative, TET catalytically active fragment thereof, or combination thereof, or nucleic acid molecule that comprises a sequence encoding at least one catalytically active TET family enzyme, functional TET family derivative, TET catalytically active fragment, or combination thereof in an appropriate buffer or solution; and(b) packaging materials and instructions therein to use said kit to hydroxylate 5-methylcytosine to 5-hydroxymethylcytosine, for the purpose of modulating gene transcription.2. The kit of claim 1 , further comprising at least one reagent suitable for the detection of 5-hydroxymethylcytosine.3. The kit of claim 2 , wherein the reagent suitable for the detection of 5-hydroxymethylcytosine is an antibody claim 2 , an antigen-binding portion thereof claim 2 , an intrabody claim 2 , or a protein claim 2 , that specifically binds to 5-hydroxymethylcytosine.4. The kit of claim 3 , wherein the reagent suitable for the detection of 5-hydroxymethylcytosine is an antibody claim 3 , an antigen-binding portion thereof claim 3 , an intrabody claim 3 , or a protein that is specific for cytosine-5-methylsulfonate.5. A kit for the detection and purification of methylcytosine and 5-hydroxymethylcytosine for use in downstream applications claim 3 , the kit comprising:(a) one or more catalytically ...

LOW RESOURCE PROCESSOR USING SURFACE TENSION VALVES FOR EXTRACTING, CONCENTRATING AND DETECTING MOLECULAR SPECIES

Systems and methods are described for isolation, separation and detection of a molecular species using a low resource device for processing of samples. Methods include isolation, separation and detection of a molecular species for protein-protein, DNA-DNA and other chemical interactions. 1. A method of processing a sample comprising:(a) providing a device comprising a plurality of sequential chambers connected by tubing, each of said sequential chambers comprising a fluid and separated by gas-based surface tension valves, wherein a first reaction chamber comprises a particle having a reactant on its surface;(b) introducing into said first reaction chamber a sample;(c) incubating said first reaction chamber under conditions sufficient to permit reaction of said reactant with an analyte in said sample;(d) transporting said particle from said first reaction chamber into at least a second chamber through tubing disposed therebetween; and(e) detecting interaction of said analyte with said reactant.2. The method of claim 1 , wherein said device comprises at least three chambers.3. The method of claim 2 , wherein said device comprises said first reaction chamber claim 2 , a first processing chamber and a first detection chamber claim 2 , wherein said first processing chamber is disposed between said first reaction chamber and said first action chamber.4. The method of claim 2 , further comprising reversing the transport of said particle to reintroduce said particle into a chamber through which it has already passed.5. The method of claim 1 , wherein said device comprises continuous tubing and surface tension valves separating said tubing into said plurality of chambers.6. (canceled)7. The method of claim 5 , wherein said tubing comprises an inner surface coated by a polymer.8. The method of claim 1 , wherein said particle is a magnetic particle claim 1 , a paramagnetic particle or a non-magnetic particle having a density of >1 or <1.9. The method of claim 8 , wherein ...

Methods and Compositions for Enriching Either Target Polynucleotides or Non-Target Polynucleotides from a Mixture of Target and Non-Target Polynucleotides

Compositions and methods are provided for enriching mitochondrial DNA and optionally chloroplast DNA from eukaryotic cells in a simple rapid method that provides greater than 100 fold enrichment. Affinity protein-coated substrate in a buffer is used to efficiently bind chromosomal DNA and thereby remove it from the buffer. Mitochondrial sequencing reads reveal that non-biased sequence selection providing representation of a substantial proportion of mitochondrial DNA in the eukaryotic cells analyzed. 1. A composition , comprising:eukaryotic cell DNA containing chromosomal DNA and mitochondrial DNA, a matrix coated with methyl binding domain peptide for selectively binding chromosomal DNA contained in a buffer the buffer containing effective amounts of a salt and a non-ionic detergent.2. A composition claim 1 , according to claim 1 , wherein the effective amount of salt is 10 mM-800 mM.3. A composition according to claim 1 , wherein the chromosomal DNA is bound to the magnetic beads claim 1 , and a significant portion of the mitochondrial DNA is unbound in the buffer.4. A composition according to claim 3 , wherein the unbound mitochondrial DNA in the buffer comprises at least a 100 fold enrichment compared to the mitochondrial DNA in the cell DNA.5. A composition according to claim 3 , wherein less than 10% of the chromosomal DNA in the cell DNA is unbound in the buffer.6. A composition according to claim 3 , wherein less than 10% of the mitochondrial DNA in the cell DNA is bound to the magnetic beads coated with methyl binding domain peptide.7. A composition according to claim 3 , wherein at least 90% of the mitochondrial DNA and less than 10% of chromosomal DNA is unbound in the buffer.8. A composition according to claim 1 , wherein the matrix comprises magnetic beads.9. A composition according to claim 1 , wherein the methyl-binding domain (MBD) is selected from the group consisting of UHRF1(SRA) claim 1 , CXX1 claim 1 , DNMT1 claim 1 , MBD or methyl-binding ...

MODIFICATION OF DNA ON MAGNETIC BEADS

Provided herein is technology related to the chemical modification and purification of DNA. Specifically, the technology provides methods for performing a bisulfate conversion reaction on small amounts of single-stranded, fragmented DNA and performing the subsequent desulfonation and purification steps on magnetic beads. 1. A method for treating DNA to quantify DNA methylation , the method comprising contacting a DNA with a sulfonation reagent to produce sulfonated DNA , and binding said sulfonated DNA to a magnetic bead in an alcohol-free binding buffer.2. The method of claim 1 , wherein said DNA is contacted with said sulfonation reagent to produce a mixture comprising sulfonated DNA claim 1 , and wherein said mixture is combined with said magnetic bead in the presence of said alcohol-free binding buffer.3. The method of wherein the sulfonation reagent is ammonium hydrogen sulfite.4. The method of wherein the alcohol-free binding buffer comprises guanidine hydrochloride.5. The method of wherein the binding buffer comprises approximately 7.0 M guanidine hydrochloride.6. The method of wherein the DNA consists of 200 or fewer bases in length.7. The method of wherein the DNA is single stranded.8. The method of further comprising contacting sulfonated DNA bound to said bead with a desulfonation reagent to produce converted DNA claim 1 , and eluting said converted DNA to provide an analytical sample.9. The method of wherein the amount of DNA contacted with said sulfonation reagent is substantially the same as the amount of DNA in the analytical sample.10. The method of wherein a cytosine claim 8 , if present in the DNA prior to sulfonation claim 8 , is converted to a uracil in the DNA in said converted DNA11. The method of wherein a methylcytosine claim 8 , if present in the DNA prior to sulfonation claim 8 , is not converted to a uracil in said converted DNA.12. The method of wherein the magnetic bead is a silica-coated magnetic bead.13. The method of claim 8 , wherein ...

METHOD FOR THE ISOLATION OF PROTEINS BINDING TO ANY KIND NUCLEIC ACID SEQUENCE OF INTEREST

The invention is to supply a novel way for the isolation and identification of proteins bound to any kind of interesting nucleic acid sequence (Sequence-of-Interest: SoI), advantageously to any kind of interesting DNA sequence, particularly in the context of chromosomal DNA or RNA or episomal DNA in living cells or in test tubes. 1. A method for the isolation of the proteins bound to any kind of interesting nucleic acid sequence (Sequence-of-Interest: SoI) , whereinin a first step a Triplex Forming Tags sequence (TFT sequence) is introduced in said nucleic acid sequence of a living cell and said living cells are grown;in a second step cells obtained in step 1 are collected and mixed with a molecular probe specific of the introduced TFT sequence (the TFO probe) in conditions that permit the formation of nucleic acid triplex;in a third step the nucleic acid triplex formed in second step are isolated and bound proteins are analyzed.2. The method according to claim 1 , wherein said interesting nucleic acid sequence is genomic nucleic acid claim 1 , preferably genomic DNA or episomal DNA.3. The method according to claim 1 , wherein said Triplex Forming Tags sequence (TFT sequence) is any nucleic acid sequence that can be used as Tag.4. The method according to claim 3 , wherein said TFT sequence is a sequence that is usually not present in the nucleic acid sequence in which the SoI is present.5. The method according to claim 1 , wherein said TFT sequence is a poly-pyrimidine-poly-purine sequence.6. The method according to claim 1 , wherein said TFT sequence is a short triplex forming Tags sequence (TFT sequence) having a length comprised between 10 to 50 base pairs claim 1 , preferably between 15 to 35 base pairs very preferably of about 20 base pairs long.7. The method according to claim 1 , wherein a further step of cell fragmentation is performed in step 2 when the cells obtained in step 1 are collected and before the mixing with the TFO probe.8. The method according ...

Method for Isolation of Nucleic Acids and a Kit Thereof

The present disclosure provides a method to isolate natural & artificial nucleic acids like deoxyribonucleic acid (DNA), ribonucleic acid (RNA) and peptide nucleic acid (PNA) from a solid or liquid sample using cotton. The cotton packed is such that, a solution containing nucleic acids passes through it and the nucleic acids in solution are bound to the cotton in a medium optimal for binding. The nucleic acids are bound to cotton in such a way that, the bound nucleic acids can withstand multiple washes with liquid comprising water and gets eluted in an aqueous buffer, with which eluted nucleic acids can be directly used for amplification using PCR or for any other biochemical or molecular biology needs.

INTEGRATED ANALYSIS SYSTEM

The invention provides systems, devices, methods, and kits for performing an integrated analysis. The integrated analysis can include sample processing, library construction, amplification, and sequencing. The integrated analysis can be performed within one or more modules that are fluidically connected to each other. The one or more modules can be controlled and/or automated by a computer. The integrated analysis can be performed on a tissue sample, a clinical sample, or an environmental sample. The integrated analysis system can have a compact format and return results within a designated period of time. 120.-. (canceled)21. A microfluidic apparatus comprising:N microfluidic chambers in series, wherein N is at least two;at least one channel fluidically connected to said series of N microfluidic chambers; andat least N+1 reservoirs fluidically connected to said channel.2246.-. (canceled)47. A method , comprising:providing a microfluidic apparatus comprising N chambers in series, wherein N is at least two; at least one channel fluidically connected to said series of N chambers; and at least N+1 reservoirs fluidically connected to said channel, wherein at least one of said chambers or said channel is microfluidic;introducing a first reagent from a first reservoir into a first chamber;introducing a second reagent from a second reservoir into a second chamber; andmixing said first and second reagents within said microfluidic apparatus to form a mixed reaction.48113.-. (canceled)114. An automated system comprising:a first module configured to receive a sample comprising a target polynucleotide and modify said target polynucleotide;a second module fluidically connected to the first module configured to receive said modified polynucleotide and perform a sequencing reaction on said modified polynucleotide; andcomputer logic for controlling the first module and the second module.115223.-. (canceled)224. A method comprising:a) in a microfluidic flow path, performing a first ...

METHODS OF NONSPECIFIC TARGET CAPTURE OF NUCLEIC ACIDS

Methods for capturing a target nucleic acid from a sample by using a capture probe that binds nonspecifically to the target nucleic acid and binds specifically to an immobilized probe via a specific binding pair that has one member on the capture probe and one member on the immobilized probe are disclosed. Compositions that include a capture probe that binds nonspecifically to a target nucleic acid and specifically to an immobilized probe via binding of members of a specific binding pair in a solution phase of a reaction mixture are disclosed. 1. A method for isolating a target DNA from a sample , said method comprising: (i) a randomized poly-(k) sequence that is at least 12 residues in length and comprising G and T nucleotides or G and U nucleotides, or a nonrandom repeating (GU) sequence that is at least 12 residues in length, and', '(ii) a first specific binding partner (SBP), wherein said SBP is capable of specifically binding a second specific binding partner (SBP′);, '1) mixing a sample containing the target DNA in a solution phase with a non-specific capture probe, wherein said non-specific capture probe comprises'}2) incubating a reaction mixture containing (a) the SBP′ immobilized on a support and (b) the mixture of the non-specific capture probe and the sample containing the target DNA, wherein said incubating is under conditions that allow hybridization of the capture probe's poly-(k) sequence with the target DNA and that allow specific binding of the SBP to the SBP′; and3) separating the support from the solution phase of the reaction mixture, thereby isolating the target DNA from other sample components.2. The method of claim 1 , wherein the sample contains cells and is treated before the mixing step to release intracellular components into the solution phase.3. The method of claim 2 , wherein said treatment comprises treating the sample with a solution containing a detergent.4. The method of claim 2 , wherein the sample comprises peripheral blood.5. ...

Compositions for stabilizing dna, rna and proteins in saliva and other biological samples during shipping and storage at ambient temperatures

Compositions and methods are disclosed for substantially liquid, gel, suspension, slurry, semisolid and/or colloid storage of biological samples following admixture with the herein disclosed storage composition, permitting substantial recovery of biological activity following storage without refrigeration. In certain embodiments, unfractionated saliva samples may be stored without refrigeration for weeks, months or years in a form that permits recovery of intact DNA following the storage period.

LATE-PCR

A non-symmetric polymerise chain reaction (PCR) amplification method employing a limiting primer in low concentration whose concentration-adjusted melting point at least equals, and preferably exceeds, that of the excess primer, the latter in turn not being more than 25° C. below the melting temperature of the amplicon. Assays employing such amplification and labeled hybridization probes, including assays that include a detection step following primer extension or a low-temperature probe, or both. Kits for performing such assays and primer or primer-and-probe sets for performing the foregoing amplifications and assays. 149.-. (canceled)50. A method for amplification of at least one single-stranded DNA product via a non-symmetric polymerase chain reaction (PCR) comprising: (i) the at least one PCR primer pair comprises a Limiting Primer and an Excess Primer,', '(ii) the Limiting Primer of said pair is present at a concentration of up to 200 nM, and the Excess Primer of said pair is present at a concentration at least five times higher than the Limiting Primer,', '(iii) an initial, concentration-adjusted melting temperature of the Limiting Primer of said pair that is equal to or greater than an initial, concentration-adjusted melting temperature of the Excess Primer of said pair, when the initial, concentration-adjusted melting temperature is determined using a formula that takes into account initial primer concentration and composition,', '(iv) thermal cycling is repeated a number of times following exhaustion of the Limiting Primer sufficient for linear amplification of at least one single-stranded DNA product which is the extension product of the Excess Primer of said at least one pair of PCR primers; and, "a) thermally cycling a PCR reaction mixture containing at least one DNA or cDNA target, at least one pair of PCR primers for said target, dNTP's, and a thermostable DNA polymerase through repeated cycles of strand melting, primer annealing, and primer extension, ...

Method for linking point of care rapid diagnostic testing results to laboratory-based methods

A method for using a single sample suspected of containing a microorganism for both a local rapid test immunoassay and a remote laboratory test. The sample is collected from a patient at a physician's office or from the environment to be tested. The sample is collected using a swab or other implement, combined with a rapid test processing reagent and a portion of the processed sample is used for the local rapid test. The rapid test processing reagent typically consists of a buffer, a salt, and a detergent and is compatible with the local rapid test immunoassay. Only a portion of the processed sample is used for the local rapid test, leaving a remaining portion of the processed sample to be used in a remote laboratory assay. At least some of the remaining portion of the processed sample is combined with a stabilization agent that preserves at least the nucleic acid in the processed sample for the remote laboratory assay.

Compositions and Methods for Intramolecular Nucleic Acid Rearrangement

Aspects of the present invention are drawn to processes for moving a region of interest in a polynucleotide from a first position to a second position with regard to a domain within the polynucleotide, also referred to as a “reflex method”. In certain embodiments, the reflex method results in moving a region of interest into functional proximity to specific domain elements present in the polynucleotide (e.g., primer sites and/or MID). Compositions, kits and systems that find use in carrying out the reflex processes described herein are also provided. 120-. (canceled)21. A composition comprising a mixture of:a) a first plurality of fragments that have been amplified from different parts of a single nucleic acid molecule of a locus in genomic DNA, wherein each of said first plurality of fragments is appended to a first multiplex identifier (MID) sequence; andb) a second plurality of fragments that have been amplified from different parts of another nucleic acid molecule of said locus, wherein each of said second plurality of fragments is appended to a second MID sequence and said first MID sequence and said second MID are different.22. The composition of claim 21 , wherein said genomic DNA is mammalian genomic DNA.23. The composition of claim 22 , wherein said mammalian genomic DNA is human genomic DNA.24. The composition of claim 21 , wherein said fragments are in the range of 100 to 5 claim 21 ,000 bp in length.25. The composition of claim 21 , wherein said fragments are 400 bp or less in length.26. The composition of claim 21 , wherein:the different parts of said single nucleic acid molecule are distributed along said single nucleic acid molecule; andthe different parts of said another nucleic acid molecule are distributed along said another nucleic acid molecule.27. The composition of claim 26 , wherein:the different parts of said single nucleic acid molecule are distributed along said single nucleic acid molecule at intervals in the range of 250 bp to 5 kb; ...

Labeling and sample preparation for sequencing

The invention provides methods for sequencing and sample preparation for sequencing and amplification.

NUCLEIC ACID AMPLIFICATION

In some embodiments, the present teachings provide methods for nucleic acid amplification, comprising forming a reaction mixture, and subjecting the reaction mixture to conditions suitable for nucleic acid amplification. In some embodiments, methods for nucleic acid amplification include subjecting the nucleic acid to be amplified to partially denaturing conditions. In some embodiments, methods for nucleic acid amplification include amplifying without fully denaturing the nucleic acid that is amplified. In some embodiments, the methods for nucleic acid amplification employ an enzyme that catalyzes homologous recombination and a polymerase. In some embodiments, methods for nucleic acid amplification can be conducted in a single reaction vessel. In some embodiments, methods for nucleic acid amplification can be conducted in a single continuous liquid phase of a reaction mixture, without need for compartmentalization of the reaction mixture or immobilization of reaction components. In some embodiments, methods for nucleic acid amplification comprise a amplifying at least one polynucleotide onto a surface under isothermal amplification conditions, optionally in the presence of a polymer. The polymer can include a sieving agent and/or a diffusion-reducing agent. 1. A method for nucleic acid amplification , comprising:(a) distributing at least two polynucleotides into an array of reaction chambers by introducing a single one of said polynucleotides into at least two of said reaction chambers; and(b) forming at least two substantially monoclonal nucleic acid populations by amplifying the polynucleotides within said at least two reaction chambers, wherein the said at least two reaction chambers are in fluid communication with each other during the amplifying.2. The method of claim 1 , wherein the at least two polynucleotides have different sequences.3. The method of claim 1 , wherein the amplifying is performed without completely denaturing the at least two polynucleotides ...

Method and device for concentrating target compounds

The present invention relates to a method for concentrating one or more target compounds in a liquid sample, a device for carrying out this method and a kit for processing a biological sample comprising such a device.

Reagent for the disruption of cell material having a completely integrated internal standard

The present invention relates to a reagent for the disruption of cell material, containing an internal standard that is completely integrated into the reagent for control and evaluation of the completeness of disruption of the cell material and subsequent steps, comprising a step selected from sample preparation, extraction, enrichment, isolation, purification, reverse transcription, amplification and detection of the cell components obtained from the disrupted cells, or a combination of a plurality or all of these steps.

MICROFLUIDIC DEVICE FOR PRODUCTION AND COLLECTION OF DROPLETS OF A FLUID

A microfluidic device and method for producing and collecting single droplets of a first fluid, the device including a microfluidic platform having at least a droplet microchannel wherein is produced a flow of single droplets of the first fluid dispersed in a second fluid immiscible with the first fluid, the droplet microchannel having at least one inlet extremity and at least one outlet extremity for distributing the flow of droplets, the device further including: 110014111001101191411101111917114. Microfluidic device () for the production and collection of droplets () of a first fluid () , said device () comprising a microfluidic platform () including at least a droplet microchannel () wherein is produced a flow of single droplets () of said first fluid () dispersed in a second fluid () immiscible with the first fluid () , said droplet microchannel () comprising at least one inlet extremity (I) and comprising at least one outlet () extremity for the distribution of said flow of droplets () , [{'b': 120', '121', '14, 'a collection device () comprising a plurality of receiving areas () adapted to collect at least one of said droplets (),'}, {'b': 181', '120', '171', '110, 'means () for changing the relative position of the collection device () and the outlet () of the microfluidic platform (),'}, {'b': 182', '14, 'means () for controlling the flow of droplets (), and'}, {'b': 183', '171', '120', '110, 'means () for synchronizing the flow of droplets at the outlet () of said droplet microchannel and the relative movement of the collection device () with regards to the microfluidic platform ().'}], 'this microfluidic device comprising2100182. Microfluidic device () according to claim 1 , wherein said flow control means () control at least the speed of said flow of droplets and/or the distance between two successive single droplets in said flow of droplets.3100183171119120122120. Microfluidic device () according to claim 1 , wherein said synchronization means () ...

Test Cartridge With Integrated Transfer Module

A system that includes a cartridge housing and a hollow transfer module, according to an embodiment is described herein. The cartridge housing further includes at least one sample inlet, a plurality of storage chambers, a plurality of reaction chambers, and a fluidic network. The fluidic network is designed to connect the at least one sample inlet, a portion of the plurality of storage chambers and the portion of the plurality of reaction chambers to a first plurality of ports located on an inner surface of the cartridge housing. The hollow transfer module includes a second plurality of ports along an outer surface of the transfer module that lead to a central chamber within the transfer module. The transfer module is designed to move laterally within the cartridge housing. The lateral movement of the transfer module aligns at least a portion of the first plurality of ports with at least a portion of the second plurality of ports. 1. A system comprising: at least one sample inlet;', 'a plurality of storage chambers;', 'a plurality of reaction chambers; and', 'a fluidic network connecting the at least one sample inlet, at least a portion of the plurality of storage chambers, and at least a portion of the plurality of reaction chambers to a first plurality of ports located on an inner surface of the cartridge housing; and, 'a cartridge housing comprisinga hollow transfer module, disposed within the cartridge housing, comprising a second plurality of ports along an outer surface of the transfer module that lead to a central chamber of the transfer module, the transfer module configured to move laterally along a length of the cartridge housing, wherein lateral movement of the transfer module aligns at least a portion of the first plurality of ports with at least a portion of the second plurality of ports.2. The system of claim 1 , wherein the cartridge housing further comprises a plurality of processing chambers claim 1 , and wherein the fluidic network also connects at ...

Compositions and methods for sequencing nucleic acids

Disclosed herein are compositions and methods for sequencing nucleic acids.

Methods and apparatus for amplifying nucleic acids

A method of amplifying nucleic acid includes providing a microfluidic device having a space therein. The space is filled with a gel medium. Reagents for carrying out a PCR reaction are supported within the matrix of the gel medium within the space. A nucleic acid containing sample is brought into contact with the gel medium. The sample having whole cells or cell lysate without any prior separation of the nucleic acid from other components of the cells. PCR amplification of nucleic acid from the sample is performed in the space using the PCR reagents.

Compositions and methods for detection of mycobacterium avium paratuberculosis

Disclosed are compositions, assays, methods, diagnostic methods, kits and diagnostic kits for the specific and differential detection of Mycobacterium avium subsp. paratuberculosis from samples including veterinary samples, clinical samples, food samples, forensic sample, an environmental sample (e.g., soil, dirt, garbage, sewage, air, or water), including food processing and manufacturing surfaces, or a biological sample.

FOCUSING CHAMBER

Aspects of the invention relate to devices and methods of use thereof for concentrating, positioning and/or manipulating agents within a fluid, including but not limited to genomic DNA. 125-. (canceled)26. A method of concentrating agents , the method comprising:providing a chamber having a porous substrate;flowing a first fluid flow containing agents into the chamber through a first fluid port and through the porous substrate such that the agents are positioned on the porous substrate;reversing flow through the first fluid port; andflowing a second fluid flow into the chamber from a second fluid port out through the first fluid port during the reversing of flow through the first fluid port.27. The method of claim 26 , wherein claim 26 , during the reversing of flow claim 26 , a portion of the reversed flow exits the chamber out through the first fluid port and a portion of the reversed flow exits the chamber out through a third fluid port.28. The method of claim 26 , further comprising positioning agents on a central portion of the porous substrate.29. The method of claim 26 , wherein the agents are nucleic acids.30. The method of claim 26 , wherein the agents are DNA.31. The method of claim 26 , wherein the step of flowing a first fluid flow into the chamber through the first fluid port is enabled by applying a pressure force above the porous substrate.32. A method of concentrating agents claim 26 , the method comprising:providing a chamber having a porous substrate;flowing a first fluid flow containing agents into the chamber through a first fluid port and through the porous substrate such that the agents are positioned on the porous substrate; andreversing flow through the first fluid port,wherein a portion of the reversed flow exits the chamber out through the first fluid port and a portion of the reversed flow exits the chamber out through a second fluid port.33. The method of claim 32 , further comprising positioning agents on a central portion of the porous ...

Apparatus and Methods for Integrated Sample PReparation, Reaction and Detection

Cartridges for the isolation of a biological sample and downstream biological assays on the sample are provided, as are methods for using such cartridges. In one embodiment, a nucleic acid sample is isolated from a biological sample and the nucleic acid sample is amplified, for example by the polymerase chain reaction. The cartridges provided herein can also be used for the isolation of non-nucleic acid samples, for example proteins, and to perform downstream reactions on the proteins, for example, binding assays. Instruments for carrying out the downstream biological assays and for detecting the results of the assays are also provided.

TRANSCRIPTOME IN VIVO ANALYSIS

Provided are compositions and methods that permit a hybrid nucleic acid-peptide molecule to enter a cell and when specifically activated within the cell, the molecule anneals to endogenous cellular RNA and permits the isolation of the RNA. 1. A hybrid nucleic acid-peptide molecule comprising:a) a first, second, and third oligomer, wherein the first oligomer is linked to the second oligomer through a first photocleavable linker and the second oligomer is linked to the third oligomer through a second photocleavable linker;b) a label for isolating nucleic acids;c) a peptide moiety comprising a cell penetrating peptide (CPP).2. The molecule of claim 1 , wherein the first oligomer is at least an 18mer fluoro claim 1 , wherein the second oligomer is at least a poly-A 7mer claim 1 , and the third oligomer is at least a poly-A 7mer.3. The molecule of claim 1 , wherein the first oligomer is at least an 18mer 2′-fluoro claim 1 , wherein the second oligomer is at least a poly-A 14mer claim 1 , and the third oligomer is at least a poly-A 14mer.4. The molecule of claim 1 , wherein the molecule is caged in the absence of cleavage of the photocleavable linker.5. The molecule of claim 1 , wherein the molecule is uncaged in the presence of cleavage of the photocleavable linker.6. The molecule of claim 1 , wherein the label is linked to the first oligomer.7. The molecule of claim 1 , wherein the label is biotin.8. The molecule of claim 1 , wherein the CPP is linked to the third oligomer.9. A method of isolating cellular RNA in a live cell claim 1 , the method comprising the steps of: introducing the molecule of into a cell claim 1 , activating the cell under conditions suitable for binding of the nucleic acid portion of the hybrid molecule to cellular RNA wherein the activation cleaves the photocleavable linkers in the molecule claim 1 , allowing the formation of a hybridized nucleic acid molecule/cellular RNA complex claim 1 , and isolating the hybridized nucleic acid molecule/ ...

Ambient temperature stable kits for molecular diagnostics

A method for processing DNA polymerase and/or dNTPs for use in an amplification procedure, includes providing a solution mixture, the solution mixture including a DNA polymerase and/or dNTPs, a buffer solution and at least one stabilizing agent and hydration reducing the solution mixture. The solution mixture is hydration reduced at a temperature between 0° C. and about 100° C.

Transcriptome In Vivo Analysis

The invention provides compositions and methods that permit a hybrid nucleic acid molecule to enter a cell and when specifically activated within the cell, the molecule anneals to endogenous cellular RNA and permits the isolation of the RNA. 1. A hybrid nucleic acid molecule comprising:a) a first, second, and third oligomer, wherein the first oligomer is linked to the second oligomer through a first photocleavable linker and the second oligomer is linked to the third oligomer through a second photocleavable linker;b) a label for isolating nucleic acids;c) a cell penetrating domain (CPD).2. The molecule of claim 1 , wherein the first oligomer is at least an 18mer 2′-fluoro claim 1 , wherein the second oligomer is at least a poly-A 7mer claim 1 , and the third oligomer is at least a poly-A 7mer.3. The molecule of claim 1 , wherein the first oligomer is at least an 18mer 2′-fluoro claim 1 , wherein the second oligomer is at least a poly-A 14mer claim 1 , and the third oligomer is at least a poly-A 14mer.4. The molecule of claim 1 , wherein the molecule is caged in the absence of cleavage of the photocleavable linker.5. The molecule of claim 1 , wherein the molecule is uncaged in the presence of cleavage of the photocleavable linker.6. The molecule of claim 1 , wherein the label is linked to the first oligomer.7. The molecule of claim 1 , wherein the label is biotin.8. The molecule of claim 1 , wherein the CPD is linked to the third oligomer.9. The molecule of claim 1 , wherein the CPD is a cell-penetrating peptide.10. The molecule of claim 1 , wherein the CPD comprises folate.11. The molecule of claim 1 , wherein the CPD directs the entry of the molecule into a specific cell population.12. The molecule of claim 1 , wherein the CPD directs entry of the molecule into a subcellular compartment.12. The molecule of claim 1 , wherein the CPD directs entry of the molecule into the nucleus of a cell.13. A hybrid nucleic acid molecule comprising:a) a first and second oligomer, ...

High-Throughput Single Cell Barcoding

Methods and compositions for high-throughput, single cell analyses are provided. The methods and compositions can be used for analysis of genomes and transcriptomes, as well as antibody discovery, HLA typing, haplotyping and drug discovery. 120-. (canceled)21. A bead , comprisinga first bar code and a second bar code, wherein the second bar code is an amplified product of the first bar code.22. The bead of claim 21 , further comprising one or more target polynucleotides from an isolated single cell.23. The bead of claim 22 , wherein the one or more target polynucleotides comprise a heavy chain mRNA and a light chain mRNA.24. A method of bar coding one or more target polynucleotides claim 22 , comprising performing a reverse transcription reaction on the bead of .25. The method of claim 24 , wherein the bead is isolated with the single cell.26. The method of claim 25 , wherein the bead and the single cell are isolated in an oil and water emulsion.27. The method of claim 26 , wherein the single cell is lysed.28. The method of claim 25 , wherein the isolated single cell is a B-cell.29. The bead of claim 21 , wherein the first bar code is comprised in a first polynucleotide claim 21 , comprising: a first sequencing primer region claim 21 , the first barcode claim 21 , and a first annealing primer region.30. The bead of claim 29 , further comprising a third bar code identical to the first bar code claim 29 , and the third bar code is comprised in a second polynucleotide comprising: a second sequencing primer region claim 29 , the third bar code claim 29 , and a second annealing primer region that is not identical to the first annealing primer region.31. The method of claim 24 , further comprising claim 24 , amplifying the one or more bar coded target polynucleotides.32. The method of claim 31 , further comprising sequencing two or more of the amplified claim 31 , bar coded target polynucleotides.33. The method of claim 32 , further comprising correlating one of the two ...

INTEGRATED SAMPLE PREPARATION SYSTEMS AND STABILIZED ENZYME MIXTURES

The present invention provides integrated sample preparation systems and stabilized enzyme mixtures. In particular, the present invention provides microfluidic cards configured for processing a sample and generating DNA libraries that are suitable for use in sequencing methods (e.g., next generation sequencing methods) or other suitable nucleic acid analysis methods. The present invention also provides stabilized enzyme mixtures containing an enzyme (e.g., an enzyme used in whole genome amplification), BSA, and a sugar. Such enzyme mixtures may be lyophilized and stored at room temperature without significant loss of enzyme activity for months. 1. A microfluidic card comprising:a) a loading port configured for introduction of a biological sample; i) a nucleic acid extraction component configured to bind nucleic acids present in said biological sample;', 'ii) a wash buffer;', 'iii) an elution buffer; and', 'iv) a component configured for moving said elution buffer over said nucleic acid extraction component to generate a mixture of extracted nucleic acids; and, 'b) a nucleic acid extraction sub-circuit wherein said nucleic acid extraction sub-circuit comprisesc) an amplification sub-circuit, wherein said amplification sub-circuit comprises an enzyme mixture, wherein said enzyme mixture comprises at least one amplification-related enzyme useful for performing amplification on said extracted nucleic acid to generate amplified nucleic acid, i) a reagent mixture configured for digesting nucleic acid to generate fragmented nucleic acid; and/or', 'ii) a fragmentation component configured for mechanically fragmenting nucleic acid to generate fragmented nucleic acid; and', 'iii) at least one type of enzyme configured for polishing the ends of said fragmented nucleic acid; and, 'd) a fragmentation sub-circuit, wherein said fragmentation sub-circuit comprises i) nucleic acid linkers configured for use in sequencing methods;', 'ii) a ligation enzyme mixture configured for ...

EXTRACTION OF NUCLEIC ACIDS FROM WAX-EMBEDDED SAMPLES

The present invention relates to a method for extracting nucleic acids from a wax-embedded sample, the use of particular solvents for removing wax from a wax-embedded sample in a method for extracting, isolating and/or purifying nucleic acids from a crosslinked wax-embedded sample as well as to a kit for extracting, isolating and/or purifying nucleic acids from a wax-embedded sample. 115-. (canceled)16. A method for extracting nucleic acids from a wax-embedded sample , comprising:(1) contacting the sample with a wax-solubilizing agent comprising at least one organic solvent immiscible with water,(2) optionally incubating the mixture obtained in step (1),(3) adding an aqueous lysis buffer to the mixture still comprising the wax-solubilizing agent, and(4) incubating the mixture obtained in step (3) to obtain a bi- or multi-phasic mixture, comprising at least an organic phase, said organic phase consisting essentially of the dissolved wax and the wax-solubilizing agent, and an aqueous phase, said aqueous phase comprising the nucleic acids, wherein steps (1) and (3) may as well be carried out as one combined step.17. The method according to claim 16 , further comprising:(5) optionally separating the organic phase from the aqueous phase, and(6) isolating and/or purifying the nucleic acids from the aqueous phase.18. The method according to claim 16 , wherein the sample is a paraffin embedded sample claim 16 , and the wax-solubilizing agent comprises at least one organic solvent19. The method according to claim 18 , wherein the paraffin embedded sample is a formalin-fixed paraffin-embedded sample (FFPE-sample).20. The method according to claim 18 , wherein the at least one organic solvent is selected from the group consisting of linear claim 18 , branched and cyclic C-Calkanes and mixtures thereof.21. The method according to claim 18 , wherein the at least one organic solvent is selected from the group consisting of C-Calkanes and mixtures thereof.22. The method according ...

NUCLEIC ACID AMPLIFICATION

In some embodiments, the present teachings provide methods for nucleic acid amplification, comprising forming a reaction mixture, and subjecting the reaction mixture to conditions suitable for nucleic acid amplification. In some embodiments, methods for nucleic acid amplification include subjecting the nucleic acid to be amplified to partially denaturing conditions. In some embodiments, methods for nucleic acid amplification include amplifying without fully denaturing the nucleic acid that is amplified. In some embodiments, the methods for nucleic acid amplification employ an enzyme that catalyzes homologous recombination and a polymerase. In some embodiments, methods for nucleic acid amplification can be conducted in a single reaction vessel. In some embodiments, methods for nucleic acid amplification can be conducted in a single continuous liquid phase of a reaction mixture, without need for compartmentalization of the reaction mixture or immobilization of reaction components. In some embodiments, methods for nucleic acid amplification comprise a amplifying at least one polynucleotide onto a surface under isothermal amplification conditions, optionally in the presence of a polymer. The polymer can include a sieving agent and/or a diffusion-reducing agent. 120-. (canceled)21. A method for nucleic acid amplification , comprising:(a) forming a reaction mixture including a continuous liquid phase containing a plurality of supports, a plurality of different polynucleotide templates, a recombinase and a polymerase; and(b) clonally amplifying, within the continuous liquid phase, at least two of the polynucleotide templates onto different supports under isothermal amplification conditions.22. The method of claim 21 , wherein at least two of the supports include a primer having a sequence that is complementary to a sequence within a polynucleotide template of the reaction mixture.23. The method of claim 21 , wherein at least two of the supports each include no more than ...

Development of a New Isolation Method with Higher Selectivity and Efficiency

A sample extraction method with improved sensitivity for capture of trace amounts of target by utilizing a target-specific enzyme, and covalently bonding the target for capture and immobilization on an activated surface.

POLYMERASE

The present invention relates to an engineered polymerase with an expanded substrate range characterised in that the polymerase is capable of incorporating an enhanced occurrence of detection agent-labelled nucleotide analogue into nucleic acid synthesised by that engineered polymerase as compared with the wild type polymerase from which it is derived. 1. An engineered polymerase with an expanded substrate range characterised in that the polymerase is capable of incorporating an enhanced occurrence of detection agent-labelled nucleotide analogue into nucleic acid synthesised by that engineered polymerase as compared with the wild type polymerase from which it is derived.2. The engineered polymerase according to wherein the agent-labelled nucleotide analogue is a dye labelled nucleotide analogue.3. The engineered polymerase according to wherein the agent-labelled nucleotide analogue is a fluorescent labelled nucleotide analogue.4. The engineered polymerase according to wherein the fluorescent label is selected from the group consisting of Alexa Fluor™ dye claim 3 , diethylaminocoumarin claim 3 , tetramethylrhodamine claim 3 , N-methylanthraniloyl claim 3 , trinitrophenyl claim 3 , etheno derivatives claim 3 , biotin claim 3 , fluorescein claim 3 , or carbocyanine.5. The engineered polymerase according to wherein the agent-labelled nucleotide analogue is a carbocyanine labelled nucleotide analogue.6. The engineered polymerase according to which is a DNA polymerase.7. The engineered polymerase according to claim 2 , wherein the dye labelled nucleotide analogue is selected from the group consisting of Cy5-dNTP and Cy3-dNTP.8. (canceled)9. The engineered polymerase according to wherein the polymerase has one or more of the following mutations: V337I claim 6 , E399D claim 6 , N400D claim 6 , R407I and/or Y546H.10. The engineered polymerase according to comprising the amino acid sequence designated SEQ ID NO: 1.11. The engineered polymerase according to comprising an amino ...

Method for Isolation of Nucleic Acid Containing Particles and Extraction of Nucleic Acids Therefrom

A method for extracting nucleic acids from a biological sample by isolating nucleic acid-containing particles from the biological sample by one or more centrifugation procedures, performing one or more steps to mitigate adverse factors that prevent or might prevent high quality nucleic acid extraction, and extracting nucleic acids from the isolated particles. The centrifugation procedures are performed at a speed not exceeding about 200,000 g. The extracted nucleic acids contain both 18S and 28S rRNA. 1. A method for extracting nucleic acids from a biological sample , comprising the steps of:a. isolating nucleic acid-containing particles from the biological sample by one or more centrifugation procedures, wherein none of the centrifugation procedures are performed at a speed exceeding about 200,000 g;b. performing one or more steps to mitigate adverse factors that prevent or might prevent high quality nucleic acid extraction; andc. extracting nucleic acids from the isolated particles.2. The method of claim 1 , wherein the nucleic acid-containing particles are microvesicles claim 1 , RNA-protein complexes claim 1 , DNA-protein complexes claim 1 , or a combination of any of microvesicles claim 1 , RNA-protein complexes claim 1 , and DNA-protein complexes.3. The method of claim 1 , wherein the nucleic acid-containing particles are microvesicles.4. The method of claim 1 , wherein the nucleic acid-containing particles are RNA-protein complexes.5. The method of claim 1 , wherein the nucleic acid-containing particles are DNA-protein complexes.6. The method of claim 1 , wherein all of the centrifugation procedures are performed at speeds of about 2 claim 1 ,000 g to about 200 claim 1 ,000 g.7. The method of claim 1 , wherein none of the centrifugation procedures are performed at a speed exceeding about 50 claim 1 ,000 g.8. The method of claim 1 , wherein none of the centrifugation procedures are performed at a speed exceeding about 20 claim 1 ,000 g.9. The method of claim 1 ...

Pretreatment method of biological sample, detection method of rna, and pretreatment kit

The present invention is to provide a pretreatment method that allows RNA to be detected promptly and simply. RNA degradation activity due to lactoferrin present in the human rhinal mucosa is inhibited, for example, by adding iron ion and carbonate ion to a biological sample that contains the human rhinal mucosa. With the pretreated biological sample, an RNA virus gene can be amplified by a reverse transcriptase. Iron ion and carbonate ion can also inhibit reverse transcriptase inhibition due to lysozyme C contained in the human rhinal mucosa. Further, it is preferable to remove the envelope of the RNA virus by adding SDS to the biological sample that contains the human rhinal mucosa.

MODIFIED SURFACES AS SOLID SUPPORTS FOR NUCLEIC ACID PURIFICATION

The invention relates to methods of separating polynucleotides, such as DNA, RNA and PNA, from solutions containing polynucleotides by reversibly binding the polynucleotides to a solid surface, such as a magnetic microparticle. 2. (canceled)3. The method of claim 1 , wherein the surface comprises a polymeric polyol.4. The method of claim 3 , wherein the polymeric polyol is Dextran.514-. (canceled)15. The method of claim 1 , wherein the surface is on one or more magnetic microparticles.16. The method of claim 1 , wherein the salt concentration is a concentration of one or more salts comprising at least one of sodium chloride claim 1 , magnesium chloride claim 1 , calcium chloride claim 1 , potassium chloride claim 1 , lithium chloride claim 1 , barium chloride claim 1 , cesium chloride claim 1 , sodium perchlorate claim 1 , guanidinium isothiocyanate claim 1 , guanidinium hydrochloride claim 1 , potassium iodide claim 1 , and sodium iodide.17. (canceled)18. The method of claim 16 , wherein the organic solvent concentration is a concentration of one or more organic solvents comprising at least one of a C1 to C5 alcohol claim 16 , a polyethylene glycol claim 16 , a dimethyl sulfoxide claim 16 , or an acetone.1921-. (canceled)22. The method of claim 1 , wherein the polynucleotide solution comprises a lysate of blood claim 1 , a blood fraction claim 1 , fresh tissue claim 1 , fixed tissue claim 1 , or a cultured cell.2325-. (canceled)26. The method of claim 1 , wherein the polynucleotide is a DNA.27. The method of claim 1 , wherein the polynucleotide is a RNA.28. (canceled)29. The method of claim 1 , further comprising preparing the solution claim 1 , wherein preparing the solution comprises performing an RNA amplification reaction claim 1 , an in vitro transcription reaction claim 1 , a reverse transcription reaction claim 1 , a second strand DNA synthesis reaction claim 1 , a DNase reaction claim 1 , and/or or a PCR reaction.3035-. (canceled)36. The method of claim 1 , ...

PROCESS FOR ISOLATING MICROORGANISMS

A process for isolating microorganisms is disclosed. The process utilizes a device comprising an inner surface, an outer surface, a first port, and a second port, wherein the inner surface comprises an unmodified, smooth glass substrate and defines a binding chamber providing fluid communication between the first port and second port. Microorganisms in an aqueous solution are contacted with the unmodified, smooth glass substrate, wherein the solution is essentially free of cell precipitants, and the microorganisms are allowed to bind to the glass substrate. 1. A process for isolating microorganisms comprising:providing a device comprising an inner surface, an outer surface, a first port, and a second port, wherein the inner surface comprises an unmodified, smooth glass substrate and defines a binding chamber providing fluid communication between the first port and the second port;contacting microorganisms in an aqueous solution with the unmodified, smooth glass substrate, wherein the solution is essentially free of cell precipitants; andallowing the microorganisms to bind to the glass substrate to provide bound cells.2. The process of further comprising separating the aqueous solution from the bound microorganisms.3. The process of further comprising claim 2 , following the separating step claim 2 , adding a growth medium to the bound microorganisms and incubating the bound microorganisms claim 2 , whereby the bound microorganisms increase in number.4. The process of claim 1 , further comprising lysing the bound microorganisms to produce a lysate.5. The process of claim 4 , further comprising:adding a chaotropic salt to the lysate, whereby nucleic acid within the lysate binds to the unmodified, smooth glass surface; andwashing the bound nucleic acid to provide isolated nucleic acid.6. The process of further comprising amplifying the isolated nucleic acid.7. The process of wherein the amplifying step comprises isothermal amplification.8. The process of wherein the ...

BUFFER FOR ONE-STEP DNA EXTRACTION

DNA is extracted from epithelial cells and other cells without cell walls, by use of a DNA extraction buffer that contains a C-Calcohol, a cell lysis detergent, and a buffering agent maintained at a slightly basic pH. The cells are immersed in the buffer and gently agitated at ambient temperature, and DNA extraction and precipitation occur in thirty minutes or less, and often in five minutes or less. 1. A process for extracting DNA from cells without cell walls , said process comprising:{'sub': 1', '4, '(a) immersing said cells in an aqueous solution comprising a C-Calcohol at from about 50% to about 85% by weight, a cell lysis detergent at from about 0.05% to about 0.5% by weight, and a buffering agent maintaining a pH of from about 7.5 to about 9.0, and substantially no protease, substantially no reducing agent, and substantially no non-detergent, inorganic salt, at a temperature of from about 15° C. to about 35° C. for from about five seconds to about thirty minutes, to cause DNA to be liberated from said cells and to precipitate; and'}(b) recovering said DNA so precipitated from said aqueous solution.2. The process of wherein said C-Calcohol is a member selected from the group consisting of methanol claim 1 , ethanol claim 1 , and isopropanol.3. The process of wherein said C-Calcohol is isopropanol or a mixture of isopropanol and ethanol.4. The process of wherein said cell lysis detergent is a denaturing detergent.5. The process of wherein said cell lysis detergent is a member selected from the group consisting of anionic and zwitterionic detergents.6. The process of wherein said cell lysis detergent is an anionic detergent.7. The process of wherein said cell lysis detergent is a member selected from the group consisting of sodium dodecyl sulfate claim 1 , sodium octadecyl sulfate claim 1 , and sodium decyl sulfate.8. The process of wherein said cell lysis detergent is sodium dodecyl sulfate.9. The process of wherein said C-Calcohol is a member selected from the ...

FLUIDIC DEVICES AND SYSTEMS FOR SAMPLE PREPARATION OR AUTONOMOUS ANALYSIS

The present invention relates to fluidic devices for preparing, processing, storing, preserving, and/or analyzing samples. In particular, the devices and related systems and methods allow for preparing and/or analyzing samples (e.g., biospecimen samples) by using one or more of capture regions and/or automated analysis. 1. A device comprising:(i) a first layer comprising a plurality of first chambers;(ii) a second layer comprising one or more second chambers; and(iii) an intermediate layer disposed between said first and second layers, wherein said intermediate layer comprises one or more capture regions,wherein at least one of said plurality of first chambers, at least one of said one or more second chambers, and at least one of said one or more capture regions are able to be connected by relative movement.2. The device of claim 1 , wherein said one or more capture regions comprise a filter claim 1 , a matrix claim 1 , a polymer claim 1 , a charge switch material claim 1 , or a membrane.3. The device of claim 1 , wherein said one or more capture regions are configured to connect two or more of said plurality of first chambers and at least one of said one or more second chambers.4. The device of claim 1 , wherein said intermediate layer comprises a continuous membrane.5. The device of claim 1 , wherein said first layer claim 1 , said second layer claim 1 , or said intermediate layer is planar or non-planar.6. The device of claim 1 , wherein said first layer claim 1 , said second layer claim 1 , or said intermediate layer claim 1 , or a portion thereof claim 1 , is differentially wetted.7. The device of claim 1 , further comprising a deformable layer between said first layer and said intermediate layer and/or between said second layer and said intermediate layer.8. The device of claim 7 , further comprising a coating on one or more of said first layer claim 7 , said intermediate layer claim 7 , said second layer claim 7 , or said deformable layer.9. The device of ...

SELECTIVE ENRICHMENT OF NUCLEIC ACIDS

Methods for the selective enrichment of nucleic acids. 1. A method for selective enrichment of a nucleic acid , said method comprising the steps of:(a) obtaining a population of nucleic acids, wherein at least some of the nucleic acids in said population comprise a target;(b) contacting said population of nucleic acids with a nickase, thereby producing a population of nicked nucleic acids;(c) contacting said population of nicked nucleic acids with an exonuclease, thereby generating a nucleic acid having a single-stranded portion, wherein said single-strand portion comprises at least a portion of said target;(d) contacting a capture probe to said at least a portion of said target, wherein said probe hybridizes to said target; and(e) separating a nucleic acid hybridized to said capture probe from a nucleic acid not bound to said capture probe.2. The method of further comprising the step of releasing said hybridized nucleic acid from said capture probe.3. The method of claim 1 , further comprising amplifying said target.4. The method of claim 1 , further comprising sequencing at least a portion of said target.5. The method of claim 1 , wherein step (a) further comprises selecting for a population of nucleic acids having an average length greater than about 10 kb.6. The method of claim 1 , wherein step (a) further comprises:contacting the population of double stranded nucleic acids with a type II restriction endonuclease comprising an isoschizomer of said nickase; andrecircularizing said cut double stranded nucleic acids under conditions that favor intramolecular recircularization of individual nucleic acids.7. The method of claim 6 , wherein said restriction endonuclease comprises BbvCI.8. The method of claim 1 , wherein said nickase is selected from Nb.BbvCI and Nt.BbvCI.9. The method of claim 1 , wherein said probe comprises a capture moiety.10. The method of claim 9 , wherein said capture moiety comprises biotin.11. The method of claim 10 , wherein said separating ...

Methods for nucleic acid manipulation

A method for replicating and amplifying a target nucleic acid sequence is described. A method of the invention involves the formation of a recombination intermediate without the prior denaturing of a nucleic acid duplex through the use of a recombination factor. The recombination intermediate is treated with a high fidelity polymerase to permit the replication and amplification of the target nucleic acid sequence. In preferred embodiments, the polymerase comprises a polymerase holoenzyme. In further preferred embodiments, the recombination factor is bacteriophage T4 UvsX protein or homologs from other species, and the polymerase holoenzyme comprises a polymerase enzyme, a clamp protein and a clamp loader protein, derived from viral, bacteriophage, prokaryotic, archaebacterial, or eukaryotic systems.

FUNGAL NUCLEIC ACID EXTRACTION

The invention provides methods for extraction of fungal (e.g., yeast spp., filamentous fungal spp.) nucleic acid (e.g., DNA, RNA) from a sample (e.g., be human or veterinary clinical or research samples, agricultural samples, agricultural commodity samples, food products, or environmental samples). In some embodiments, the present invention provides enhanced nucleic acid extraction from samples comprising fungal cell(s) wherein enzymatic (e.g., lysostaphin treatment, lyticase treatment) sample treatment is performed in combination with mechanical (e.g., bead beating) sample treatment. 1. A method of extracting fungal nucleic acid from a sample , comprising:a) subjecting said sample to enzymatic treatment;b) subjecting said sample to mechanical treatment; andc) extracting said nucleic acid from said sample.2. The method of claim 1 , wherein said enzymatic treatment is selected from the group consisting of lysostaphin treatment and lyticase treatment.3. The method of claim 1 , wherein said enzymatic treatment comprises treatment with lysostaphin and lyticase.4. The method of wherein said mechanical treatment is selected from the group consisting of bead beating claim 1 , grinding claim 1 , sonication claim 1 , extrusion claim 1 , freezing claim 1 , freeze-thawing claim 1 , exposure to pressure exceeding 1 atm claim 1 , exposure to pressure below 1 atm claim 1 , exposure to temperature above 37 degrees C. claim 1 , exposure to temperature below 10 degrees C. claim 1 , treatment with a hammer mill claim 1 , treatment with a knife mill claim 1 , treatment with a ball mill claim 1 , treatment with a homogenizer claim 1 , treatment with a chipping machine claim 1 , treatment with a grinding machine claim 1 , treatment with a French press claim 1 , treatment with an extrusion device claim 1 , and irradiation.5. The method of claim 1 , wherein said mechanical treatment comprises bead beating.6. The method of claim 1 , further comprising treatment of said sample with protease ...

INTEGRATED VERSATILE KIT FOR ISOLATING COMPONENTS IN BIOLOGICAL SAMPLES

The instant invention provides an intergrated kit with solutions and instruments to isolate various biological samples from biological samples. The kit enables an user to preserve specimens and isolate biomolecules with features and benefits of high quality, easy, fast, no toxicity, safe to user and environment, low demanding, cost-effective, reducing waste, saving nature resources and protecting environment, and leads to a low-carbon and Green economy in preparation of specimens. The integrated kit enables the user to extract biomolecules including DNA/ccfDNA, Large RNA/mRNA/ccfRNA, Small RNA/miRNA/ccfmiRNA, Protein, Lipid, Carbohydrates, and Metabolite using one seamless procedure. 1. A kit , comprising:a core module and a plug-in module comprising of a lysis solution, to be added to a biological sample, capable of inhibiting endogenous degrading enzymes to preserve the biological specimen, extracting and isolating a component in the biological sample, wherein the lysis solution is selected from the group consisting of a lysis solution 1, lysis solution 2, lysis solution 3 and lysis solution 4; wherein the component of the biological sample is a DNA/ccfDNA, Large RNA/mRNA/ccfRNA, Small RNA/miRNA/ccfmiRNA, protein, lipid, carbohydrate, and metabolite, wherein the extraction does not use toxic phenol/chloroform extraction.2. The kit of claim 1 , wherein the core module kit contains a protecting claim 1 , lysis and inhibiting solution selected from the group consisting of a lysis solution 1 claim 1 , lysis solution 2 claim 1 , lysis solution 3 and lysis solution 4 for processing the biological sample.3. The kit of claim 1 , wherein the plug-in module contains a Affinity column claim 1 , magnetic bead and Con-A column for processing the biological specimen without using toxic phenol/chloroform extraction process.4. The kit of claim 1 , wherein the biological sample comprises of (a) a solid specimen including but not limited to a Tissue claim 1 , Frozen tissue section ...

Methods and Compositions for Isolating Template Nucleic Acids

The present invention is directed to methods and compositions for isolating template nucleic acids containing target sequences of interest, wherein those isolated template nucleic acids can be further assessed for information related to sequence and nucleic acid modifications. 1. A method for isolating template nucleic acids containing one or more target sequences , said method comprising:(a) providing a population of circular template nucleic acids, wherein a plurality of said population of circular template nucleic acids comprises said one or more target sequences; (i) one of said population of circular template nucleic acids, and', '(ii) a linear nascent strand comprising at least one copy of a sequence complementary to said one or more target sequences;, '(b) amplifying said population of template nucleic acids with a strand displacing polymerase to produce amplified template nucleic acids, wherein said amplified template nucleic acids each comprise(c) applying one or more affinity handles to said amplified template nucleic acids, wherein said one or more affinity handles associate with said at least one copy of a sequence complementary to said one or more target sequences;(d) separating amplified template nucleic acids associated with said affinity handles from amplified template nucleic acids not associated with said affinity handles;thereby isolating said template nucleic acids containing one or more target sequences.2. The method of claim 1 , wherein said population of circular template nucleic acids comprises genomic DNA.3. The method of claim 1 , wherein said circular template nucleic acids comprise a single-stranded portion and a double-stranded portion.4. The method of claim 1 , wherein said circular template nucleic acids are single stranded or double stranded.5. The method of claim 1 , wherein said template nucleic acids comprise:(a) a first strand segment;(b) a second strand segment substantially complementary to said first strand segment;(c) a first ...

INHIBITOR LEACHING RESISTANT NUCLEIC ACID STORAGE REAGENT

The invention provides compositions and methods related to a nucleic acid storage reagent. 1. A composition , comprising Tris , ethylenediaminetetraacetic acid (EDTA) , and sodium azide (NaN) , wherein the composition has been previously exposed to an artificial source of ultraviolet irradiation.2. The composition of claim 1 , wherein the composition is a liquid.3. The composition of claim 1 , wherein the composition is dry.4. The composition of claim 1 , wherein the composition is lyophilized.5. The composition of claim 1 , wherein the composition is a solution and wherein Tris is present in an amount of 1.0 mM to 50 mM claim 1 , EDTA is present in an amount of 0.05 mM to 2.0 mM claim 1 , and NaNis present in an amount of 0.01 to 0.3%.6. The composition of claim 1 , wherein the exposure to ultraviolet irradiation is for at least 15 minutes.7. The composition of claim 6 , wherein the exposure to ultraviolet irradiation is for 1 to 4 hours.8. The composition of claim 1 , wherein the ultraviolet irradiation is at a wavelength range from 250 to 320 nm.9. A container claim 1 , comprising:{'sub': '3', '(a) a composition comprising Tris, EDTA, and NaN, wherein the composition has been previously exposed to an artificial source of ultraviolet irradiation; and'}(b) a nucleic acid.10. The container of claim 9 , wherein (a) and (b) are frozen.11. The container of claim 9 , wherein the container is plastic.12. The container of claim 11 , wherein the plastic comprises a polypropylene claim 11 , a polystyrene claim 11 , a polycarbonate claim 11 , a cyclo-olefin claim 11 , or a mixture thereof.13. The container of claim 9 , wherein the nucleic acid has not been previously exposed to an artificial source of ultraviolet irradiation.14. The container of claim 9 , wherein the nucleic acid is a DNA or cDNA.15. The container of claim 9 , wherein (a) and (b) are in a solution and wherein Tris is present in an amount of 1.0 mM to 50 mM claim 9 , EDTA is present in an amount of 0.05 mM to ...

Methods and Compositions for Segregating Target Nucleic Acid from Mixed Nucleic Acid Samples

The invention provides methods, compositions and kits for segregating a target nucleic acid from a mixed nucleic acid sample. The methods, compositions and kits comprise a non-processive endonuclease (e.g., a restriction enzyme) or an antibody that binds the target nucleic acid (e.g., has methylation specificity). The mixed nucleic acid sample can comprise prokaryotic and eukaryotic nucleic acid and/or nucleic acid from more than one prokaryotic or eukaryotic organisms. 180-. (canceled)81. A kit for segregating a target nucleic acid from a mixed sample containing a target nucleic acid and a non-target nucleic acid , comprising:(i) a non-processive endonuclease that binds to the target nucleic acid, but does not cleave the target nucleic acid; and(ii) a buffer having conditions suitable for the non-processive endonuclease to bind the target nucleic acid, but not cleave the target nucleic acid.82. The kit of claim 81 , wherein the buffer contains a Ca2+ concentration of at least 50 mM.83. The kit of claim 81 , wherein the buffer contains a Ca2+ concentration that is at least 500 times greater than the Mg2+ concentration of the buffer.84. The kit of claim 81 , wherein the buffer contains a Mg2+ concentration of less than 10 mM.85. The kit of claim 81 , wherein the buffer contains EDTA at a concentration of at least 10 mM.86. The kit of claim 81 , wherein the buffer contains EDTA at a concentration of about 100 mM.87. The kit of claim 81 , wherein the non-processive endonuclease has specificity for N4-methylcytosine or N6-methyladenine.88. The kit of claim 81 , wherein the non-processive endonuclease is inhibited by C5-methylcytosine.89. The kit of claim 81 , wherein the non-processive endonuclease comprises a detectable label.90. The kit of claim 81 , wherein the non-processive endonuclease is biotinylated.91. A kit for segregating a target nucleic acid from a mixed sample containing a target nucleic acid and a non-target nucleic acid claim 81 , comprising:(i) a non- ...

Extraction of nucleic acids

The invention relates to a nucleic acid extraction material which comprises at least one ion exchange material and PVPP.

Cassette For Sample Preparation

Apparatuses for preparing a sample are disclosed herein. The apparatuses include a chamber, a first valve at least partially disposed in the first chamber, a second valve at least partially disposed in the first chamber, and a pump comprising an actuator and nozzle.

METHOD FOR ISOLATING NUCLEIC ACIDS

The current disclosure provides methods and kits for isolating nucleic acid from an environmental sample. The current methods and compositions further provide methods for isolating nucleic acids by reducing adsorption of nucleic acids by charged ions and particles within an environmental sample. The methods of the current disclosure provide methods for isolating nucleic acids by releasing adsorbed nucleic acids from charged particles during the nucleic acid isolation process. The current disclosure facilitates the isolation of nucleic acids of sufficient quality and quantity to enable one of ordinary skill in the art to utilize or analyze the isolated nucleic acids for a wide variety of applications including, sequencing or species population analysis. 1. A method for isolating nucleic acids from an environmental sample , comprising:(i) obtaining an environmental sample comprising cells;(ii) subjecting the sample to a lysis process comprising mixing the sample with a lysis solution in the presence of liquid nitrogen, thereby obtaining a lysed material;(iii) subjecting the lysed material to an extraction process by mixing the lysed material with an extraction solution, and subjecting the resulting mixture to centrifugation;(iv) collecting the supernatant after the centrifugation;(v) washing the pellet obtained after the centrifugation of step (iii) with a wash solution comprising sodium phosphate at a concentration of at least 300 mM, and collecting the supernatant from the wash; and(vi) combining the collected supernatants from step (iv) and step (v), and isolating nucleic acids from the collected supernatants.2. The method of claim 1 , wherein the environmental sample is selected from the group consisting of soil claim 1 , clay claim 1 , sediment claim 1 , water or liquid claim 1 , and a combination thereof.3. The method of claim 1 , wherein said lysis solution comprises sodium phosphate at a concentration of at least 300 mM.4. The method of claim 1 , wherein said ...

Devices and methods for concentration and analysis of fluids

Disclosed are articles, compositions and methods for detecting analytes. The disclosed articled, compositions and methods increase the ease of detection and quantitation of the target analyte.